Marker for predicting prognosis of ovarian cancer and application of marker

By revealing the role of the BRD4-H4K12la-Ube2v1 pathway in ovarian cancer, we provide BRD4, H4K12la, and Ube2v1 as prognostic biomarkers and therapeutic targets for ovarian cancer, thus addressing the problem of poor prognosis in ovarian cancer and enabling more accurate prediction and effective targeted therapy.

CN121856554APending Publication Date: 2026-04-14RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511671318.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

In the current technology, the role and influence of histone H4K12 lactylation modification in the occurrence and development of ovarian cancer have not been fully elucidated, resulting in poor prognosis of ovarian cancer and a lack of effective predictive biomarkers and therapeutic targets.

Method used

BRD4 was discovered to be a histone lactyltransferase that promotes ovarian cancer cell proliferation through the BRD4-H4K12la-Ube2v1 pathway. BRD4, H4K12la, and Ube2v1 were provided as biomarkers for predicting the prognosis of ovarian cancer, and BRD4 inhibitors, H4K12la inhibitors, and Ube2v1 inhibitors were developed for the treatment of ovarian cancer.

Benefits of technology

By detecting the expression levels of BRD4, H4K12la, and Ube2v1 in ovarian cancer tissues, the prognosis of ovarian cancer can be predicted, and related inhibitors can be used to inhibit the proliferation of ovarian cancer cells, providing a new targeted treatment method for ovarian cancer and improving patient prognosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121856554A_ABST
    Figure CN121856554A_ABST
Patent Text Reader

Abstract

The invention relates to a marker for predicting the prognosis of ovarian cancer and application thereof, and the marker is used for predicting the prognosis condition of ovarian cancer by detecting any one or more of BRD4, H4K12la and Ube2v1. Compared with the prior art, it is found for the first time that BRD4 can be used as a histone milk acylation transferase to enzymatically modify a histone lysine site H4K12, so that the histone lysine site H4K12 is subjected to milk acylation modification, then gene transcription of Ube2v1 is increased, and proliferation and growth of ovarian cancer cells are promoted. The invention not only discovers that BRD4 can be used as histone milk acylation transferase to play a new function of milk acylation modification, but also clarifies the effect of the BRD4-H4K12la-Ube2v1 pathway in the growth process of the ovarian cancer, and provides a new method for targeted therapy of the ovarian cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a biomarker for predicting the prognosis of ovarian cancer and its application. Background Technology

[0002] Ovarian cancer is a gynecological tumor with a high mortality rate. Despite advancements in treatment methods such as surgery, platinum-based chemotherapy, targeted drugs, and immunotherapy, the prognosis remains poor, with a 5-year survival rate of less than 40% [doi: 10.3322 / caac.21559]. Imbalanced histone modifications caused by abnormal expression of epigenetic regulatory factors are a crucial mechanism in the development and progression of ovarian cancer. Researchers have for the first time revealed a novel post-translational modification of histone lysine residues—lysine lactation (Kla) [doi:10.1038 / s41586-019-1678-1]. Lactate, a precursor metabolite, induces histone Kla modification, which plays a key role in regulating the homeostasis of M1 macrophages under bacterial infection.

[0003] However, research on the mechanisms of histone lactylation modification in the development and progression of ovarian cancer is insufficient. Currently, only a few studies have pointed out the role of H3K18 lactylation modification (H3K18la) in ovarian cancer: high expression of H3K18la is associated with poor prognosis and chemotherapy resistance in ovarian cancer patients [doi: 10.4149 / neo_2024_240127N41]. Lactate in the tumor microenvironment activates CCL18 in macrophages through lactylation modification of H3K18, thereby inducing macrophage M2 polarization and promoting the proliferation and migration of ovarian cancer cells [doi: 10.3724 / abbs.2024111]. Tanshinone I can inhibit lactate production, thereby reducing H3K18la levels, which in turn downregulates the expression of oncogenes TTK, PDGFRβ, YTHDF2, and RUBCNL, inhibiting ovarian cancer growth [doi:10.1016 / j.ijbiomac.2024.139072]. Studies have shown that in niraparib-resistant ovarian cancer cells, abnormal activation of the glycolysis pathway leads to lactate accumulation, resulting in upregulation of H4K12la levels in ovarian cancer cells. This upregulation, in turn, enhances super-enhancer-mediated RAD23A expression, thereby increasing the DNA damage repair capacity of ovarian cancer cells and promoting drug resistance [doi: 10.1186 / s12943-025-02295-w]. These results indicate that histone H3K18 lactylation plays a crucial role in the development and progression of ovarian cancer, while the impact of H4K12 mammaryization on ovarian cancer and its prognosis urgently needs further investigation and clarification. Summary of the Invention

[0004] The purpose of this invention is to explore the association between H4K12la and ovarian cancer, thereby providing a biomarker for predicting the prognosis of ovarian cancer and its application.

[0005] This invention reveals that H4K12la levels are elevated in ovarian cancer tissue compared to normal ovarian tissue and are associated with poor prognosis in ovarian cancer patients. Furthermore, it is the first to discover that H4K12la can promote Ube2v1 expression and thus promote ovarian cancer cell proliferation by enriching in the Ube2v1 promoter region. Ube2v1 expression levels are associated with poor prognosis in ovarian cancer patients; Ube2v1 can promote ovarian cancer cell proliferation and inhibit apoptosis, thus serving as a novel potential target for targeted therapy of ovarian cancer.

