SnRNA for correcting protein C defect caused by exon-intron boundary mutation and application thereof

Abstract

The invention discloses snRNA for correcting protein C defects caused by exon-intron boundary mutation and application of the snRNA. Specific U1 small nuclear RNA (U1snRNA) and U7 small nuclear RNA (U7snRNA) are designed for protein C defects caused by abnormal mRNA splicing due to PROC gene exon-intron boundary mutation, so that recognition of 5'splicing sites is enhanced or recovered, and activated potential splicing sites are shielded. The small nuclear RNA is expressed through respective expression vectors, and corresponding U1snRNA or U7snRNA is correspondingly designed for each mutation. Cell experiment results show that the U1snRNA and the U7snRNA can remarkably recover correct splicing of abnormal PROC transcripts and improve the expression level and the functional activity of protein C. The invention provides a small nuclear RNA strategy based on RNA, which has potential gene therapy application value.

Description

Technical Field

[0001] This invention relates to a snRNA for correcting protein C defects caused by exon-intron boundary mutations and its application, specifically to a specific U1 small nuclear RNA (U1snRNA) and U7 small nuclear RNA (U7snRNA) for correcting protein C defects caused by exon-intron boundary mutations and their application, belonging to the fields of bioengineering and molecular medicine. Background Technology

[0002] Protein C (PC) is a vitamin K-dependent serine protease that plays a crucial regulatory role in the coagulation cascade. Activation of protein C (APC) forms a complex with protein S, inhibiting the activity of coagulation factors V and VIII, thus maintaining blood coagulation homeostasis. Protein C deficiency (PCD) can lead to a hypercoagulable state and is an important genetic risk factor for venous thromboembolism (VTE) and recurrent thrombosis. In Asian populations, hereditary PCD is relatively common and forms an important genetic basis for thrombophilia. The clinical manifestations of PCD vary significantly, ranging from asymptomatic carriers to life-threatening conditions such as severe thrombosis, infantile purpuric necrosis, and disseminated intravascular coagulation.

[0003] Hereditary PCD is primarily caused by variations in the PROC gene. Heterozygous variations significantly increase the risk of VTE, while biallelic variations, though rare, often lead to severe early-onset PCD. To date, over 500 PROC gene variations have been reported, including missense, nonsense, synonymous, splice sites, and small deletions or insertions. These variations can affect protein expression, stability, or function, resulting in highly variable clinical phenotypes. In particular, variations located at the exon-intron boundary (±20 bp) primarily disrupt pre-mRNA splicing, producing abnormal transcripts and thus reducing protein C expression or function. Since PROC is mainly synthesized in the liver, its mRNA is almost undetectable in blood cells, limiting the effectiveness of traditional splicing analysis methods that rely on peripheral blood RNA.

[0004] Currently, the main clinical treatment for PCD (percutaneous thrombotic disease) is still anticoagulants, including direct thrombin inhibitors (such as dabigatran) and factor Xa inhibitors (such as rivaroxaban). These drugs typically require long-term, even lifelong, medication, with regular monitoring of coagulation function and thrombotic risk to prevent bleeding or thrombotic events. Although anticoagulants can reduce the risk of recurrent thrombosis, they are essentially only symptomatic treatment and cannot restore the normal levels or function of protein C in the body. Furthermore, long-term medication not only increases the economic burden but may also lead to poor medication adherence, bleeding complications, or liver and kidney damage. Especially in China and East Asian populations, the rate of hereditary protein C deficiency is relatively high, which has become an important genetic basis for thrombophilia, but large-scale epidemiological data and molecular mechanism studies are still relatively insufficient. Therefore, developing targeted intervention strategies that can directly restore protein C expression or function has significant clinical and social health value. Summary of the Invention

[0005] The purpose of this invention is to address the problem of abnormal mRNA splicing caused by mutations at the exon-intron junction of the PROC gene (such as c.658C>T, c.659G>A, c.677A>G, c.678G>A, c.678G>C, c.678+9C>T). This invention provides a specific U1-snRNA and U7-snRNA strategy for correcting abnormal mRNA splicing in the PROC gene and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a snRNA expression vector, wherein the snRNA expression vector is a U1-snRNA expression vector or a U7-snRNA expression vector; wherein...

[0008] The U1-snRNA expression vector is a wild-type U1-snRNA expression vector obtained by inserting a U1-snRNA fragment into a pSP64 vector via a BamHI restriction site, wherein the nucleotide sequence of the U1-snRNA gene fragment is shown in SEQ ID NO: 1;

[0009] The U7-snRNA expression vector is a wild-type U7-snRNA expression vector obtained by inserting the U7-snRNA gene fragment into the pSP64 vector through the BamHI restriction site, wherein the nucleotide sequence of the U7-snRNA gene fragment is shown in SEQ ID NO: 8.

[0010] In a second aspect, the present invention provides a U1snRNADEL vector, wherein the U1snRNADEL vector is obtained by using the U1-snRNA expression vector described in the first aspect as a template and removing the sequence between the Bcll and BglII restriction sites by double digestion with Bcll and BglII, and its nucleotide sequence is shown in SEQ ID NO: 3.

[0011] Thirdly, the present invention provides a U7snRNADEL vector, which is obtained by removing the histone antisense base sequence in the U7snRNA plasmid by site-directed mutagenesis using the U7-snRNA expression vector described in the first aspect as a template, and its nucleotide sequence is shown in SEQ ID NO: 11.

[0012] Fourthly, the present invention provides a method for constructing the U1snRNADEL vector as described in the second aspect, comprising the following steps:

[0013] Using the wild-type U1-snRNA expression vector described in the first aspect as a template, the fragment between the two was removed by double digestion with BclI and BglII, and then the plasmid loop was closed by T4 DNA ligase to obtain the U1snRNADEL vector.

[0014] Fifthly, the present invention provides a method for constructing the U7snRNADEL vector as described in the third aspect, comprising the following steps:

[0015] Using the wild-type U7-snRNA expression vector described in the first aspect as a template, site-directed mutagenesis was performed using a site-directed mutagenesis kit to remove the histone antisense base sequence in the U7snRNA plasmid, thereby obtaining the U7snRNADEL vector. The site-directed mutagenesis primers used are shown in SEQ ID NO: 9-10.

