Use of a CSTB inhibitor in the preparation of drugs for remodeling the immune microenvironment of tumors and for immunosensitization

Abstract

This invention relates to the field of biomedicine, and discloses the application of a CSTB inhibitor in the preparation of drugs that reshape the tumor immune microenvironment and enhance immunity. The CSTB inhibitor, as the active ingredient, is used to prepare drugs that downregulate CXCL3 or CCL2 levels in tumor tissue and reduce the barrier of suppressor neutrophils, aiming to improve CD8+ in tumor parenchyma. + The distribution of T cells. This invention also relates to the application of CSTB inhibitors as immune checkpoint inhibitor sensitizers, which can effectively enhance the efficacy of PD-1 / PD-L1 inhibitors against immune checkpoint inhibitor-resistant or immune-rejecting solid tumors.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to the application of a CSTB inhibitor in the preparation of drugs for remodeling the tumor immune microenvironment and enhancing immunity. Background Technology

[0002] Lung adenocarcinoma is the most common pathological type of lung cancer. In recent years, immune checkpoint inhibitors (ICIs), represented by PD-1 / PD-L1 inhibitors, have made significant progress in clinical treatment. However, clinical data show that only a small number of patients can benefit sustainably from monotherapy, and most patients exhibit primary resistance or develop acquired resistance during treatment.

[0003] Current research indicates that drug resistance mechanisms in tumor cells are often related to the abnormal activation of their internal signaling pathways, such as enhancing anti-apoptotic capabilities by regulating pathways like PI3K / Akt, thereby resisting the cytotoxic effects of chemotherapy drugs. However, strategies based on improving the metabolism or survival pathways of tumor cells are often insufficient to effectively reverse the drug resistance to immunotherapy. Although attempts have been made to improve efficacy through combination chemotherapy or radiotherapy, these methods often lack precise targets for remodeling the immunosuppressive microenvironment, resulting in poor efficacy or significant toxic side effects.

[0004] Remodeling the tumor microenvironment is crucial for reversing immunotherapy resistance, but identifying which key factor drives the precise recruitment of suppressor cells and how to simultaneously downregulate multiple inhibitory chemokines and restart T-cell killing activity through intervention on a single target remain major unsolved technical challenges in this field. Although some studies have found anti-tumor effects in tumor-associated neoplasms (TANs), increasing research indicates that TANs exhibit more pro-tumor effects related to immune tolerance: high-level infiltration of TANs in various solid tumors leads to tumor progression, lymph node metastasis, angiogenesis, and poor prognosis. Furthermore, there is a lack of effective molecular markers in clinical practice that can accurately assess the immune shielding status of the tumor microenvironment and thus predict patient sensitivity to immunotherapy. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, which lacks a dual-effect regulatory target that can simultaneously block the recruitment of suppressor cells and restart the function of cytotoxic T cells, and where existing tumor growth regulators often fail to address the physical barrier of the microenvironment formed by myeloid suppressor cells, resulting in low immunotherapy response rates and easy development of primary drug resistance, this invention provides an application of a CSTB inhibitor. Another object of the present invention is to provide a composition for reshaping the immune microenvironment of solid tumors; Another object of the present invention is to provide a kit for detecting the sensitivity of tumor samples to immune checkpoint inhibitors; Another objective of this invention is to provide a method for screening tumor immunosensitizing drugs.

[0006] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows: The application of a CSTB (Cystatin B) inhibitor for the preparation of drugs that remodel the tumor microenvironment.

[0007] Preferably, the CSTB inhibitor refers to any substance that can reduce CSTB gene expression, reduce CSTB protein levels, or inhibit CSTB protein activity.

[0008] Preferably, the CSTB inhibitor is selected from: small interfering RNA (siRNA), short hairpin RNA (shRNA), antisense oligonucleotide (ASO), CSTB neutralizing antibody or its antigen-binding fragment, or CSTB small molecule inhibitor.

