HAT probe with adjustable switch characteristics and application thereof
By designing the polydeoxythymidine sequence and raised secondary structure of the HAT probe, combined with the DNAzyme activation mechanism and AuNP signal enrichment, the problems of false positives and signal leakage of nucleic acid probes in complex samples were solved, and high sensitivity and stable biosensing effect were achieved.
Patent Information
- Application Number
- CN202610071204.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-05-29
AI Technical Summary
Existing nucleic acid probes are prone to non-specific binding in complex biological samples, leading to false positives. Furthermore, the signal amplification process is prone to leakage, resulting in poor system robustness and a lack of external control capabilities. It is difficult to achieve high sensitivity and low background signal without affecting the target binding ability.
A HAT probe containing a polydeoxythymidine sequence and a raised secondary structure was designed to inhibit Cas12a trans-cleavage through steric hindrance, and to achieve fine regulation of Cas12a activity by combining DNAzyme activation mechanism and AuNP signal enrichment.
It achieves high signal-to-noise ratio biosensing, maintains high sensitivity and stability in complex samples, has a detection limit of up to 2.05×10-15M, and features low background and fast response capabilities.
Smart Images

Figure CN122104684A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular diagnostics and biosensing technology, and particularly relates to a HAT probe with adjustable switching characteristics and its applications. Background Technology
[0002] In the fields of molecular diagnostics and biosensing, nucleic acid probes are core tools for achieving highly specific and sensitive detection of target nucleic acids or biomarkers. Currently, common functional nucleic acid probes mainly include molecular beacons, TaqMan probes, and Scorpions probes. These probes are typically based on the principle of fluorescence resonance energy transfer (FRET), modifying both ends of the probe with fluorescent and quenching groups. They utilize the distance change caused by conformational changes before and after binding to the target to "turn on" or "enhance" the fluorescence signal. In recent years, to further improve detection performance, researchers have developed techniques such as strand displacement probes, rolling circle amplification probes, and various DNA nanomachines. These amplify and regulate signals by precisely controlling the hybridization and substitution of DNA strands in complex pathways. Furthermore, the rise of aptamer technology has enabled nucleic acid probes not only to recognize nucleic acid targets but also to bind with high affinity to proteins, small molecules, and other targets, greatly expanding their application scope. Overall, research in this field is continuously developing towards higher sensitivity, stronger specificity, and better applicability to complex real-world samples.
[0003] Despite significant advancements in existing technologies, some inherent problems and limitations remain. First, current probes are relatively simple in function, typically only capable of detecting positive or negative results, lacking the ability to effectively integrate signal strength with the detection system. Second, in complex biological samples (such as plasma and cell lysates), probes are prone to generating high background signals, i.e., "false positives," due to adsorption to non-specific proteins or partial hybridization with non-target sequences, severely impacting the specificity and signal-to-noise ratio of the detection. Furthermore, many probe structures are susceptible to leakage reactions during complex signal amplification processes, leading to background signal amplification in the absence of a target and resulting in misinterpretations.
[0004] The root cause of these problems and shortcomings lies in the limitations of existing probe structural design and control mechanisms. First, the switching characteristics of probes rely excessively on the complementarity of their own sequence with the target; their conformational transitions are binary, lacking a "trigger" that can be precisely controlled by external factors (such as light, specific chemical substances, or physical fields), resulting in an inability to control their functional state as needed. Second, to maintain a stable hairpin structure or specific conformation, traditional probe designs often sacrifice some kinetic performance, making it difficult to balance structural stability and functional specificity when encountering multiple interfering substances in complex samples. Third, while complex multi-step signal amplification strategies improve sensitivity, they also introduce more reactive components and longer reaction paths; each step can become a source of erroneous signals, resulting in poor system robustness.