[0016] In a sixth aspect, the present invention provides a specific U1-snRNA vector targeting specific exon-intron boundary mutations in the PROC gene. The specific U1-snRNA vector uses the U1snRNADEL vector described in the second aspect as a template, and inserts a recognition sequence targeting the exon-intron boundary mutation between the Bcl I and Bgl II restriction sites through homologous recombination, thereby constructing a specific U1-snRNA vector to enhance the recognition of the true donor site and correct abnormal mRNA splicing. The specific U1-snRNA vector is selected from the following four types:

[0017] i) U1snRNA_WT, used to correct c.658C>T, c.659G>A and c.678+9C>T mutations (non-classical sites), its binding sequence is shown in SEQ ID NO: 4;

[0018] ii) U1snRNA_-2A_G, used to correct the c.677A>G mutation (classical donor site), its binding sequence is shown in SEQ ID NO: 5;

[0019] iii) U1snRNA_-1G_A, used to correct the c.678G>A mutation (classical donor site), its binding sequence is shown in SEQ ID NO: 6;

[0020] iv) U1snRNA_-1G>C, used to correct the c.678G>C mutation (classical donor site), its binding sequence is shown in SEQ ID NO: 7.

[0021] In a seventh aspect, the present invention provides a specific U7-snRNA vector targeting specific exon mutations in the PROC gene. The specific U7-snRNA vector uses the U7snRNADEL vector described in the third aspect as a template, and inserts recognition sequences targeting upstream and downstream sequences of the exon mutation at a predetermined insertion site through homologous recombination, thereby constructing the specific U7-snRNA vector. The specific U7-snRNA vector shown is selected from the following three types:

[0022] i) U7snRNA_c.658C_T, used to target the c.658C>T mutation, its recognition sequence covers 10bp upstream and downstream of the mutation, and the binding sequence is shown in SEQ ID NO: 12;

[0023] ii) U7snRNA_c.659G_A, used to target the c.659G>A mutation, its recognition sequence covers 10 bp upstream and downstream of the mutation, and the binding sequence is shown in SEQ ID NO: 13;

[0024] iii) U7snRNA_c.678_9C_T, used to target the c.678+9C>T mutation, has a recognition sequence covering 10 bp upstream and downstream of the mutation, and the binding sequence is shown in SEQ ID NO: 14.

[0025] The U7-snRNA vector effectively restores abnormal mRNA splicing by masking abnormal splicing signals or cryptic sites within exons, thereby enhancing exon definition and improving the identification of true donor sites.

[0026] Eighthly, the present invention provides the use of a specific U1-snRNA vector as described in the sixth aspect or a specific U7-snRNA vector as described in the seventh aspect in the preparation of a gene therapy agent targeting protein C deficiency-related thrombotic diseases.

[0027] In a ninth aspect, the present invention provides a method for constructing a mini gene reporter vector PROC-E7-WT plasmid for analyzing the splicing of exon 7 of the PROC gene. The method uses plasmid pTB as a template and inserts the target fragment of the PROC gene into the Nde I restriction site of plasmid pTB by homologous recombination to obtain the PROC-E7-WT plasmid. The target fragment sequence of the PROC gene is shown in SEQ ID NO: 15, including a portion of intron 6 of the PROC gene, the complete exon 7, and a portion of the intron 7 sequence.

[0028] In a tenth aspect, the present invention provides a mini gene reporter vector PROC-E7-WT plasmid for analyzing the splicing of the seventh exon of the PROC gene, which is constructed using the construction method described in the ninth aspect of the present invention.

[0029] In the eleventh aspect, the present invention provides a method for constructing a PROC-E7 splicing reporter vector. The method involves using the mini-gene reporter vector PROC-E7-WT plasmid as described in the tenth aspect as a template, and introducing specific mutations through homologous recombination or synthetic sequences to obtain corresponding mutant mini-gene vectors, including: c.658C>T, c.658C>A, c.659G>A, c.659G>C, c.660G>A, c.666C>T, c.666C>G, c.673T>G, c.675G>A, c.677A>G, c.678G>A, c.678G>C, c.678+9C>T, c.678+10G>A, and c.678+20C>T.

[0030] In this context, c.658, c.659, c.660, etc., represent nucleotide numbers, which are sequence positions relative to the PROC coding region of the reference gene. The coding region positions are counted starting from the ATG start codon, with each nucleotide numbered sequentially. Suffixes such as "+9" or "+10" indicate that the mutation is located at the 9th or 10th base of the intron sequence following the exon. For example, c.658C>T indicates that cytosine (C) at the 658th nucleotide position in exon 7 has been replaced by thymine (T).

[0031] In a twelfth aspect, the present invention provides a mini gene reporter vector for analyzing the effect of exon 7 mutation of the PROC gene on mRNA splicing. The vector is constructed using the construction method described in the eleventh aspect. Each mutant vector can be constructed using site-directed mutagenesis primers. The vector can be used to verify the effect of the corresponding mutation on mRNA splicing in cells, thereby providing an experimental basis for designing specific U1-snRNA or U7-snRNA targeting the mutation.

[0032] In a thirteenth aspect, the present invention provides the use of mini gene reporter vectors as described in the tenth or twelfth aspect in screening therapeutic agents for protein C deficiency-related thrombotic diseases.

[0033] In a fourteenth aspect, the present invention provides a method for analyzing in vitro repair of abnormal splicing of exon 7 of the PROC gene by a specific U1-snRNA vector as described in the sixth aspect of the present invention or a specific U7-snRNA vector as described in the seventh aspect of the present invention, comprising: co-transfecting HEK293T cells with the mini gene reporter vector as described in the tenth or twelfth aspect and the corresponding specific snRNA expression plasmid, collecting cells after transfection, extracting total RNA, reverse transcribing to synthesize cDNA, amplifying the target fragment by RT-PCR, and analyzing the ratio of normal and abnormal splicing products by agarose gel electrophoresis and Sanger sequencing.

[0034] This invention provides a method and gene therapy agent for correcting protein C deficiency (a type of thrombophilia) caused by exon-intron boundary mutations in the PROC gene through RNA intervention. Specifically, using specific U1snRNA or U7snRNA vectors, abnormal mRNA splicing is restored in in vitro cells or mini-gene models to generate correct protein C transcripts, thereby increasing the expression level and functional activity of protein C. This invention also provides corresponding U1snRNA and U7snRNA expression vectors and their construction methods, as well as a technical solution for evaluating the effect of specific RNA intervention using in vitro splicing reporter vectors, providing experimental evidence for future preclinical research and the development of potential RNA therapies.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1. Precise Repair of Abnormal mRNA Splicing: This invention designs specific U1 / U7-snRNAs that can precisely identify and repair PROC gene mutation sites, restoring normal mRNA splicing. This method overcomes the limitations of traditional gene therapy in effectively addressing splicing abnormalities and improves the repair efficacy against mutated splicing defects.