[0009] Preferably, the CSTB inhibitor is shRNA; preferably, the shRNA has the following sequence: SEQ ID NO 1: GATCCGCAGAAGTTTGATGTCTTTAAAACTCGAGTTTAAAGACATCAAACTTCTGTTTTTTG; SEQ ID NO 2: AATTCAAAAAACAGAAGTTTGATGTCTTTAAAACTCGAGTTTAAAGACATCAAACTTCTGCG.

[0010] Furthermore, the tumor microenvironment remodeling drug aims to improve intratumoral CD8... + Drugs that target T cell distribution.

[0011] Furthermore, the tumor microenvironment remodeling drug is a drug that can downregulate the expression of CXCL3 and / or CCL2.

[0012] Furthermore, the tumor microenvironment remodeling drug is a drug that inhibits the shielding of tumor neutrophils.

[0013] Furthermore, the tumor microenvironment remodeling drug is a CXCL3 and / or CCL2-mediated PD-L1 reduction agent. + Neutrophils or Arg1 + Drugs that induce neutrophil infiltration.

[0014] Preferably, the tumor is selected from lung adenocarcinoma, pancreatic cancer, colorectal cancer, liver cancer, breast cancer, or stomach cancer.

[0015] Furthermore, the tumor immune checkpoint inhibitor-resistant tumors and / or immune-rejecting tumors.

[0016] Preferably, the tumor is a tumor with suppressive neutrophil shielding characteristics caused by high expression of CXCL3 and / or CCL2.

[0017] An application of a CSTB inhibitor for the preparation of PD-1 / PD-L1 inhibitor sensitizers.

[0018] A composition for remodeling the immune microenvironment of solid tumors, wherein the active ingredient comprises a CSTB inhibitor and at least one of a PD-1 inhibitor or a PD-L1 inhibitor.

[0019] A kit for detecting the sensitivity of tumor samples to immune checkpoint inhibitors, the kit comprising a formulation for detecting CSTB expression levels, and further comprising formulations for detecting CXCL3 expression levels and PD-L1 expression levels. + Neutrophil infiltration level, CD8 + At least one of the preparations for increasing T-cell infiltration levels.

[0020] Preferably, the formulation for detecting expression levels in the kit includes an antibody that specifically binds to the protein, a primer that specifically amplifies the mRNA, or a specific hybridization probe.

[0021] Preferably, the kit uses at least one of the following techniques for detection: immunohistochemistry (IHC), multiplex immunofluorescence (mIF), flow cytometry (FACS), or enzyme-linked immunosorbent assay (ELISA).

[0022] A method for screening tumor immunosensitizing drugs includes the following steps: adding a test drug to a biological system expressing CSTB as an experimental group, and using a biological system expressing CSTB without the test drug as a control group; detecting the activity of CSTB, the expression level of CXCL3, and / or the chemotactic ratio of suppressor neutrophils in the experimental group and the control group, respectively; if the activity of CSTB, the expression level of CXCL3, and / or the chemotactic ratio of suppressor neutrophils in the experimental group are lower than those in the control group, then the test drug is a tumor immunosensitizing drug.

[0023] Preferably, the biological system expressing CSTB includes an in vitro cell model, an ex vivo tissue model, or an in vivo animal model.

[0024] Preferably, the biological system expressing CSTB includes tumor cell lines, tumor organoids, or tumor-bearing mice.

[0025] The CSTB of this invention exhibits a unique targeted regulatory effect on the immune microenvironment of lung adenocarcinoma. High expression of CSTB directly leads to activation of the NF-κB signaling pathway in tumor cells, and simultaneously induces a significant upregulation of the expression levels of downstream chemokines CXCL3 (as well as CCL2, PTGS2, etc.); this further triggers the response of tumor tissue to PD-L1. + and ARG1 + The targeted recruitment and accumulation of neutrophils spatially constructs a physical barrier to hinder immune attack. Correspondingly, by inhibiting CSTB expression, the infiltration of these suppressive neutrophils can be precisely reduced, while simultaneously increasing intratumoral CD8. + This invention enhances the infiltration abundance and cytotoxic activity of T cells. It combines CSTB inhibitors with PD-1 / PD-L1 inhibitors, generating potent synergistic antitumor activity through the combined effects of increased T cell recruitment and relief of environmental inhibition. This invention, based on a method of immunosensitization through the linkage of specific molecular expression levels, provides a novel approach to addressing primary drug resistance in lung adenocarcinoma immunotherapy, distinct from existing technologies (which focus on direct killing logic or simply regulate cell metabolism).