[0006] Ube2v1, as an E2 allosteric variant of the ubiquitin ligase, forms a complex with Ubc13, participating in protein ubiquitination and thus promoting tumorigenesis and development. Studies have found that in colorectal cancer, Ube2v1 promotes Ubc13-mediated ubiquitination, leading to Sirt1 protein degradation by the proteasome, inhibiting H4K16 acetylation, ultimately suppressing autophagy gene expression and promoting colorectal cancer metastasis. However, the role and prognostic value of Ube2v1 in the development and progression of ovarian cancer remain unresolved.

[0007] BRD4 is the fourth most frequently amplified gene in high-grade serous ovarian cancer. BRD4 is known to act as a "recognizer" rather than a "modifier" in histone acetylation, specifically recognizing histone acetylation sites. This invention is the first to discover that BRD4 possesses histone lactyltransferase activity, inducing lactylation of H4K12, and subsequently promoting ovarian cancer cell proliferation and inhibiting apoptosis through the BRD4-H4K12la-Ube2v1 pathway.

[0008] The objective of this invention can be achieved through the following technical solutions: One of the technical solutions of the present invention provides the use of a substance for detecting proteins in the preparation of products for predicting the prognosis of ovarian cancer, wherein the protein is selected from any one or more of BRD4, H4K12la, and Ube2v1.

[0009] In some specific embodiments, the substance used to detect the protein refers to a reagent capable of specifically detecting whether a protein is expressed and / or detecting the amount of protein expression.

[0010] The second technical solution of the present invention provides a product for predicting the prognosis of ovarian cancer, including a substance for detecting proteins, wherein the proteins are selected from any one or more of BRD4, H4K12la, and Ube2v1.

[0011] In some specific embodiments, the product comprises at least one of reagents, reagent kits, test strips, and chips.

[0012] The third technical solution of the present invention provides a drug for treating ovarian cancer and / or poor prognosis of ovarian cancer, wherein the drug includes any one or more of BRD4 inhibitors, H4K12la inhibitors, and Ube2v1 inhibitors.

[0013] In some specific embodiments, the H4K12la inhibitor is selected from any one of BRD4 inhibitors, glycolysis inhibitor 2-DG, and oxamate.

[0014] In some specific embodiments, the BRD4 inhibitor is selected from any one of BET bromodomain inhibitor, CP1203, SF2523, dBET1, Dbet57, A1874, MZ1, and ZEN-3862.

[0015] In some specific embodiments, the BRD4 inhibitor includes any one of the sequences shown in SEQ ID NO. 13 and 14.

[0016] In some specific embodiments, the Ube2v1 inhibitor is selected from any one or more of BRD4 inhibitors, H4K12la inhibitors, oxamate, and glycolysis inhibitor 2-DG.

[0017] In some specific embodiments, the Ube2v1 inhibitor includes any one of the sequences shown in SEQ ID NO. 13, 14, 6, 7, 9, 10, 11.

[0018] Compared with existing technologies, this invention has the following advantages: It is the first discovery that BRD4 can act as a histone lactyltransferase, enzymatically modifying the histone lysine site H4K12, causing lactylation modification, thereby increasing Ube2v1 gene transcription and promoting the proliferation and growth of ovarian cancer cells. This invention suggests that BRD4-H4K12la-Ube2v1 can serve as a series of linked drugs for the treatment of ovarian cancer and / or poor prognosis of ovarian cancer. This invention not only discovers that BRD4 can perform a novel function of lactylation modification as a histone lactyltransferase, but also elucidates the role of the BRD4-H4K12la-Ube2v1 pathway in the growth process of ovarian cancer, providing a new method for targeted therapy of ovarian cancer. Attached Figure Description