[0037] 2. Simplified operation process: This invention improves the snRNA construction method by using the U1 / U7 snRNADEL vector, which makes the design and synthesis of specific snRNA more convenient. It can be completed with only one site-directed mutagenesis operation, which greatly reduces the complexity and time cost of the experiment.

[0038] 3. Wide applicability: This technology is not only applicable to the repair of PROC gene splicing abnormalities, but also has the potential for wide application. It can be extended to other hereditary diseases involving splicing site mutations, providing new treatment ideas for abnormal splicing caused by various gene mutations.

[0039] 4. Reduced treatment costs: Compared with traditional protein C replacement therapy, this invention can fundamentally restore the normal expression and function of protein C by repairing the splicing defects of autologous genes, which is expected to reduce patients' dependence on exogenous protein C replacement therapy and reduce long-term treatment costs.

[0040] 5. Potential commercial value: This invention provides a new tool for gene therapy based on mRNA splicing repair, with significant application prospects and commercialization potential. In particular, it provides a gene therapy agent for the treatment of protein C deficiency-related thrombotic diseases, and provides technical support for the development and application of related gene therapies. Attached Figure Description

[0041] Figure 1 Structural characteristics of protein C and distribution of PROC mutations involved in this study:

[0042] (A) Crystal structure and schematic diagram of protein C, showing an overview of each domain of protein C (SP-GLA-EGF-catalytic domain); the selected PROC mutation is marked in red; SP, signal peptide; GLA, γ-carboxyglutamate domain; EGF, epidermal growth factor-like domain;

[0043] (B) Schematic diagram of the regions where protein C interacts with other coagulation factors: EPCR, endothelial protein C receptor; PS, protein S; FVa, activated coagulation factor V; related amino acid residues are also marked.

[0044] (C) Schematic diagram of the location and structural distribution of 15 selected PROC mutations in the genome.

[0045] Figure 2 Results of splicing function analysis of 15 PROC mutation mini-genes:

[0046] (A) Schematic diagram of splicing product pattern obtained after transfecting HEK293T cells with variants of PROC exon 7 and intron 7; right side is schematic diagram of splicing product; NT, normal transcript; Ex, exon; Del, deletion;

[0047] (B) Schematic diagram of all tested variants classified according to splicing results; each point represents a single variant, light gray indicates no effect on splicing, colored indicates mutations that affect splicing, classified by mechanism;

[0048] (CG) Representative splicing results illustration:

[0049] (C) The use of hidden 5' splicing sites within exons leads to partial exon deletion;

[0050] (D) The use of hidden 5' splice sites within introns results in the retention of some introns;

[0051] (E) Exon skipping completely;

[0052] (F) No abnormal splicing was detected;

[0053] (G) Complex splicing patterns used by exon skipping combined with exon or intron 5' splicing sites;

[0054] The top icons on each panel represent the corresponding splicing modes; the bottom diagrams show the splice isoforms and their corresponding Sanger sequencing results; and the red triangles indicate the splice junction locations.

[0055] Figure 3 The repair effects of engineered U1 snRNA and U7 snRNA on PROC variant aberration splicing:

[0056] (A) Schematic diagram of engineered U1snRNA (U1snRNA_WT, U1snRNA_-2A_G, U1snRNA_-1G_A, U1snRNA_-1G>C) and U7snRNA (U7snRNA_c.658C_T, U7snRNA_c.659G_A, U7snRNA_c.678_9C_T) used in this invention; the blue box contains uppercase letters of the exon sequence, and the box contains lowercase letters of the intron sequence; the PROC mutation position is shown in bold red;

[0057] (B) Schematic diagram of splicing patterns after transfection of wild-type PROC or specified mutant into HEK293T cells, either alone or co-transfected with the corresponding U1 / U7 snRNA;

[0058] (C) Schematic diagram of transcripts; Ex, exon; NT, normal transcript; Del, deletion; Ins, insertion; Histogram shows the proportion of each transcript quantified by denaturing capillary electrophoresis, with results being the mean ± standard deviation of three independent experiments.

[0059] Figure 4 Analysis of splicing aberrations and repair of PROC c.658C>T and c.659G>A mutations by denaturing capillary electrophoresis:

[0060] Denaturing capillary electrophoresis pattern of fluorescently labeled RT-PCR products; X-axis represents fragment size (bp), and Y-axis represents relative fluorescence units (RFUs).

[0061] Figure 5 Analysis of splicing aberrations and repair in PROC c.677A>G and c.678G>A mutations by denaturing capillary electrophoresis:

[0062] Denaturing capillary electrophoresis pattern of fluorescently labeled RT-PCR products; X-axis represents fragment size (bp), and Y-axis represents relative fluorescence units (RFUs).

[0063] Figure 6 Analysis of splicing aberrations and repair in PROC c.678G>C and c.678+9C>T mutations by denaturing capillary electrophoresis:

[0064] Denaturing capillary electrophoresis pattern of fluorescently labeled RT-PCR products; X-axis represents fragment size (bp), and Y-axis represents relative fluorescence units (RFUs). Detailed Implementation

[0065] To make the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0066] Example 1: Method for constructing wild-type U1-snRNA expression vector

[0067] A method for constructing a wild-type U1-snRNA expression vector involves inserting a synthetically produced U1-snRNA target fragment (SEQ ID NO:1) into the BamHI insertion site of the pSP64 vector via homologous recombination (homological splicing assembly) with overlapping homologous arms at both ends of the vector, thereby obtaining a wild-type U1-snRNA expression vector. The method includes the following steps:

[0068] (1) Based on the human U1-snRNA sequence (SEQ ID NO:1), nucleotide fragments homologous to the sequences flanking the BamHI restriction site of the pSP64 vector were added to both ends of the sequence, and the structure of the synthesized fragment was designed as "left homologous arm—U1-snRNA target sequence—right homologous arm". The fragment was synthesized by BGI Genomics (China), and the sequence was verified to be correct by sequencing.

[0069] atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggcttatccattgcactccgg atgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttc ccctg (SEQ ID NO: 1)

[0070] (2) Vector linearization: Take 1 μg of pSP64 plasmid and digest it with BamHI restriction endonuclease (NEB, USA) in a 50 μL reaction system. The system includes: 1 μL BamHI, 1 μg plasmid DNA, 5 μL 10×NEB Buffer, and ddH2O to a final volume of 50 μL. Incubate at 37℃ for 30 min to obtain the linearized vector.