[0005] In seeking solutions to the aforementioned problems, those skilled in the art have encountered numerous technical difficulties. The primary challenge lies in introducing an efficient, stable, and biocompatible external control switch without compromising the probe's specific binding ability to the target. Secondly, designing an integrated probe structure that simultaneously achieves low background, high sensitivity, and strong anti-interference capability is extremely challenging, as reducing background often requires enhancing structural stability, which may slow down the binding kinetics to the target, and vice versa. Finally, successfully applying such advanced probe designs from idealized buffer systems to complex clinical samples while maintaining their excellent analytical performance is the ultimate obstacle to realizing their practical application value. Summary of the Invention
[0006] The purpose of this invention is to provide a HAT probe with adjustable switching characteristics and its applications. To achieve the above objectives, this application adopts the following technical solution: In a first aspect, the present invention provides a HAT probe with adjustable switching characteristics, which includes a secondary structure capable of forming a specific spatial steric hindrance.
[0007] In the above technical solutions, the secondary structure is a raised "bubble" or "ring".
[0008] In the above technical solution, the core of the secondary structure is a polydeoxythymidine sequence.
[0009] In the above technical solutions, the length of the polydeoxythymidine sequence is between 5 and 30 nucleotides.
[0010] The above technical solution includes a specific site for being cleaved by an upstream activator.
[0011] In the above technical solutions, the specific site is the riboadecanoside intercalation site.
[0012] The above technical solution includes a Spacer sequence that is complementary to the target nucleic acid.
[0013] Secondly, the present invention provides the application of the above-mentioned HAT probe as a molecular switch in controlling the presence or absence of Cas12a trans-cutting.
[0014] Thirdly, the present invention provides the application of the above-mentioned HAT probe in the continuous and precise control of the trans-cleavage activity of Cas12a.
[0015] Fourthly, the present invention provides a biological detection system comprising a Split Cas12a protein component, a crRNA component, and the aforementioned HAT probe.
[0016] The beneficial effects of this invention are as follows: (1) Efficient active blocking mechanism The HAT probe achieves complete inhibition of trans-cleavage activity through its unique three-dimensional structure. Its core mechanism relies on a raised, bubble-like structure formed in the center of the probe, which effectively prevents the binding of the Cas12a-crRNA complex to the substrate through steric hindrance. Gel electrophoresis experiments confirmed that the intact HAT structure remains stable in the presence of Cas12a, while this protective ability is immediately lost upon structural disruption. This structure-dependent sealing characteristic lays the foundation for constructing high signal-to-noise ratio biosensors.
[0017] (2) Precise activity gradient regulation capability By systematically adjusting the length (5-30 nt) of the polyT region in the HAT structure, we achieved continuous and precise control over the trans-cleavage activity of Cas12a. Experimental data showed that the trans-cleavage efficiency decreased exponentially with the polyT length, allowing the HAT probe to precisely regulate enzyme activity like a "molecular sliding rheostat." This continuously tunable activity control provides excellent flexibility for optimizing the sensitivity and dynamic range of the detection system.
[0018] (3) Optimized structural switching characteristics By systematically screening the space region length, we found that a 5nt interval distance achieves the optimal balance between structural closure efficiency and cutting reactivity. Under this optimized condition, the HAT structure can effectively maintain stability in the "off" state and quickly transition to the "on" state after activation, ensuring efficient substrate cutting. This switching characteristic greatly improves the reliability and response speed of the detection system.
[0019] (4) Excellent detection sensitivity and stability The detection system constructed by combining HAT probes with the DNAzyme activation mechanism and AuNP signal enrichment strategy exhibits extremely high sensitivity. Experiments demonstrate that the detection limit for miRNAs using this system reaches 2.05 × 10⁻⁶. - ¹ 5 M, maintaining a good linear response (R²>0.99) over a wide dynamic range of 10 nM to 10 fM. Even in complex biological matrices, the system can still produce a stable fluorescence signal within 160 minutes, demonstrating excellent analytical performance. Attached Figure Description
[0020] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings: Figure 1 Compared to traditional double-stranded DNA (dsDNA) substrates, Hooded DNA (HAT structure) substrates exhibit stronger resistance to trans-cleavage of the SplitCRISPR / Cas12a system.
[0021] Figure 2 A schematic diagram illustrating the principle of hooded DNA as a "switch" element that responds to molecular signals, used to realize applications such as multidimensional diagnosis and imaging.
[0022] Figure 3 HAT structure principle verification diagram / result comparison diagram: single—single-stranded probe; double—complementary double-stranded probe; HAT—double-stranded probe with a hooded secondary structure; HAT-split—double-stranded probe with the hooded structure opened (open state).