[0026] Compared with the prior art, the beneficial effects of the technical solution of the present invention are: This invention is the first to demonstrate that CSTB is a key target for regulating the immune microenvironment of lung adenocarcinoma, and its expression level is related to the tumor suppressor CD8. + T cells showed a negative correlation, while they showed a positive correlation with tumor-promoting neutrophils and exhibited a high degree of T cell dependence.

[0027] This invention can significantly optimize the ratio and functional status of immune cells in tumor tissue: the proportion of neutrophil infiltration is significantly reduced from 9.4% to 4.85%, and it precisely eliminates the repressive subsets that highly express Arg1 or PD-L1, removing the physical and biochemical barriers that hinder immune attack; on the other hand, CD8 + The proportion of T cell infiltration increased significantly, and its effector molecule granzyme B (GZMB) also increased. + ) and interferon-γ (IFN-γ) + The expression rates of ) increased significantly from 0.9% and 0.72% to approximately 2.26% and 1.8%, respectively, achieving a comprehensive breakthrough from reconstructing the microenvironment structure to restarting immune function.

[0028] Based on the profound remodeling of the immune microenvironment by CSTB, the CSTB inhibitor of this invention, combined with a PD-1 inhibitor, exhibited an unexpected synergistic effect, with significantly better tumor-suppressive efficacy than the single-drug group, resulting in an order-of-magnitude reduction in tumor volume and weight. This method combines promoting T cell recruitment with relieving T cell suppression, significantly improving the response rate of immune checkpoint inhibitors in patients with lung adenocarcinoma. Attached Figure Description

[0029] Figure 1 The images show the IHC results of LUAD cancer tissue and adjacent tissue. A shows CSTB-positive LUAD cancer tissue (left 10×, right 20×); B shows CSTB-positive adjacent tissue (left 10×, right 20×); C shows CSTB-negative LUAD cancer tissue (left 10×, right 20×); and D shows CSTB-negative adjacent tissue (left 10×, right 20×).

[0030] Figure 2 Knockdown of CSTB in LLC cells had no significant effect on cell proliferation. A shows the knockdown efficiency of CSTB at the mRNA level; B shows the knockdown efficiency of CSTB at the Western blot (WB) level; C shows the cell proliferation capacity after CSTB knockdown as indicated by the CCK8 assay; D shows the cell proliferation capacity after CSTB knockdown as indicated by the colony formation assay. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0031] Figure 3 To reduce the effect of CSTB knockout on in vivo tumor growth and immune cell infiltration in lung adenocarcinoma. A shows photographs of subcutaneous xenografts in mice of each group; B shows the growth curves of tumor volume over time in each group; C shows the final weight of tumors in each group; D shows the number of neutrophils (CD11b) in tumor tissues of each group as detected by flow cytometry. + Ly6G + Statistics on the infiltration ratio and representative flow cytometry plots of ) ; E represents the CD8 in tumor tissues of each group detected by flow cytometry. + Statistics on the infiltration rate of T cells (CD3⁺CD8⁺) and representative flow cytometry plots. P <0.05,** P <0.01, *** P <0.001, **** P <0.0001.