[0071] (3) Enzyme digestion product purification: The enzyme digestion product from step (2) was purified using the SanPrep column PCR product purification kit (Sangon Biotech, China) to obtain a linearized vector backbone.

[0072] (4) Homologous recombination reaction: The synthetic fragment from step (1) and the linearized vector from step (3) are prepared in the recommended ratio (molar ratio of vector to insert fragment 1:2–1:3), and then... Homologous recombination reactions were performed using HiFi DNA Assembly Master Mix (NEB, USA). A 20 μL system consisted of: 50 ng linearized vector, an appropriate amount of insert fragment, 10 μL reaction solution, and the remainder to be made up to ddH2O. The mixture was incubated at 37°C for 30 min to obtain the recombinant product.

[0073] (5) Transformation: 3 μL of homologous recombinant product was transformed into 50 μL of Trans1-T1 competent cells (TransGold, China), placed on ice for 30 min, heat-shocked at 42℃ for 90 s, 500 μL of SOC medium was added, and the cells were recovered in a shaker at 37℃ for 45 min. The cells were then spread on ampicillin plates and incubated at 37℃ overnight.

[0074] (6) Clone screening and sequencing: Twenty single colonies were picked and inoculated into 2 mL of LB medium containing ampicillin. The colonies were cultured at 37°C and 250 rpm for 18 h. Plasmids were extracted and Sanger sequencing was performed for verification. Positive clones with correct sequencing were selected.

[0075] (7) Amplification and Plasmid Preparation: The sequenced and correctly identified clone (SEQ ID NO: 2) was amplified and cultured. 400 μL of bacterial culture was first inoculated into 400 mL of LB medium (containing ampicillin), and the culture was incubated at 37°C and 250 rpm for 18 h. Extract plasmids using the XtraMidi kit (MACHEREY-NAGEL, Germany) and store at -20°C for later use.

[0076]

[0077] Example 2: Construction method of U1snRNADEL vector

[0078] Using the wild-type U1-snRNA plasmid as a template, the fragment between the two was removed by double digestion with Bcl I and Bgl II. The plasmid circularity was then closed using T4 DNA ligase to obtain the U1snRNADEL vector (SEQ ID NO: 3). The specific procedures are as follows:

[0079] (1) Double enzyme digestion reaction: In a 50 μL reaction system, add 1 μg of U1-snRNA wild-type plasmid, 1 μL of Bcl I enzyme, 1 μL of Bgl II enzyme, 5 μL of 10×CutSmart Buffer (NEB, USA), and ddH2O to a final volume of 50 μL. Incubate at 37℃ for 30 min to obtain the linearized plasmid product.

[0080] (2) Electrophoresis and fragment recovery: The enzyme digestion products were subjected to 2% agarose gel electrophoresis, and the linearized plasmid bands were excised and purified using a gel purification kit (Kangwei Century, China).

[0081] (3) Ligation reaction: Take 50 ng of the recovered linearized plasmid backbone and prepare the ligation reaction system according to the instructions: 20 μL total volume, including 2 μL 10×T4 DNA ligase buffer (NEB, USA), 1 μL T4 DNA ligase (NEB, USA), and ddH2O to make up the volume. Incubate at 37℃ for 30 min to obtain the ligation product. Since the sticky ends generated by Bcl I and Bgl II are compatible, a heterozygous site is formed after ligation, thereby removing the fragment between the two.

[0082] (4) Transformation: Take 3 μL of ligation reaction solution to transform 50 μL of competent cells (Trans1-T1, TransGold, China), incubate on ice for 30 min, heat shock at 42℃ for 90 s, recover for 45 min, spread on ampicillin-containing plates, and culture at 37℃ overnight.

[0083] (5) Cloning screening and sequencing identification: Several single-clone colonies were selected for amplification culture, plasmids were extracted and sequenced to identify plasmids that were missing the fragment between Bcl I and Bgl II, which was U1snRNADEL (SEQ ID NO: 3).

[0084] (6) Plasmid preparation and preservation: The bacterial culture with correct sequencing was amplified and cultured, using... Plasmids were extracted using the XtraMidi kit (MACHEREY-NAGEL, Germany), and the resulting U1snRNADEL vector was stored at -20°C for later use.

[0085] The sequence of the U1snRNADEL vector obtained in this embodiment is shown below (SEQ ID NO: 3):

[0086]

[0087] Example 3

[0088] The method for constructing a specific U1-snRNA vector (U1snRNA WT and its mutants) targeting exon 7 of the PROC gene includes the following steps:

[0089] (1) Design and synthesis of specific U1-snRNA fragments

[0090] Based on the 5' splice site sequence of exon 7 of the PROC gene, a U1-snRNA sequence (U1snRNA_WT) capable of specifically recognizing this site was designed. Simultaneously, three mutants were constructed targeting the conserved pairing regions at positions -2 and -1:

[0091] U1snRNA_-2A>G: An A→G mutation is introduced at the -2 base position;

[0092] U1snRNA_-1G>A: A G→A mutation is introduced at the -1 base position;

[0093] U1snRNA_-1G>C: A G→C mutation is introduced at the -1 base position.

[0094] All of the above sequences were synthesized by BGI Genomics (China) through DNA fragment synthesis.

[0095] (2) Carrier construction

[0096] The synthesized U1-snRNA fragment was designed with homologous arms at both ends, and it underwent homologous recombination with the linearized fragment of the pSP64 expression plasmid (digested with BamHI).

[0097] Reorganization system use Assemble using the IIOne Step Cloning Kit (Vazyme, China) and follow the instructions.

[0098] (3) Transformation and Screening

[0099] The recombinant product was added to competent cells (Trans1-T1, TransGold, China), incubated on ice for 30 min, heat-shocked at 42°C for 90 s, and recovered for 45 min before being plated on ampicillin-containing plates and incubated overnight at 37°C. Single clones were picked for small-scale culture, plasmids were extracted, and Sanger sequencing was performed to verify the correctness of the inserted fragment sequence and mutations.