[0019] Figure 1 Statistical chart showing the difference in H4K12la levels between normal ovarian tissue and ovarian cancer tissue detected by immunohistochemistry. Figure 2 Kaplan-Meier curves of PFS and OS in patients with low / high H4K12la levels. Figure 3The level of H4K12la in normal ovarian epithelial cells and ovarian cancer cells was detected by cellular immunofluorescence. Figure 4 Immunoblotting results of H4K12la protein in ovarian cancer cells after up- and down-regulating lactate levels, respectively. Figure 5 CCK8 assay was used to detect the cell viability of ovarian cancer cells after treatment with PBS, 2-DG, oxamate, and lactate. Figure 6 EdU assay was used to detect the cell proliferation capacity of ovarian cancer cells after treatment with PBS, 2-DG, oxamate, and lactate. Figure 7 Annexin V / PI double staining flow cytometry was used to detect the apoptosis level of ovarian cancer cells after treatment with PBS, 2-DG, and oxamate. Figure 8 JC-1 mitochondrial membrane potential assay was used to detect the early apoptosis level of ovarian cancer cells after treatment with PBS, 2-DG, and oxamate. Figure 9 The goal is to screen for genes that simultaneously meet the criteria of upregulated expression after lactate treatment, downregulated expression after 2-DG treatment, and the intersection of target genes that bind to H4K12la in both HEY and A2780 cells. Figure 10 Statistical graph showing the difference in Ube2v1 levels between normal ovarian tissue and ovarian cancer tissue detected by immunohistochemistry. Figure 11 Kaplan-Meier curves of PFS and OS in patients with low / high Ube2v1 levels. Figure 12 RT-PCR was used to detect changes in Ube2v1 mRNA expression in ovarian cancer cells after treatment with PBS, oxamate, lactate, and 2DG. Figure 13 Immunoblotting results of H4K12la level and Ube2v1 protein after oxamate and lactate treatment of ovarian cancer cells. Figure 14 Dual-luciferase reporter gene assay was used to detect the promoter activity of Ube2v1 in ovarian cancer cells after oxamate treatment. Figure 15 ChIP-qPCR was used to detect the binding enrichment of H4K12la in the Ube2v1 promoter region of ovarian cancer cells after oxamate treatment. Figure 16 Immunoimprinting of Ube2v1 protein in ovarian cancer cells after siRNA interference with Ube2v1 expression. Figure 17 The viability of ovarian cancer cells after siRNA interference with Ube2V1 expression was detected using CCK8 assay. Figure 18 EdU assay was used to detect the proliferation of ovarian cancer cells after siRNA interference with Ube2V1 expression. Figure 19 Flow cytometry was used to detect the cell cycle of ovarian cancer cells after siRNA interference with Ube2V1 expression. Figure 20Annexin V / PI double staining flow cytometry was used to detect the apoptosis ability of ovarian cancer cells after siRNA interference with Ube2v1 expression. Figure 21 JC-1 mitochondrial membrane potential assay was used to detect early apoptosis in ovarian cancer cells after siRNA interference with Ube2v1 expression. Figures 22-33 Figure 1 shows the late apoptosis of HEY and A2780 cells after siRNA interference with Ube2v1 expression, detected by TUNEL staining. Figure 24 After constructing a stable Ube2v1 knockdown transgene of HEY cells, the Ube2v1 knockdown efficiency was detected by protein immunoblotting. Figure 25 Plate clone assays were used to detect the cell proliferation levels of Ube2v1-KD and Ube2v1-NC cells. Figure 26 A schematic diagram illustrating the use of a histone-modified compound library to screen for a set of compounds that downregulate H4K12la in ovarian cancer cells. Figure 27 The heatmap illustrates the target classification and enrichment of 23 small molecule inhibitors in HEY and A2780 that can downregulate H4K12la levels. The left vertical axis represents the family to which the small molecule inhibitor target belongs, and the right scale bar represents the H4K12la / H4 level ratio as detected by protein immunoblotting after treating ovarian cancer cells with the small molecule inhibitor. The horizontal axis represents the number of small molecule inhibitors. Figure 28 Immunoblot results of H4K12la-Ube2v1 pathway proteins after treatment of ovarian cancer cells with different BET inhibitors. Figure 29 Statistical graph showing the difference in BRD4 levels between normal ovarian tissue and ovarian cancer tissue detected by immunohistochemistry. Figure 30 Kaplan-Meier curves of PFS and OS in patients with low / high BRD4 levels. Figure 31 Immunohistochemical staining was used to detect the expression correlation of the BRD4-H4K12la-Ube2v1 pathway in ovarian cancer (EOC) tissue microarrays. The left side shows the expression levels of BRD4, H4K12la, and Ube2v1 in ovarian cancer tissues with low (P1), moderate (P2), and high (P3) expression of the BRD4-H4K12la-Ube2v1 pathway. The right side shows the Pearson correlation test results for BRD4, H4K12la, and Ube2v1 levels. Figure 32 Immunoblot results of proteins interfering with BRD4 expression and the H4K12la-Ube2v1 pathway in ovarian cancer cells. Figure 33 Immunoblotting results of proteins overexpressing BRD4 and the H4K12la-Ube2v1 pathway in ovarian cancer cells. Figure 34 After overexpression of BRD4, lactate levels in HEY and A2780 were measured. Figure 35After the BRD4 recombinant protein underwent an in vitro enzymatic reaction with the H4K12 peptide, the mass spectra of the H4K12 peptide undergoing lactylation modification were detected by Maldi-TOF / TOF. Figure 36 ChIP-qPCR was used to detect the enrichment of BRD4 in the promoter region where H4K12la and Ube2v1 bind before and after interfering with BRD4 expression in ovarian cancer cells. Detailed Implementation

[0020] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. Unless otherwise defined, all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0021] The technical solution of the present invention includes: First, to reveal the promoting effect of H4K12la on ovarian cancer growth.

[0022] Specifically, immunohistochemical detection of H4K12la levels in tissue microarrays of normal ovarian tissue and ovarian cancer tissue revealed elevated H4K12la levels in ovarian cancer tissue and a correlation with poor prognosis in ovarian cancer patients.

[0023] Specifically, the level of H4K12la in normal ovarian cell lines and ovarian cancer cell lines was detected by cellular immunofluorescence, and it was found that the level of H4K12la was elevated in the ovarian cancer cell line.

[0024] Specifically, after upregulating or downregulating lactate levels in ovarian cancer cells, changes in H4K12la levels in cells and alterations in the proliferation and apoptosis abilities of ovarian cancer cells were detected.

[0025] Second, we revealed a novel molecular mechanism by which H4K12la promotes ovarian cancer growth by enhancing Ube2v1 expression.

[0026] Specifically, CUT&Tag combined with RNA-seq technology was used for screening, and ChIP-PCR and dual-luciferase reporter gene experiments were used to confirm that H4K12la can activate the expression of Ube2v1.