[0023] Figure 4 : A schematic diagram of the structural design of a HAT probe with continuously adjustable polyT fragment length (e.g., 5–30 nt).
[0024] Figure 5 Figure 1: Continuous adjustment results of HAT probe structure: Fluorescence response bar charts and standard / fitted curves under different polyT lengths (5T–30T).
[0025] Figure 6 The fluorescence response curves of the HAT structure probe before and after separation / purification under different pore sizes are compared and analyzed to characterize the controllable adjustment effect of the pore size.
[0026] Figure 7: Comparative analysis of the lysis activity of HAT structure probes before and after separation / purification under different pore sizes.
[0027] Figure 8 : Schematic diagram of the mechanism of probe enrichment on the surface of gold nanoparticles (AuNPs) and the detection process based on AuNPs.
[0028] Figure 9 Transmission electron microscopy (TEM) characterization images of AuNPs and AuNP-Probe (probe-modified AuNPs).
[0029] Figure 10 Figure: Zeta potential measurement results of AuNPs and AuNP-Probe.
[0030] Figure 11 Fluorescence kinetics of the cleavage reaction of the Split CRISPR / Cas12a system under different concentrations of AuNP-Probe:
[0031] Figure 12 Statistical bar chart and corresponding standard curve of fluorescence kinetic data of the cleavage reaction of the Split CRISPR / Cas12a system under different concentrations of AuNP-Probe. Detailed Implementation
[0032] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. This invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. This invention will be defined only by the claims.
[0033] The HAT probe of this invention comprises a secondary structure (such as a raised "bubble" or "loop") that can form specific steric hindrance, effectively inhibiting non-specific cleavage of the reporter probe by Cas12a. At the core of the secondary structure is a poly-dT sequence, 5 to 30 nucleotides in length, preferably 10-20 nucleotides, for precise regulation of activity. Additionally, it includes a specific site for cleavage by upstream activators (such as DNAzymes, enzymes, etc.), for example, a riboadenosine (rA) intercalation site, and a spacer sequence complementary to the target nucleic acid (such as miRNA). This probe can be further coupled to signal carriers (such as gold nanoparticles, AuNPs) to enhance signaling or achieve intracellular delivery.
[0034] The HAT probe of this invention has a "switch" regulatory function: by utilizing the intact structure and the linear structure after cleavage of the HAT probe to inhibit and activate Cas12a activity, a molecular switch is constructed. This "switch" can respond to specific biomolecules (such as miRNAs and proteins) and convert their presence into a detectable signal.
[0035] This invention's HAT probe possesses a finely tuned capability akin to a "molecular rheostat": by altering the length of the Poly-T ring in the HAT structure, continuous and predictable adjustment of the Cas12a trans-cutting efficiency can be achieved. It is a method for steplessly controlling the background signal and sensitivity of a CRISPR detection system by changing probe structural parameters.
[0036] The raw materials for this invention are sourced from: All oligonucleotide chains used in the experiments were synthesized and purified by Sangon Biotech Ltd. (Shanghai, China).
[0037] The concentration of DNA oligonucleotides was measured using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
[0038] The sequences of all oligonucleotides are shown in Table 1.
[0039] Table 1 Oligonucleotide Sequences
[0040] AsCas12a, FnCas12a and LbCas12a were purchased from Tolo Biotech Co., Ltd. (Shanghai, China).
[0041] 2 mM MgSO4 was purchased from New England Biolabs Inc. (Beijing, China).
[0042] Agarose, 5×TBE buffer, 4S Red Plus Nucleic Acid Stain, 6× DNA loading dye, DNA Marker and ATP were purchased from Sangon Biotech Ltd. (Shanghai, China).
[0043] The MiPure Cell / Tissue miRNA Kit, miRNA 1st Strand cDNA Synthesis Kit (bystem-loop), and miRNA Unimodal SYBR qPCR Master Mix were purchased from Vazyme (Jiangsu, China).
[0044] The experimental method of this invention: 1. Preparation of HAT probes The HAT probe consists of a main strand of HAT DNA and a reporter strand of HAT-Probe. The nucleotide sequence of the main strand of HAT DNA is: TGGAGAGGGCGTTTTTTTTTTTTTTTTTTTTGCCAGGGGTATGTG (SEQ ID NO. 1), and the nucleotide sequence of the reporter strand of HAT-Probe is: CACATACCCCTGGCCGCCCTCTCCA (SEQ ID NO. 2).