[0100] (4) Plasmid amplification and preservation

[0101] The correctly identified strain was inoculated into 400 mL of LB medium and cultured overnight at 37°C with shaking at 250 rpm. Plasmids were prepared using the Xtra Midi kit (MACHEREY-NAGEL, Germany), and the resulting plasmids were named as follows:

[0102] U1snRNA_WT (wild-type sequence targeting PROC exon 7) (SEQ ID NO: 4)

[0103] U1snRNA_-2A>G (SEQ ID NO: 5)

[0104] U1snRNA_-1G>A (SEQ ID NO: 6)

[0105] U1snRNA_-1G>C (SEQ ID NO: 7), sequence verification is as follows:

[0106] GGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCCCAAGATCTCATTCCCACCTGGCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCC (SEQ ID NO: 4);

[0107] GGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCCCAAGATCTCATTCCCACCCGGCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCC (SEQ ID NO: 5);

[0108] GGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCCCAAGATCTCATTCCCACTTGGCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCC (SEQ ID NO: 6);

[0109] GGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCCCAAGATCTCATTCCCACGTGGCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCC (SEQ ID NO: 7);

[0110] All plasmids were stored at -20°C for later use.

[0111] Example 4: Method for constructing wild-type U7-snRNA expression vector

[0112] A method for constructing a wild-type U7-snRNA expression vector involves inserting a synthetically produced U7-snRNA target fragment (SEQ ID NO:8) into the BamHI insertion site of the pSP64 vector via homologous recombination (homological splicing assembly) with overlapping homologous arms at both ends of the vector, thereby obtaining a wild-type U7-snRNA expression vector. The method includes the following steps:

[0113] (1) Based on the human U7-snRNA sequence (SEQ ID NO: 8), nucleotide fragments homologous to the sequences flanking the SmaⅠ restriction site of the pSP64 vector were added to both ends of the sequence, and the structure of the synthesized fragment was designed as "left homologous arm—U7-snRNA target sequence—right homologous arm". The fragment was synthesized by BGI Genomics (China), and the sequence was verified to be correct by sequencing.

[0114] (SEQ ID NO: 8)

[0115] The construction method is the same as that described in Example 1 for constructing the wild-type U1-snRNA expression vector.

[0116] Example 5: Construction method of U7snRNADEL vector

[0117] Using wild-type U7-snRNA plasmid as a template, site-directed mutagenesis was performed using the Quickchange Lightning site-directed mutagenesis kit from Agilent Technologies to remove histone antisense base sequences from the U7-snRNA plasmid, resulting in the U7-snRNADEL vector. Primers were designed according to the instructions on the website (https: / / www.agilent.com.cn / store / primerDesignProgram.jsp). The site-directed mutagenesis primer sequences are as follows:

[0118] F: 5'-AAACCTGCTCCAAAAATTGCGGAAAGGCCTCTGTAG-3' (SEQ ID NO: 9)

[0119] R: 5'-CTACAGAGGCCTTTCCGCAATTTTTGGAGCAGGTTT-3' (SEQ ID NO: 10)

[0120] The specific steps for the above site-directed mutation are as follows:

[0121] (1) Site-directed mutagenesis reaction system 50 μL: including 5 μL 10×Raction Buffer, 1 μL DNA template (U1-snRNA wild-type vector, 20 ng / μL), 1.25 μL each of forward and reverse primers (10 μM), 1.5 μL QuickSolutionReagent, 1 μL QuickChange Lightning Enzyme, and 39 μL ddH2O.

[0122] (2) The PCR reaction program was: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, 60℃ annealing for 10 s, 68℃ extension for 5 min, for a total of 18 cycles.

[0123] (3) After the reaction is complete, add 2 μL of Dpn I restriction endonuclease (Agilent Technologies, USA) to the reaction product, gently mix the liquid in the tube with a pipette, and then place it on a 37℃ metal bath for 30 min to digest and remove the site-directed mutation template plasmid.

[0124] (4) Take 4 μL of the site-directed mutagenesis PCR product and add it to 50 μL of competent cells, then transform and plate the cells. After overnight culture, select several single-clone colonies for amplification and sequencing identification. Select the site-directed mutagenesis bacterial cultures that have been correctly identified by sequencing for bacterial amplification and plasmid extraction. Store the extracted U7snRNADEL vector at -20℃ for later use.

[0125] The partial sequence of the U7snRNADEL vector obtained in this embodiment is shown below (SEQ ID NO: 11):

[0126] CACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGG CTCGCTACAGAGGCCTTTCCGCAATTTTTGGAGCAGGTTTTCTGACTTCGG TCGGAAAACCCCTCCCAAGTTAACTGGTCTACAATGAAAG (SEQ ID NO: 11).

[0127] Example 6

[0128] Construction method of specific U7-snRNA vectors (U7snRNA_c.658C_T, U7snRNA_c.659G_A and U7snRNA_c.678_9C_T) targeting exon 7 of the PROC gene:

[0129] (1) Design and synthesis of specific U7-snRNA fragments

[0130] Based on the sequence characteristics of exon 7 of the PROC gene and its splicing donor site, a U7-snRNA sequence capable of specific binding was designed, and three different mutations were introduced based on this sequence:

[0131] U7snRNA_c.658C_T: A C→T mutation is introduced at the c.658 site;

[0132] U7snRNA_c.659G_A: A G→A mutation is introduced at the c.659 site;

[0133] U7snRNA_c.678_9C_T: A C→T mutation is introduced at the c.678+9 site.

[0134] The above U7-snRNA fragments were all synthesized by BGI Genomics (China) and were verified to be correct by sequencing.

[0135] (2) Carrier construction

[0136] The synthesized fragment was joined at both ends with homologous arms to the linearized fragment of the pSP64 expression plasmid (digested with BamHI), and inserted using homologous recombination. The recombination system adopted... IIOne Step Cloning Kit (Vazyme, China) - Operate according to the instruction manual.

[0137] (3) Transformation and Screening

[0138] The recombinant product was transformed into Trans1-T1 competent cells (TransGold, China), incubated on ice for 30 min, heat-shocked at 42°C for 90 s, and recovered for 45 min. The cells were then plated on ampicillin-containing plates and cultured overnight at 37°C. Single clones were picked for small-scale culture, plasmids were extracted, and Sanger sequencing was performed to verify the correctness of the inserted fragments and mutations.

[0139] (4) Plasmid amplification and preservation

[0140] Clones that were correctly sequenced were inoculated into 400 mL of LB medium (containing ampicillin) and cultured overnight at 37°C with shaking at 250 rpm. Plasmids were extracted using the Xtra Midi kit (MACHEREY-NAGEL, Germany).