[0027] Specifically, immunohistochemical analysis of tissue microarrays in normal ovarian tissue and ovarian cancer tissue revealed that Ube2v1 levels were elevated in ovarian cancer tissue and were associated with poor prognosis in ovarian cancer patients.

[0028] Specifically, siRNA was used to interfere with the expression of Ube2v1 in ovarian cancer cells or to construct ovarian cancer knockdown stable transgenes to detect changes in the proliferation and apoptosis abilities of ovarian cancer cells.

[0029] Third, it reveals that BRD4 can act as a histone lactyltransferase, lactylating and modifying H4K12, thereby promoting ovarian cancer growth through the BRD4-H4K12la-Ube2v1 pathway. Specifically, a library of histone-modified compounds was used to screen for small molecule inhibitors that could downregulate H4K12la, and the common target of the above small molecule compounds—BRD4—was enriched.

[0030] Specifically, immunohistochemical staining of BRD4 expression levels in tissue microarrays of normal ovarian tissue and ovarian cancer tissue revealed elevated BRD4 expression in ovarian cancer tissue, which was associated with poor prognosis in ovarian cancer patients. Pearson correlation analysis showed that the levels of BRD4, H4K12la, and Ube2v1 in ovarian cancer tissue were positively correlated.

[0031] Specifically, in vitro enzymatic experiments demonstrated that BRD4 can induce lactylation of the H4K12 peptide. Interference with or overexpression of BRD4 altered the expression of H4K12la-Ube2v1 in ovarian cancer cells.

[0032] Example 1: 1. Immunohistochemistry was used to detect the H4K12la level in tissue microarrays (including normal ovarian tissue from 21 patients and ovarian cancer tissue from 104 EOC patients). Aipathwell software was used to calculate the histochemical score of the H4K12la level in each ovarian cancer tissue microarray. Figure 1 The level of H4K12la in ovarian cancer tissue was significantly higher than that in normal ovarian tissue.

[0033] 2. Progression-free survival (PFS) and overall survival (OS) were collected from 104 ovarian cancer (EOC) patients using tissue microarrays. The impact of H4K12la levels on PFS and OS in ovarian cancer patients was analyzed using a log-rank test. Figure 2 As shown, ovarian cancer patients with high H4K12la levels had worse PFS and OS than those with low H4K12la levels.

[0034] 3. Prepare cell slides of epithelial ovarian cancer cell lines (HEY, A2780, OVCA433, SKOV3) and normal ovarian epithelial cells (IOSE80). Fix with 4% paraformaldehyde, permeabilize with 0.1% Triton X-100, and block with goat serum at room temperature for 1 h. Incubate overnight with H4K12la primary antibody, wash with PBS, and incubate with GFP-labeled secondary antibody. Stain with 1 μg / mL DAPI nuclear staining, mount, and detect. Figure 3 The level of H4K12la in ovarian cancer cell lines was significantly higher than that in normal ovarian epithelial cell lines.

[0035] 4. Ovarian cancer cell lines HEY and A2780 were treated with lactate (0-15 mM), 2-DG (0-6 mM), and oxamate (0-15 mM) for 24 h, respectively. Total protein was then extracted from the cells. After quantification using BCA, H4K12la and H4 were detected by immunoblotting. Figure 4 Lactate upregulates lactate levels, which can significantly upregulate H4K12la levels in ovarian cancer cells, while 2-DG and oxamate downregulate lactate levels, which can significantly downregulate H4K12la levels in ovarian cancer cells.

[0036] 5. 1000 HEY cells / well and 2000 A2780 cells / well were seeded into wells of a plate. After cell adhesion, the cells were treated with PBS, lactate (10 mM), 2-DG (4 mM), and oxamate (10 mM), respectively. CCK8 was added at 0, 24, 48, 72, and 96 h after drug treatment, and the OD450 absorbance was measured after 4 h of reaction. Figure 5 Lactate upregulates lactate levels and promotes the proliferation of ovarian cancer cells, while 2-DG and oxamate downregulate lactate levels and inhibit the proliferation of ovarian cancer cells.

[0037] 6. HEY and A2780 cells were seeded into 24-well plates. After adhesion, the cells were treated with PBS, lactate (10 mM), 2-DG (4 mM), and oxamate (10 mM) for 24 hours, respectively. Cell proliferation was measured using a 5-ethynyl-29-deoxyuridine (EDU) assay kit (Cellarlab, CX002). Figure 6 Lactate upregulates lactate levels and promotes the proliferation of ovarian cancer cells, while 2-DG and oxamate downregulate lactate levels and inhibit the proliferation of ovarian cancer cells.

[0038] 7. HEY and A2780 cells were seeded into well plates. After adhesion, the cells were treated with PBS, 2-DG (4 mM), and oxamate (10 mM) for 24 h, respectively. Cells were then collected and treated with 200 μL of Annexin V-fluorescein isothiocyanate solution at 4°C for 15 min, followed by treatment with 1 mL of propidium iodide (PI) for 5 min. The proportion of apoptotic cells was determined by flow cytometry. Figure 7 2-DG and oxamate downregulate lactate levels and promote apoptosis in ovarian cancer cells.