[0045] Take 2 μL of main strand HAT DNA (100 nM), 2 μL of reporter strand HAT-Probe (100 nM), and 14 μL of DEPC water, and mix with 2 μL of 10× r2.1 buffer. Vortex for 1 minute to ensure thorough mixing. Place the mixture in a PCR instrument and anneal according to the following program: 85℃ for 5 minutes, 45℃ for 10 minutes, and 25℃ for 10 minutes. The HAT probe is then successfully prepared.
[0046] 2. HAT probe performance testing Add 2 μL scaffold RNA (100 nM), 2 μL spacer RNA (100 nM), 2 μL DNA (100 nM), and 2 μL Mg to the reaction system. 2+ The reaction mixture was prepared with 100 mM LbCas12a protein, 20 μL DEPC water, and 3 μL 10× r2.1 buffer, and incubated at 37°C for 60 minutes. Finally, 1 μL LbCas12a protein (100 nM) was added, vortexed, and the reaction mixture was placed in a PCR instrument and incubated at 37°C for 60 minutes, with real-time monitoring of fluorescence intensity changes during the process.
[0047] 3. DNAzyme cleavage of probes Take 2 μL of DNAzyme (100 nM) and 16 μL of DEPC water, mix with 2 μL of 10× r2.1 buffer, and vortex for 1 minute to ensure thorough mixing. Then add the HAT probe and incubate for 1 hour. Afterwards, add scaffoldRNA (100 nM), spacer RNA (100 nM), DNA (100 nM), and Mg to the reaction system. 2+ The reaction mixture was prepared with 100 mM DEPC water and 10× r2.1 buffer and incubated at 37°C for 60 minutes. Finally, LbCas12a protein (100 nM) was added, vortexed, and the reaction mixture was placed in a PCR instrument and incubated at 37°C for 60 minutes, with real-time monitoring of fluorescence intensity changes during the process.
[0048] 4. Gold nanoparticle loading Take 2 μL of thiolized HAT probe (100 μM) and add an appropriate amount of TCEP·HCl to make a final concentration of 10–20 mM. Vortex mix and incubate at room temperature in the dark for 1 h to reduce disulfide bonds. Then, desalt and purify the reduced probe (using ultrapure water as the eluent) and collect the purified thiolized HAT probe for later use.
[0049] Add 1 mL of gold nanoparticle (AuNPs) solution to a 1.5 mL centrifuge tube, and add 10–20 μL of 1 M PBS (pH 7.4) dropwise while gently vortexing to complete the pretreatment. Add a certain amount of the reduced and purified thiolized HAT probe to the pretreated AuNPs solution, mix well, and incubate at room temperature in the dark for 2 h to allow the probe to bind to the AuNPs surface.
[0050] Prepare the salt aging buffer: This buffer is prepared by mixing 2 M NaCl with 100 mM PBS (pH 7.4). Then, gradually add the salt aging buffer to the AuNPs-probe mixture every 30 min, increasing the final NaCl concentration by approximately 0.1 M each time, until the final NaCl concentration reaches 0.3–0.5 M. After salt aging, separate the AuNP-Probe conjugate from the unbound free DNA by high-speed centrifugation: 14,000 rpm, 30 min, 4°C. Carefully aspirate the supernatant, avoiding disturbing the precipitate.
[0051] Add 1 mL of washing buffer to the precipitate and resuspend. Centrifuge again (under the same conditions as above) and discard the supernatant. If necessary, wash 1–2 times to reduce the background of free DNA. Finally, resuspend AuNP-Probe in an appropriate amount of storage solution and store at 4°C in the dark for later use.