[0141] The recombinant plasmids obtained were named respectively

[0142] U7snRNA_c.658C_T (SEQ ID NO: 12)

[0143] U7snRNA_c.659G_A (SEQ ID NO: 13)

[0144] U7snRNA_c.678_9C_T (SEQ ID NO: 14);

[0145] Sequence verification is as follows:

[0146] CACCCTCATCGAAAGTGGAGTTGATGTCCTCCTGGCTCGCTACAGA GGCCTTTCCGCCTGTCTCCCCACCTGGTCATCAATTTTTGGAGCAGGTTTTC TGACTTCGGTCGGAAAACCCCTCCCAAGTTAACTGGTCTACAATGAAAG (SEQ ID NO: 12)

[0147] CACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGAGGCCTTTCCGCTGTCTCCCTGCCTGGTCATCTAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAAGTTAACTGGTCTACAATGAAAG (SEQ ID NO: 13)

[0148] CACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGA GGCCTTTCCGCGTGCTGCCTCACCTCCCACCTAATTTTTGGAGCAGGTTTTC TGACTTCGGTCGGAAAACCCCTCCCAAGTTAACTGGTCTACAATGAAAG (SEQ ID NO: 14)

[0149] All plasmids were stored at -20°C for later use.

[0150] Example 7

[0151] Construction method of PROC gene exon 7 splicing analysis reporter vector (PROC-E7-WT plasmid)

[0152] Using the plasmid vector pTB, which is used to study in vitro mRNA splicing, a mini gene vector named PROC-E7-WT was constructed to analyze the normal and mutant splicing of exon 7 of the PROC gene. To this end, a portion of intron 6, the complete exon 7, and a portion of intron 7 of the PROC gene were inserted into plasmid pTB. The construction steps are as follows:

[0153] (1) Fragment design and synthesis

[0154] Based on the sequence information of exon 7 of the PROC gene and its upstream and downstream splicing regulatory regions, a DNA fragment (SEQ ID NO: 15) containing a complete exon and approximately 400–500 bp introns before and after it was designed. Sequences homologous to the pTB multiple cloning site were added to both ends of the fragment for homologous recombination insertion. The designed fragment was synthesized by BGI Genomics and validated by sequencing.

[0155]

[0156] (2) Carrier linearization

[0157] Take the pTB plasmid and linearize it at the Nde I cloning site to facilitate subsequent homologous recombination insertion.

[0158] (3) Homologous recombination insertion

[0159] Using a homologous recombination kit (such as ClonExpress II, Vazyme, China), the synthesized PROC-E7 fragment was inserted into a linearized pTB plasmid. The recombinant product was obtained after the reaction was complete.

[0160] Homologous recombination insertion

[0161] Using a homologous recombination kit (such as ClonExpress II, Vazyme, China), the synthesized PROC-E7 fragment was inserted into a linearized pTB plasmid. The recombinant product was obtained after the reaction was complete.

[0162] (4) Transformation and Screening

[0163] 5 μL of the recombinant product was transformed into competent E. coli, heat-shocked at 42°C for 90 s, and then recovered. The culture was plated on LB agar containing ampicillin and incubated overnight at 37°C. Several single colonies were randomly selected for small-scale plasmid extraction and sent for sequencing to verify the correctness of the inserted fragment.

[0164] (5) Amplification and plasmid extraction

[0165] Large-scale culture of correctly sequenced positive clones was performed using... Plasmid DNA was extracted using the Xtra Midi kit (MACHEREY-NAGEL, Germany) to obtain the PROC-E7-WT splicing analysis plasmid, which was stored at -20°C for later use.

[0166] This plasmid can be used for subsequent in vitro analysis of the splicing pattern of exon 7 of the PROC gene and serves as the basis for constructing corresponding mutant vectors (such as the target mutant of U1snRNA_WT).

[0167] Example 8

[0168] Method for constructing the PROC gene exon 7 splicing analysis reporter vector (PROC-E7- mutant plasmid):

[0169] Using the wild-type PROC-E7-WT mini gene plasmid (obtained in Example 4) as a backbone, a splicing analysis vector targeting different nucleotide variations in exon 7 of the PROC gene was constructed. The mutation sites studied included:

[0170] c.658C>T, c.658C>A, c.659G>A, c.659G>C, c.660G>A, c.666C>T, c.666C>G, c.673T>G, c.675G>A, c.677A>G, c.678G>A, c.678G>C, c.678+9C>T, c.678+10G>A, c.678+20C>T (see Figure 1 The construction steps are as follows:

[0171] (1) Fragment design and synthesis

[0172] Based on the aforementioned mutation sites and exon 7 sequence information, corresponding single-base mutations were introduced into the fragment. Sequences homologous to the pTB multiple cloning site were added to both ends of the fragment for homologous recombination insertion. The designed fragment was synthesized and sequenced by BGI Genomics.

[0173] (2) Carrier linearization

[0174] Take the PROC-E7-WT plasmid and linearize it at the multiple cloning site to facilitate subsequent homologous recombination insertion.

[0175] (3) Homologous recombination insertion

[0176] Using a homologous recombination kit (such as ClonExpress II, Vazyme, China), each synthetic mutant fragment was inserted into a linearized plasmid to obtain the corresponding PROC-E7- mutant plasmid.

[0177] (4) Transformation and Screening

[0178] The recombinant product was transformed into competent E. coli, and after culturing, single colonies were picked for small-scale plasmid extraction and sequencing to verify the correctness of the mutated fragment and the integrity of the exon sequence.

[0179] (5) Amplification and plasmid extraction

[0180] Large-scale culture of correctly sequenced positive clones was performed using... The plasmid DNA extracted using the Xtra Midi kit was stored at -20°C for subsequent in vitro splicing analysis.

[0181] Example 9

[0182] In vitro mini gene mRNA splicing analysis

[0183] Based on the PROC-E7- mutant mini gene plasmid constructed in Example 5, in vitro mRNA splicing analysis was performed using human embryonic kidney 293T cells (HEK293T). HEK293T cells are suitable as a model for mRNA splicing research due to their high transfection efficiency and mature splicing mechanism.

[0184] (1) Cell culture and transfection

[0185] 1) Cell resuscitation and culture: The cryopreserved HEK293T cells were rapidly thawed in a 37°C water bath, resuspended in DMEM medium containing 10% fetal bovine serum, centrifuged to remove the cryoprotectant, and then seeded into 10cm culture dishes and cultured at 37°C with 5% CO2.