[0039] 8. HEY and A2780 cells were seeded into well plates. After adhesion, they were treated with PBS, 2-DG (4 mM), and oxamate (10 mM) for 24 h, respectively. The mitochondrial membrane potential was then detected using the JC-1 mitochondrial membrane potential assay kit (UElandy, J6004S). Normal cells with intact mitochondrial membrane potential emitted red fluorescence at 590 nm in the mitochondria; apoptotic / necrotic cells contained monomeric dyes and emitted green fluorescence at 530 nm. The red / green fluorescence intensity was calculated using ImageJ software. Figure 8 2-DG and oxamate downregulate lactate levels and promote early apoptosis in ovarian cancer cells.

[0040] Example 2: 1. CUT & Tag Detection of Target Sequences and Corresponding Target Genes Binding to H4K12la in HEY and A2780 Cells. HEY cells were treated with PBS, 2-DG (4 mM), and lactate (10 mM) for 24 hours. Cells were collected and RNA was extracted. RNA-seq was used to screen for genes downregulated after 2-DG treatment compared to the PBS group, and for genes upregulated after lactate treatment compared to the PBS group. Finally, genes in this gene set that can also bind to H4K12la were identified, and a Venn diagram was plotted. (See figure below.) Figure 9 As shown, through combined CUT&Tag and RNA-seq analysis, a total of 7 genes were screened in ovarian cancer cells. The expression levels of these genes were regulated by both lactate levels and H4K12la levels. These 7 genes are: WDR88, PVRIG, SHISAL1, IZUMO4, LPCAT1, Ube2v1, and OTX1.

[0041] 2. Immunohistochemistry was used to detect the expression level of Ube2v1 in the tissue microarray of Example 1 (including normal ovarian tissue from 21 patients and ovarian cancer tissue from 104 EOC patients). Aipathwell software was used to calculate the histochemical score of Ube2v1 expression level in each ovarian cancer tissue in the microarray. Figure 10 The level of H4K12la in ovarian cancer tissue was significantly higher than that in normal ovarian tissue.

[0042] 3. Log-rank test of the effect of Ube2v1 expression level on PFS and OS in ovarian cancer patients, such as Figure 11 Patients with high Ube2v1 expression levels had worse overall survival (OS) than those with low expression levels, but there was no significant difference in progression-free survival (PFS).

[0043] 4. HEY and A2780 cells were treated with PBS, lactate (10 mM), oxamate (10 mM), and 2DG (10 mM), respectively, and total RNA was extracted. The RNA was reverse transcribed into cDNA using the HiScript III RT SuperMix kit (Novizan, R323). PCR was performed using the ChamQ Universal SYBR qPCR Master mix (Novizan, Q711). The RT-PCR results are shown below. Figure 12 As shown, upregulating lactate levels with lactate promotes Ube2v1 mRNA expression, while downregulating lactate levels with oxamate and 2DG inhibits Ube2v1 mRNA expression. The forward and reverse primer sequences for Ube2v1 are shown in SEQ ID NO. 1-2, respectively. SEQ ID NO.1 (forward primer sequence of Ube2v1, 5`-3`): GGGGGGAAAACCTTAGTTCTA; SEQ ID NO.2 (reverse primer sequence of Ube2v1, 5`-3`): GTCTGACAATAAAAAGGCTGCT.

[0044] 5. HEY and A2780 cells were treated with lactate (0 mM, 5 mM, 10 mM, 20 mM) and oxamate (0 mM, 5 mM, 10 mM, 15 mM, 20 mM) for 24 h, respectively, and then total cellular protein was extracted. After BCA quantification, the levels of Ube2v1, GAPDH, H4K12la, and H4 in each treatment group were detected by protein immunoblotting. Figure 13 Lactate upregulates lactate levels and increases Ube2v1 protein expression, while oxamate downregulates lactate levels and inhibits Ube2v1 protein expression.

[0045] 6. The Ube2v1 promoter fragment (from -2000 bases to +20 bases, SEQ ID NO.3) was cloned into the NheI-HindIII restriction sites of the GV534 vector (Jikai Gene) containing firefly luciferase, resulting in GV534-Ube2v1. HEY cells were seeded in well plates. After cell adhesion, the cells were treated with PBS and oxamate (10 mM) for 24 h, and then co-transfected with either the *G. sarcodactylis* plasmid or the GV534-Ube2v1 empty vector plasmid. Luciferase activity was measured 48 h after transfection using a dual-luciferase reporter gene assay system (Promega, E1910) according to the instructions. Figure 14 As shown, downregulating lactate levels via oxamate can inhibit the transcriptional activity of the Ube2v1 gene.

[0046] SEQ ID NO.3 (Ube2v1 promoter fragment): 7. Chromatin immunoprecipitation assay was performed using the SimpleChIP® Plus kit (CST, 56383). The sonicated cross-linked chromatin was incubated overnight at 4°C with 10 μg of anti-H4K12la antibody (PTMBIO, PTM1411RM) or normal rabbit IgG (as a negative control). The presence of the Ube2v1 gene promoter sequence in the immunoprecipitated DNA was detected by PCR. Figure 15 As shown, H4K12la binds to the Ube2v1 promoter region, and oxamate can downregulate lactate levels, significantly reducing the H4K12la level in the Ube2v1 promoter region. The forward and reverse primer sequences of the Ube2v1-chip are shown in SEQ ID NO.4 and 5: SEQ ID NO.4 (Ube2v1-chip forward primer, 5'-3'): ggttgttgtagtctagcgttgg; SEQ ID NO.5 (Ube2v1-chip reverse primer, 5`-3`): aggaatggggcagaaactc.