[0052] Previous studies have shown that CRISPR-Cas12a exhibits varying trans-cleavage activities against different DNA probes, but no studies have reported this property of the more versatile Split CRISPR / Cas12a system. Therefore, this invention designed DNA probes with different structures to investigate the trans-cleavage ability of Split CRISPR / Cas12a against them. The Hooded / HAT structure exhibited complete resistance to trans-cleavage, and this resistance stemmed from the raised, vesicular structure, as the HAT structure lost its trans-cleavage resistance upon disruption. To further investigate the effect of the HAT structure on reaction kinetics, this invention designed single-stranded hairpin structures and HAT structures of different sizes. Gel electrophoresis results showed that the single-stranded vesicular structure and the "small" HAT structure could be completely digested by the Split CRISPR / Cas12a system, while the "large" HAT structure could not be cleaved. This further suggests that the trans-cleavage activity of splitCRISPR-Cas12a is dependent on the size of the HAT structure. Therefore, this invention designs a HAT structure probe with bubble-like protrusions that continuously vary between 5-30 nt T bases, verifying that the trans-cleavage efficiency of the Split CRISPR / Cas12a system decreases exponentially with increasing T bases. Based on this, it was found that by adjusting the size of the HAT structure, not only can the presence or absence of trans-cleavage in the Split CRISPR / Cas12a system be controlled, but it also possesses an effect similar to a "molecular sliding rheostat" to continuously and finely adjust the activity of Cas12a.
[0053] Compared to traditional double-stranded DNA (dsDNA) substrates, hooded DNA (HAT structure) substrates exhibit stronger resistance to trans-cleavage in the split CRISPR / Cas12a system. Figure 1 Meanwhile, hooded DNA can also serve as a "switch" element that responds to molecular signals, providing a tunable signal modulation basis for applications such as multidimensional diagnosis and imaging. Figure 2 To clarify the switching control mechanism of the HAT structure, this invention verified its function through a series of experiments. For example... Figure 3As shown, the split CRISPR / Cas12a system exhibits significant differences in probe cleavage activity and corresponding fluorescence output under different structural states: When the probe is in a linear single-strand conformation, the activated split CRISPR / Cas12a-crRNA complex can efficiently recognize and cleave the probe, causing the reporter group (such as FAM) to separate from the quencher group, thereby generating a strong fluorescence signal and establishing the baseline activity level of the system in the "on" state. Conversely, when the same sequence is designed as a cap-shaped (HAT) secondary structure, the resulting protruding ring / bubble-like spatial conformation produces a significant steric hindrance effect, hindering the effective approach and binding of the split CRISPR / Cas12a-crRNA complex to the cleavage site, causing the trans-cleavage activity to be almost completely inhibited, and the fluorescence signal to drop to near background levels, thus directly demonstrating the excellent "off" state blocking ability of the HAT structure. Furthermore, this regulatory process exhibits excellent reversibility: when the HAT structure is disrupted under specific conditions (e.g., by DNAzyme cleavage or treatment with specific enzymes), its steric hindrance effect is relieved, the probe reverts to a recognizable linear conformation, the cleavage activity of split CRISPR / Cas12a is reconstructed, and the fluorescence signal correspondingly recovers to a high level, achieving a controllable switch from "off" to "on". In summary, the above experiments clearly demonstrate that the HAT structure can achieve precise regulation of splitCas12a activity through conformational changes, providing a crucial molecular basis for constructing a low-background, high-signal-to-noise-ratio, and activatable CRISPR biosensing and imaging system.
[0054] To systematically investigate the effect of HAT structural size on its regulatory ability, a series of HAT probes with continuously varying bubble protrusion lengths between 5 and 30 thymine nucleotides (T) were designed and synthesized. Figure 4 Quantitative analysis of the trans-cleavage efficiency of SplitCRISPR / Cas12a for HAT probes of different sizes revealed a clear structure-property relationship: the cleavage efficiency of the system decreases systematically with increasing polyT sequence length. Figure 5 Further data fitting showed that the decay of cutting efficiency follows an exponential function relationship with the polyT length (R²>0.99), revealing that its regulation process is not a simple linear change, but a nonlinear process affected by both spatial steric hindrance and accessibility.
[0055] This invention further investigates the "switching" effect of the HAT structure on Cas12a. At 6 nt and below, changing the length of the space in the HAT structure has a slight effect on the HAT structure's resistance to reverse cutting, but significantly affects the cutting efficiency of Cas12a on the split HAT structure. Figure 6). Optimization of the space length revealed that the HAT structure achieves the optimal balance between closure efficiency and cutting activity when the distance is 5nt. Figure 7 ).