[0186] 2) Cell passage: When the cells grow to a suitable density, wash with 1×PBS, add 0.25% trypsin to digest and then stop digestion, centrifuge and resuspend, and passage to 12-well plates for further culture.

[0187] 3) Plasmid transfection: When cell confluence reaches 70–80%, mix 500 ng of PROC-E7-WT or the corresponding mutant plasmid with 100 μL of Opti-MEM; separately, mix 2 μL of Lipofectamine 2000 with 100 μL of Opti-MEM, let stand for 5 minutes, then mix again, let stand for another 30 minutes, and add to the cell wells. Change the culture medium 6 hours after transfection and continue culturing.

[0188] (2) Cell collection and RNA extraction

[0189] 1) 24 hours after transfection, discard the culture medium, wash the cells with PBS, add 0.25% trypsin to digest and stop digestion, and collect the cell pellet.

[0190] 2) Resuspend the cells in 1 mL of Trizol reagent and mix thoroughly for total RNA extraction.

[0191] 3) RNA extraction was performed using the Trizol-chloroform method. Isopropanol was used to precipitate RNA, which was then washed with ethanol and dissolved in RNase-free water. RNA quality was determined by agarose gel electrophoresis and NanoDrop.

[0192] (3) cDNA synthesis and PCR amplification

[0193] 1) Use a reverse transcription kit to reverse transcribe RNA into cDNA while removing genomic DNA.

[0194] 2) Amplify the target fragment using specific primers. PCR conditions: 25.5 μL reaction volume, 30 cycles. Primer sequences are as follows:

[0195] F: 5'-CAACTTCAAGTCCCTAAGCCACTGC-3' (SEQ ID NO: 16)

[0196] R: 5'-TGATTTAACCAACTTCCTGGTGACC-3' (SEQ ID NO: 17)

[0197] (4) Validation and quantification of splice products

[0198] 1) TA cloning and sequencing: Purify the PCR product, ligate it into the pMD19-T vector, transform competent bacteria and select single clones for sequencing to verify the splicing product sequence.

[0199] 2) Fluorescent PCR combined with capillary electrophoresis: PCR products with FAM label at the 5' end were used for capillary electrophoresis analysis to calculate the peak area ratio of different splicing products and assess the frequency of abnormal splicing events.

[0200] (5) Result Example

[0201] In vitro mini-gene analysis revealed that most of the 15 PROC exon 7-related variants (including 3 intron variants and 12 exon mutations) resulted in aberrant mRNA splicing. The wild-type PROC-E7-WT plasmid produced predominantly normal transcripts, while the mutant plasmid generated a variety of aberrant splicing products, including exon skipping, partial exon deletion, activation of cryptic 5' splice donor sites, or partial intron retention. Specifically (see...) Figure 2 ):

[0202] 1. Activation of cryptic donor splicing sites with partial exon deletion: For example, the c.658C>T mutation leads to activation of cryptic donor splicing sites on exons and results in partial exon deletion.

[0203] 2. Activation of cryptic donor splicing sites with partial intron retention: For example, the c.678+9C>T mutation activates cryptic donor splicing sites on introns, resulting in the retention of some intron fragments.

[0204] 3. Deletion of the entire exon: For example, mutations such as c.677A>G and c.678G>C disrupt the true splicing donor site, resulting in the deletion of the entire exon 7.

[0205] 4. Complex splicing patterns: such as c.659G>A and c.678G>A mutations simultaneously exhibiting complex combinations of exon deletion, occult donor splicing site activation with partial exon deletion, and occult donor splicing site activation with partial intron retention.

[0206] 5. No splicing abnormalities were observed: No significant splicing changes were observed in the remaining 9 mutations.

[0207] These results demonstrate that PROC exon 7 mutations can disrupt normal splicing through multiple mechanisms, highlighting the importance of mini-gene function analysis in accurately determining the pathogenic mechanisms of variants.

[0208] Example 10

[0209] Detection of the correction efficiency of specific U1-snRNA and U7-snRNA for abnormal splicing of exon 7 of PROC gene.

[0210] (1) Cell resuscitation

[0211] For detailed operating procedures, please refer to Example 9 – Cell Resuscitation.

[0212] (2) Cell passage

[0213] For detailed operating procedures, please refer to Example 9 – Cell Passage.

[0214] (3) Plasmid cotransfection

[0215] 1) The PROC gene exon 7 mutant splicing reporter vectors (including c.658C>T, c.659G>A, c.678+9C>T, c.677A>G, c.678G>A and c.678G>C mutants) were co-transfected into HEK293T cells with the corresponding specific snRNA expression plasmids.

[0216] 2) For c.658C>T, c.659G>A, and c.678+9C>T mutations, use U1snRNA_WT and U7snRNA_c.658C_T / U7snRNA_c.659G_A / U7snRNA_c.678_9C_T;

[0217] 3) For the c.677A>G mutation, use U1snRNA_-2A>G;

[0218] 4) For the c.678G>A mutation, use U1snRNA_-1G>A;

[0219] 5) For the c.678G>C mutation, U1snRNA_-1G>C was used.

[0220] The plasmid transfection molar ratio is 1:1.5. For other specific operating steps, please refer to Example 9 - Plasmid Transfection.

[0221] (4) mRNA splicing analysis

[0222] Cells were collected 24 hours after transfection, total RNA was extracted, cDNA was synthesized by reverse transcription, the target fragment was amplified by RT-PCR, and the ratio of normal and abnormal splicing products was analyzed by agarose gel electrophoresis and Sanger sequencing.

[0223] (5) The test results show:

[0224] 1) In c.658C>T, c.659G>A, and c.678+9C>T mutant reporter vectors, specific U1 snRNA_WT and the corresponding U7 snRNA can significantly increase the correct splicing ratio of exon 7 (the normal product ratio is increased to about 40%–65%) (see Figure 3 , 4 and 6);

[0225] 2) In the c.677A>G, c.678G>A, and c.678G>C mutant reporter vectors, the corresponding U1snRNA mutants (-2A>G, -1G>A, -1G>C) can partially or significantly restore the normal mRNA splicing level of exon 7 (see...). Figure 3 , 5 and 6).

[0226] In summary, both specific U1-snRNA and U7-snRNA can repair aberrant splicing in different PROC gene exon 7 mutation backgrounds, verifying the application potential of snRNA-based splicing regulation strategies in the treatment of diseases related to genetic protein C defects.