[0047] 8. HEY and A2780 cells were seeded in well plates and, after adhesion, transiently transfected with siRNA using Lipofectamine 3000 reagent (Invitrogen) to interfere with Ube2v1 expression. The Ube2v1 siRNA sequence included the Ube2v1 si-3 and Ube2v1 si-4 sequences as shown in SEQ ID NO. 6 and 7, respectively. The control sequence was the Ube2v1-NC sequence as shown in SEQ ID NO. 8. After 48 h, total protein was extracted from the cells, quantified by BCA, and the levels of Ube2v1 and GAPDH in each treatment group were detected by protein immunoblotting. Figure 16 As shown, siRNA can significantly interfere with Ube2v1 expression.

[0048] SEQ ID NO.6 (Ube2v1 si-3, 5`-3`): GACGAAGACAUGACACUUATT; SEQ ID NO.7 (Ube2v1 si-4, 5`-3`): GGACCCAAGAGCCAUAUCATT; SEQ ID NO.8 (Ube2v1-NC, 5`-3`): UUCUCCGAACGUGUCACGUTT.

[0049] 9. HEY and A2780 cells were seeded into well plates. After adhesion, transient transfection with siRNA to interfere with Ube2v1 expression was performed using Lipofectamine 3000 reagent (Invitrogen). 24 hours later, cells from each treatment group were digested. 1000 HEY cells / well and 2000 A2780 cells / well were seeded into 96-well plates, respectively. CCK8 was added at 24, 48, and 72 h, and the OD450 absorbance was measured after 4 h of reaction. Figure 17 As shown, interfering with Ube2v1 expression can inhibit the proliferation of ovarian cancer cells.

[0050] 10. HEY and A2780 cells were seeded into well plates. After adhesion, Ube2v1-NC, Ube2v1 si-3, and Ube2v1 si-4 were transiently transfected with Lipofectamine 3000 reagent. Cell proliferation levels were measured 48 h later using an EdU assay kit. Figure 18 Interfering with Ube2v1 expression can inhibit the proliferation of ovarian cancer cells.

[0051] 11. HEY and A2780 cells were seeded into well plates. After adhesion, Ube2v1-NC, Ube2v1 si-3, and Ube2v1 si-4 were transiently transfected with Lipofectamine 3000 reagent for 48 h. Cells were then fixed overnight at 4°C with 1 mL of 70% ethanol solution. After washing with PBS, the cells were centrifuged to obtain cell pellets. 10 μL of PI and 10 μL of RNase A were added to 500 μL of staining solution (Yisheng, 40301) and mixed thoroughly to prepare the PI staining solution. This solution was added to the cell pellet and incubated at 37°C in the dark for 30 min. Flow cytometry was used for analysis, and ModFit software was used to analyze the cell cycle distribution of each treatment group. Figure 19 As shown, interfering with Ube2v1 expression can cause G2 / M phase arrest in ovarian cancer cells.

[0052] 12. HEY and A2780 cells were seeded into well plates. After adhesion, Ube2v1-NC and Ube2v1 si-4 were transiently transfected with Lipofectamine 3000 reagent, respectively. Cells were collected after 48 h and treated with 200 μL of annexin V-fluorescein isothiocyanate solution at 4℃ for 15 min, followed by treatment with 1 mL of PI for 5 min. The proportion of apoptotic cells was determined by flow cytometry. Figure 20 Interference with Ube2v1 expression can promote apoptosis in ovarian cancer cells.

[0053] 13. HEY and A2780 cells were seeded into well plates. After adhesion, Ube2v1-NC, Ube2v1 si-3, and Ube2v1 si-4 were transiently transfected with Lipofectamine 3000 reagent for 48 h. The mitochondrial membrane potential was then detected using the JC-1 mitochondrial membrane potential assay kit. Figure 21 Interference with Ube2v1 expression can promote early apoptosis in ovarian cancer cells.

[0054] 14. After placing cell slides in well plates, seeding HEY and A2780 cells and allowing them to adhere, transiently transfect Ube2v1-NC, Ube2v1 si-3, and Ube2v1 si-4 cells with Lipofectamine 3000 reagent for 48 hours. Then, fix each treatment group's cell slides with 4% paraformaldehyde at 4°C for 25 min. Wash with PBS, treat with 0.2% Triton X-100 solution at room temperature for 5 min, and wash again. Add 100 μL of 1× equilibration buffer to each slide and incubate at room temperature for 30 min. Add 50 μL of TdT incubation buffer (TUNEL apoptosis detection kit, Yisheng, 40306). Incubate the cell slides at 37°C for 60 min. Stain the cell nuclei with 2 μg / mL DAPI solution. Observe the green TUNEL fluorescence at 520±20 nm and the blue DAPI fluorescence at 460 nm under a fluorescence microscope. Figures 22-23 As shown, interfering with Ube2v1 expression can promote late-stage apoptosis in ovarian cancer cells.

[0055] 15. HEY cells were seeded in well plates and infected with Ube2v1 knockdown lentivirus (MOI=50) for 48 h. The cells were then treated with 2 μg / mL puromycin and passaged. After 3 passages, total cell protein was extracted, and after BCA quantification, the levels of Ube2v1 and GAPDH in each treatment group were detected by protein immunoblotting.