[0056] Based on the switching function of the cap-shaped probe and the efficient and convenient RNA detection capabilities of the Split CRISPR / Cas12a system, this invention constructs a precise sensing system. For example... Figure 8 As shown, DNAzyme was chosen as the activation switch for the cap-shaped probe because it combines cleavage activity and programmability. Accordingly, a riboadecanoside (rA) site was introduced into the polyT region of the HAT probe, enabling it to undergo specific cleavage under the action of DNAzyme, thereby transforming the HAT structure into an open structure. The cap-shaped probe was modified onto AuNP material to achieve signal enrichment and improve cleavage efficiency. Transmission electron microscopy (TEM) and Zeta potential measurements characterized the morphology of AuNPs before and after probe adsorption. Figure 9 , Figure 10 To further evaluate the detection limit of this system, we selected miR-375 and set its concentration gradient in the range of 10 nM to 10 fM for fluorescence intensity measurement. Experimental results showed that even at the fM concentration level, the system still produced a significant fluorescence signal within 160 minutes. Figure 11 Furthermore, the fluorescence intensity showed a good linear relationship with the logarithm of the miRNA concentration. Figure 12 By using a 3x signal-to-noise ratio calculation method, the detection limit can reach 2.05*10. -15 M. The above results demonstrate that the constructed reaction system is responsive to DNAzymes and possesses high sensitivity, enabling quantitative detection of miRNAs at the fM level.
[0057] To verify the successful modification of gold nanoparticles (AuNPs) with HAT probes and elucidate their detection mechanism, we conducted systematic characterization and performance analysis. First, we observed the morphology of bare AuNPs and probe-modified AuNPs (Probe@AuNPs) using transmission electron microscopy (TEM). The results showed that bare AuNPs exhibited a uniform spherical structure with clear edges; while in the TEM images of Probe@AuNPs, a distinct light-colored halo was clearly observed around the nanoparticles. This phenomenon stems from the fact that the density of DNA molecules is much lower than that of the gold core and the commonly used negative staining agent phosphotungstic acid. Its low electron scattering ability causes the HAT probe layer bound to the AuNP surface to appear as a unique low-contrast peripheral band in the imaging, directly confirming that the probe has been successfully anchored to the nanoparticle surface. To further provide evidence from an electrochemical perspective, we measured the Zeta potential of AuNPs and Probe@AuNPs. Bare AuNPs, due to their citrate coating, are negatively charged, and the measured Zeta potential is approximately -0.05 mV. After successfully attaching the negatively charged DNA probe, the surface negative charge density of Probe@AuNPs increased significantly, and its Zeta potential measurement showed a clear rightward (more negative) shift, with the potential value dropping to approximately -13.38 mV. This change strongly demonstrates that the negatively charged DNA probe has been efficiently and stably assembled onto the AuNPs surface via Au-S bonds.
[0058] Based on this, the detection mechanism of the Probe@AuNPs complex was clarified: First, AuNPs, with their large specific surface area, achieve high-density loading of the HAT probe, playing a role in signal enrichment and amplification. During detection, when the target miRNA is present, it specifically interacts with the DNAzyme-cleaved HAT probe, thereby activating the downstream Split CRISPR / Cas12a system. The activated Cas12a then trans-cleaves the reporter probe extending from the AuNPs surface, causing the fluorescence signal to be released from the quenched state and dramatically enhanced. Thanks to the enrichment effect of AuNPs, multiple cleavage events can occur simultaneously on a single nanoparticle, greatly amplifying the output signal.