[0227] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make several improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. A snRNA expression vector, characterized in that, The snRNA expression vector is either a U1-snRNA expression vector or a U7-snRNA expression vector; wherein... The U1-snRNA expression vector is a wild-type U1-snRNA expression vector obtained by inserting a U1-snRNA fragment into a pSP64 vector via a BamHI restriction site, wherein the nucleotide sequence of the U1-snRNA gene fragment is shown in SEQ ID NO: 1; The U7-snRNA expression vector is a wild-type U7-snRNA expression vector obtained by inserting the U7-snRNA gene fragment into the pSP64 vector through the BamHI restriction site, wherein the nucleotide sequence of the U7-snRNA gene fragment is shown in SEQ ID NO:

8.

2. A U1snRNADEL vector, characterized in that, The vector obtained by using the wild-type U1-snRNA expression vector described in claim 1 as a template and removing the sequence between the Bcl I and Bgl II restriction sites by double digestion with Bcl I and Bgl II is shown in SEQ ID NO:

3.

3. A U7snRNADEL vector, characterized in that, The vector obtained by removing histone antisense base sequences in the U7snRNA plasmid through site-directed mutagenesis using the wild-type U7-snRNA expression vector described in claim 1 as a template has the nucleotide sequence shown in SEQ ID NO:

11.

4. A method for constructing the U1snRNADEL vector as described in claim 2, characterized in that, Includes the following steps: Using the wild-type U1-snRNA expression vector described in claim 1 as a template, the fragment between the two was removed by double digestion with Bcl I and Bgl II, and then the plasmid loop was closed by T4 DNA ligase to obtain the U1snRNADEL vector.

5. A method for constructing the U7snRNADEL vector as described in claim 3, characterized in that, Includes the following steps: Using the wild-type U7-snRNA expression vector described in claim 1 as a template, site-directed mutagenesis was performed using a site-directed mutagenesis kit to remove the histone antisense base sequence in the U7snRNA plasmid, thereby obtaining the U7snRNADEL vector. The site-directed mutagenesis primers used are shown in SEQ ID NO: 9-10.

6. A specific U1-snRNA vector targeting specific exon-intron boundary mutations in the PROC gene, characterized in that, Using the U1snRNADEL vector described in claim 2 as a template, a recognition sequence targeting exon-intron boundary mutations is inserted between the Bcl I and Bgl II restriction sites via homologous recombination, thereby constructing a specific U1-snRNA vector to enhance the recognition of the true donor site and correct abnormal mRNA splicing; the specific U1-snRNA vector is selected from the following four types: i) U1snRNA_WT, used to correct c.658C>T, c.659G>A and c.678+9C>T mutations (non-classical sites), its binding sequence is shown in SEQ ID NO: 4; ii) U1snRNA_-2A_G, used to correct the c.677A>G mutation, its binding sequence is shown in SEQ ID NO: 5; iii) U1snRNA_-1G_A, used to correct the c.678G>A mutation, has the binding sequence shown in SEQ ID NO: 6; iv) U1snRNA_-1G>C, used to correct the c.678G>C mutation, has the binding sequence shown in SEQ ID NO:

7.

7. A specific U7-snRNA vector targeting specific exon mutations in the PROC gene, characterized in that, Using the U7snRNADEL vector of claim 3 as a template, a specific U7-snRNA vector is constructed by inserting a recognition sequence targeting the upstream and downstream sequences of the exon mutation at a predetermined insertion site through homologous recombination; the specific U7-snRNA vector shown is selected from the following three types: i) U7snRNA_c.658C_T, used to target the c.658C>T mutation, its recognition sequence covers 10bp upstream and downstream of the mutation, and the binding sequence is shown in SEQ ID NO: 12; ii) U7snRNA_c.659G_A, used to target the c.659G>A mutation, its recognition sequence covers 10 bp upstream and downstream of the mutation, and the binding sequence is shown in SEQ ID NO: 13; iii) U7snRNA_c.678_9C_T, used to target the c.678+9C>T mutation, has a recognition sequence covering 10 bp upstream and downstream of the mutation, and the binding sequence is shown in SEQ ID NO:

14.

8. The use of the specific U1-snRNA vector of claim 6 or the specific U7-snRNA vector of claim 7 in the preparation of gene therapy agents, characterized in that, The gene therapy agent targets protein C deficiency-related thrombotic diseases.

9. A method for constructing a mini gene reporter vector PROC-E7-WT plasmid for analyzing exon 7 splicing of the PROC gene, characterized in that, Using plasmid pTB as a template, the target fragment of the PROC gene was inserted into the Nde I restriction site of plasmid pTB by homologous recombination to obtain the PROC-E7-WT plasmid. The sequence of the target fragment of the PROC gene is shown in SEQ ID NO: 15, including part of the 6th intron of the PROC gene, the complete 7th exon, and part of the 7th intron sequence.

10. A mini gene reporter vector PROC-E7-WT plasmid for analyzing the splicing of the 7th exon of the PROC gene, characterized in that, It is constructed using the construction method described in claim 9.

11. A method for constructing a PROC-E7 splicing report carrier, characterized in that, By using the mini gene reporter vector PROC-E7-WT plasmid as described in claim 10 as a template, specific mutations are introduced through homologous recombination or synthetic sequences to obtain corresponding mutant mini gene vectors, including: c.658C>T, c.658C>A, c.659G>A, c.659G>C, c.660G>A, c.666C>T, c.666C>G, c.673T>G, c.675G>A, c.677A>G, c.678G>A, c.678G>C, c.678+9C>T, c.678+10G>A, and c.678+20C>T.

12. A mini gene reporter vector for analyzing the effect of exon 7 mutation of the PROC gene on mRNA splicing, characterized in that, It is constructed using the construction method described in claim 11.

13. The use of the mini gene reporter vector of claim 10 or 12 in screening therapeutic agents for protein C deficiency-related thrombotic diseases.

14. A method for in vitro analysis of the repair of abnormal splicing of exon 7 of the PROC gene by the specific U1-snRNA vector of claim 6 or the specific U7-snRNA vector of claim 7, characterized in that, include: The mini gene reporter vector described in claim 10 or 12 was co-transfected with the corresponding specific snRNA expression plasmid into HEK293T cells. After transfection, cells were collected, total RNA was extracted, cDNA was synthesized by reverse transcription, the target fragment was amplified by RT-PCR, and the ratio of normal and abnormal splicing products was analyzed by agarose gel electrophoresis and Sanger sequencing.

Images