[0056] The Ube2v1 shRNA consisted of the shUbe2v1 sh-1, shUbe2v1 sh-2, and shUbe2v1 sh-3 sequences shown in SEQ ID NO. 9, 10, and 11, respectively, with the control sequence being the shUbe2v1 NC sequence shown in SEQ ID NO. 12. The sequences shown in SEQ ID NO. 9, 10, 11, and 12 were inserted between the AgeⅠ-EcoRI restriction sites of the GV493 lentiviral vector (Jikai Gene) to construct Ube2v1 knockdown lentivirus and control lentivirus, respectively. Figure 24 The level of Ube2v1 protein was significantly downregulated in Ube2v1 knockdown stable transfectants.

[0057] SEQ ID NO.9 (shUbe2v1 sh-1 sequence, 5`-3`): GGTGAGGAATTCAGGGCTTTC; SEQ ID NO.10 (shUbe2v1 sh-2 sequence, 5`-3`): GCCCTGACCTCCCTTGTTTA; SEQ ID NO.11 (shUbe2v1 sh-3 sequence, 5`-3`): ACCACCCAACACCTTCCATGA; SEQ ID NO. 12 (shUbe2v1 NC sequence, 5`-3`): TTCTCCGAACGTGTCACGT.

[0058] 16. The stable mutant strain of shUbe2v1 sh-3 was named Ube2v1-KD, and the control stable mutant strain was named Ube2v1-NC. 10 3 Two stable HEY Ube2v1-NC and Ube2v1-KD cell lines were seeded into wells of a plate, and 1 μg / mL puromycin was added to the culture medium for maintenance. After 15 days, once cell clones had formed, the cells were fixed in 4% paraformaldehyde for 15 min and then stained with 0.1% crystal violet solution. Cell clones with more than 50 cells were selected and counted. Figure 25 Knocking down Ube2v1 can significantly inhibit the proliferation of ovarian cancer cells.

[0059] Example 3: 1. Small molecule compounds (30 μM) of 444 histone modification-related proteins from the histone modification compound library were added to wells plated with HEY or A2780, and cellular proteins were collected after 24 h of treatment. After BCA quantification, the levels of H4K12la and H4 in each treatment group were detected by protein immunoblotting. Image J analysis of grayscale values ​​was used to calculate the H4K12la / H4 ratio. Figures 26-27 Compounds with ratios less than 0.75 in both HEY and A2780 cells were screened, resulting in 23 small molecule inhibitors. The targets of these 23 small molecule inhibitors were summarized and enriched, revealing that 8 were BET inhibitors (BET bromodomain inhibitor, CP1203, SF2523, dBET1, Dbet57, A1874, MZ1, and ZEN-3862), and BRD4 was a common target of these 8 BET inhibitors.

[0060] 2. HEY and A2780 cells were seeded in well plates. After adhesion, the cells were treated with 30 μM of the eight BET inhibitors mentioned above for 24 h, and then cell proteins were extracted. After BCA quantification, the levels of BRD4, Ube2v1, GAPDH, H4K12la, and H4 in each treatment group were detected by protein immunoblotting. ImageJ was used to analyze the gray values ​​and quantify them. Figure 28 As shown, eight BET inhibitors can significantly inhibit H4K12la levels and Ube2v1 expression. Among them, two PROTAC inhibitors targeting BRD4 have the most significant inhibitory effect on the H4K12la-Ube2v1 pathway: A1874 (number 201 in the figure) and MZ1 (number 262 in the figure).

[0061] 3. Immunohistochemistry was used to detect the BRD4 expression level in the tissue microarray of Example 1 (including normal ovarian tissue from 21 patients and ovarian cancer tissue from 104 EOC patients). Aipathwell software was used to calculate the histochemical score of the BRD4 expression level in each ovarian cancer tissue in the microarray. Figure 29 As shown, the expression level of BRD4 in ovarian cancer tissue was significantly higher than that in normal ovarian tissue.

[0062] 4. Log-rank test of the effect of BRD4 expression level on PFS and OS in ovarian cancer patients, such as Figure 30 Ovarian cancer patients with high BRD4 expression levels had worse progression-free survival (PFS) than those with low BRD4 levels, but there was no significant difference in overall survival (OS).

[0063] 5. The histochemical scores of BRD4, H4K12la, and Ube2v1 expression levels in ovarian cancer tissues from the tissue microarray of Example 1 (including normal ovarian tissue from 21 patients and ovarian cancer tissue from 104 EOC patients) were analyzed using the Pearson correlation test and plotted. Figure 31 As shown, the expression levels of BRD4, H4K12la, and Ube2v1 were positively correlated in ovarian cancer patient tissues.

[0064] 6. HEY and A2780 cells were seeded in well plates and, after adhesion, transiently transfected with siRNA using Lipofectamine 3000 reagent to interfere with BRD4 expression. After 48 h, total cell protein was extracted, quantified using BCA, and the levels of BRD4, H4K12la, Ube2v1, GAPDH, and H4 in each treatment group were detected by protein immunoblotting. The BRD4 siRNA sequences were the BRD4 si-1 and BRD4 si-3 sequences shown in SEQ ID NO. 13 and 14, respectively, with the control sequence being the BRD4-NC sequence shown in SEQ ID NO. 15. Figure 32As shown, after interfering with BRD4 expression, both H4K12la and Ube2v1 expression levels were downregulated.