[0059] To systematically evaluate the sensitivity of the constructed detection system, we selected the prostate cancer-related biomarker miR-375 as the model analyte and conducted a series of precise quantitative experiments. The miR-375 standard concentration was serially diluted from 10 nM to 10 fM, with three technical replicates for each concentration point. Fluorescence intensity was monitored under uniform reaction conditions (37°C, reaction time 160 min). Experimental results showed ( Figure 12Within the detection time window, significant fluorescence signal growth was observed in all concentration gradient experimental groups, with signal accumulation exhibiting a typical concentration-dependent pattern. Notably, even at concentrations as low as 10 fM, the system still produced a fluorescence response significantly different from the negative control (signal-to-noise ratio S / N > 5), demonstrating the system's ability to detect targets with extremely low abundance. Further data analysis showed a good linear relationship between the fluorescence intensity at the reaction endpoint and the logarithm of the miR-375 concentration across four concentration orders from 10 fM to 10 nM, with a linear regression coefficient of determination R² reaching 0.987. This linear relationship provides a reliable standard curve for accurate quantification of miRNAs in real samples. Based on the detection limit calculation method recommended by the International Union of Pure and Applied Chemistry (IUPAC) (LOD = 3σ / slope, where σ is the standard deviation of the blank sample), the detection limit of this system reached 2.05 × 10⁻⁶. - ¹ 5 M.
[0060] Example 1: Combined detection of miR-21 and miR-375 in blood samples Two HAT probes were designed, targeting miR-21-5p and miR-375 respectively. When the target miRNA is present in the sample, the corresponding Split CRISPR / Cas12a system is activated, cleaving the reporter probe and generating a fluorescent signal. The miRNA can be quantified by detecting the fluorescence intensity. For miR-21-5p, an rA site is introduced into the polyT region of the probe, forming a cap-like structure. Its spacer region is completely complementary to miR-21-5p. Similarly, for miR-375, an rA site is introduced into the polyT region, with the spacer region completely complementary to miR-375. The polyT length is set to 15-20 nt to achieve a good balance between blocking effect and cleavage activity. AuNPs are used as the carriers for the reporter probes. HAT probes with quenched fluorescent reporter groups (such as FAM-BHQ1) are modified onto the AuNPs. The HAT probes are cleaved using DNAzyme, and fluorescence is restored after Cas12a cleavage.
[0061] After collecting clinical serum samples, centrifuge at 3000 rpm for 10 minutes to remove cell debris and store at -80℃ for later use. Mix all components of the above reaction system (Cas12a protein is added last) and vortex to mix. Place the reaction tubes in a real-time PCR instrument or microplate reader and react at 37℃ for 60-120 minutes, collecting the fluorescence value of the FAM channel (Ex / Em: 492 / 518 nm) every 5 minutes. Perform quantitative analysis using the fluorescence value at the reaction endpoint (e.g., 120 minutes). Using the fluorescence value of the serum sample without miRNA (negative control) as the baseline, calculate ΔF = F_sample - F_negative control. Plot a standard curve of ΔF versus miR-21-5p / miR-375 concentrations (serial dilutions, e.g., 10 fM - 10 nM) to calculate the concentration of miRNA in the sample.
[0062] Example 2: Detection of let-7b in urine samples A specific spacer sequence was designed for let-7b and is fully complementary to let-7b. rA was introduced into the PolyT region; since the urine matrix may differ from blood, the PolyT length can be selected as 10-15 nt. A commercially available urine miRNA extraction kit was used to enrich and extract miRNAs from urine to improve detection sensitivity. The enriched miRNAs were then detected using the same method as in Protocol 1.
[0063] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A HAT probe with adjustable switching characteristics, characterized in that: It contains a secondary structure that can form specific spatial steric hindrance.
2. The HAT probe according to claim 1, characterized in that: The secondary structure is a raised "bubble" or "ring".
3. The HAT probe according to claim 1, characterized in that: The core of the secondary structure is a polydeoxythymidine sequence.
4. The HAT probe according to claim 3, characterized in that: The length of the polydeoxythymidine sequence is between 5 and 30 nucleotides.
5. The HAT probe according to claim 1, characterized in that: It contains a specific site for being cleaved by upstream activators.
6. The HAT probe according to claim 5, characterized in that: The specific site is the riboadecanoside insertion site.
7. The HAT probe according to claim 1, characterized in that: It contains a spacer sequence that is complementary to the target nucleic acid.
8. The application of the HAT probe according to any one of claims 1-7 as a molecular switch in controlling the presence or absence of Cas12a trans-cutting.
9. The application of the HAT probe according to any one of claims 1-7 in the continuous and precise control of the trans-cleavage activity of Cas12a.
10. A biological detection system, characterized in that: It comprises a Split Cas12a protein component, a crRNA component, and the HAT probe as described in any one of claims 1-7.