[0065] SEQ ID NO.13 (BRD4 si-1 sequence, 5'-3'): CUAGAAACUUCCCAAAUGUTT; SEQ ID NO.14 (BRD4 si-3 sequence, 5`-3`): GCACAAUCAAGUCUAAACUTT; SEQ ID NO. 15 (BRD4-NC sequence, 5`-3`): UUCUCCGAACGUGUCACGUTT.

[0066] 7. HEY and A2780 cells were seeded into well plates. After adhesion, they were transiently transfected with a plasmid overexpressing BRD4 (OE-BRD4, Ceregene Biotech, Cat# TCREG-10036) and a control plasmid (NC-OE, Ceregene Biotech, Cat# TCREG-10000) using Lipofectamine 3000 reagent. After 48 h, total protein was extracted from the cells. After BCA quantification, the levels of BRD4, H4K12la, Ube2v1, GAPDH, and H4 in each treatment group were detected by protein immunoblotting. Figure 33 After overexpression of BRD4, the levels of H4K12la and Ube2v1 were both upregulated.

[0067] 8. Seed HEY and A2780 cells into 6-well plates and transfect them with OE-BRD4 or NC-OE plasmids, respectively, for 48 h. Take 5*10 cells... 6 Cells were analyzed using an L-LA assay kit (Sologbio, BC2235) to detect intracellular lactate levels. A T-test was used to compare the differences in intracellular lactate levels after BRD4 overexpression. Figure 34 As shown, there was no significant difference in lactate content in ovarian cancer cells after BRD4 overexpression.

[0068] 9. Construct the H4K12 peptide as shown in SEQ ID NO.16. In a 20 μL in vitro enzymatic reaction system (containing 10 mM butyric acid, 50 Mm Tris, pH=8.0, 1 mM dithiothreitol, and 0.1 mM EDTA), add 1 μg of H4K12 peptide, 500 ng of BRD4 recombinant protein, and 0.6 mM lactyl-CoA, and react overnight at 37°C. Detect the H4K12 peptide and the reaction products from the in vitro enzymatic reaction using a matrix-assisted laser desorption / ionization high-resolution time-of-flight mass spectrometry (Maldi-TOF / TOF, Ultraflextreme-196) to obtain the mass spectrum peaks of the reaction products. (See figure below.) Figure 35As shown, in the in vitro enzymatic system, BRD4 can lactylate the H4K12 peptide, thereby acting as a histone lactyltransferase and increasing the level of H4K12la.

[0069] SEQ ID NO.16 (H4K12 peptide): GLGKGGA, with Ac and COOH modified at both ends, i.e., Ac-GLGKGGA-COOH.

[0070] 10. HEY and A2780 cells were seeded into 10 cm dishes. After adhesion, BRD4-NC, BRD4 si-1, and BRD4 si-3 were transiently transfected with Lipofectamine 3000 reagent. 48 hours later, chromatin immunoprecipitation was performed using the SimpleChIP® Plus kit (CST, 56383). The sonicated cross-linked chromatin was incubated overnight at 4°C with 10 μg of anti-BRD4 antibody or normal rabbit IgG (as a negative control). The presence of the Ube2v1 gene promoter sequence in the immunoprecipitated DNA was detected by PCR. Figure 36 As shown, interference with BRD4 expression reduced the amount of BRD4 bound to the Ube2v1 gene promoter region.

Claims

1. The use of a substance for detecting proteins in the preparation of a product for predicting the prognosis of ovarian cancer, characterized in that, The protein is selected from any one or more of BRD4, H4K12la, and Ube2v1.

2. The use according to claim 1, characterized in that, The substance used to detect the protein refers to a reagent that can specifically detect whether a protein is expressed and / or detect the amount of protein expression.

3. A product for predicting the prognosis of ovarian cancer, characterized in that, The substance includes a protein for detection, wherein the protein is selected from any one or more of BRD4, H4K12la, and Ube2v1.

4. The product according to claim 3, characterized in that, The product includes at least one of reagents, reagent kits, test strips, and chips.

5. A drug for treating ovarian cancer and / or ovarian cancer with a poor prognosis, characterized in that, The drug includes any one or more of BRD4 inhibitors, H4K12la inhibitors, and Ube2v1 inhibitors.

6. The drug according to claim 5, characterized in that, The H4K12la inhibitor is selected from any one of BRD4 inhibitors, glycolysis inhibitor 2-DG, and oxalic acid.

7. The drug according to claim 6, characterized in that, The BRD4 inhibitor is selected from any one of BET bromodomain inhibitor, CP1203, SF2523, dBET1, Dbet57, A1874, MZ1, and ZEN-3862.

8. The drug according to claim 6, characterized in that, The BRD4 inhibitors include any of the sequences shown in SEQ ID NO. 13 and 14.

9. The drug according to claim 5, characterized in that, The Ube2v1 inhibitor is selected from any one or more of the following: BRD4 inhibitor, H4K12la inhibitor, oxaline, and glycolysis inhibitor 2-DG.

10. The medicament according to claim 5, characterized in that, The Ube2v1 inhibitor includes any one of the sequences shown in SEQ ID NO. 13, 14, 6, 7, 9, 10, and 11.