[0032] Figure 4 To knock down CSTB's effect on tumor-invasive CD8 + The effect of T cell effector molecule expression. A represents the expression of CD8 in each group. + T cell infiltration ratio statistics and flow cytometry; B represents CD8 in each group. + GZMB, a cytotoxic molecular granzyme B in T cells, + Percentage statistics and flow cytometry for each group; C represents the CD8 values ​​for each group. + Interferon-γ (IFN-γ) in T cells + Percentage statistics and flow cytometry plots of the tumors. D shows photographs of subcutaneous xenografts in each group of mice; E shows the final weight of tumors in each group; F shows the CD8+ levels in tumor tissues of each group as detected by flow cytometry. + T cells (CD3) + CD8 +)Statistical analysis of infiltration ratios and representative flow cytometry plots. P <0.05,** P <0.01, *** P <0.001, **** P <0.0001.

[0033] Figure 5 To reduce the effect of CSTB knockout on the infiltration rate of specific neutrophil subsets. A shows the statistical analysis and representative flow cytometry plots of the total neutrophil infiltration rate in tumor tissue; B shows the arginase 1 (Arg1) level in neutrophils. + Subpopulation proportion statistics and flow cytometry; C represents PD-L1 in neutrophils. + Subpopulation proportion statistics and representative flow cytometry plots. P <0.05,** P <0.01, *** P <0.001, **** P <0.0001.

[0034] Figure 6 To validate the mechanism by which CSTB regulates the NF-κB signaling axis and immunosuppressive factors. A shows the expression and phosphorylation levels of NF-κB pathway-related proteins in LLC cells detected by Western blotting; B shows the expression level of the chemokine CXCL3 detected by Western blotting; C shows the relative mRNA expression levels of immunosuppressive factors in each group of cells detected by RT-qPCR. P <0.05,** P <0.01, *** P <0.001, **** P <0.0001.

[0035] Figure 7 This study demonstrates the synergistic inhibitory effect of CSTB inhibitors combined with PD-1 antibodies on tumor growth. A shows a photograph of mouse tumors; B shows the final tumor weight for each group; C shows the CD8+ levels in tumor tissues from each group as detected by flow cytometry. + T cell infiltration rate; D represents CD8 in each group. + GZMB in T cells + Proportional statistics; E represents the CD8 ratio of each group. + IFN-γ in T cells + Proportional statistics. P <0.05,** P <0.01, *** P <0.001, **** P <0.0001. Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0037] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0038] This invention constructs a kit for detecting the sensitivity of tumor samples to immune checkpoint inhibitors. The kit comprises: an antibody for detecting CSTB, primers / antibodies for detecting CXCL3, and a reagent for labeling suppressor neutrophils (PD-L1). + / Arg1 + The reagents included markers for neutrophils (such as CD11b / Ly6G antibody). Multiplex quantitative analysis of the aforementioned Lewis subcutaneous tumor tissue was performed using this reagent combination via immunofluorescence and flow cytometry.

[0039] Furthermore, based on this reagent combination, this application also establishes a screening method for tumor immunosensitizing drugs. By applying candidate drugs to Lewis cell systems with high CSTB expression, changes in various indicators in the above reagent combination are simultaneously detected. If downregulation of CSTB and CXCL3 and a decrease in the neutrophil chemotaxis ratio are detected, the candidate drug is determined to be a drug with immunosensitizing potential.

[0040] Example 1 The cell line used was Lewis lung carcinoma cells (LLC cells). The constructed LLC-shCSTB and LLC-shNC cell lines were used to establish subcutaneous xenograft models in immunocompetent C57BL / 6 mice (5-6 weeks old) (1×10⁻⁶ cells were subcutaneously injected into the back of the mice). 6 (Each cell was analyzed), and changes in tumor volume and weight in mice were systematically monitored. When tumor growth reached the upper limit of ethical standards, mice were anesthetized and sacrificed. A portion of the tumor tissue was treated with tissue fixation solution and then subjected to immunofluorescence staining to identify CD8+ in the tumor tissue. + The proportions of T cells and neutrophils were measured; another portion was digested with freshly prepared tissue digestive enzymes (hyaluronidase + type IV collagenase + DMEM high-glucose basal medium) in a 37°C incubator for 1.5 h, filtered through a 70 μm filter to obtain a single-cell suspension, and centrifuged (350 g, 5 min). Red blood cell lysis and cell counting were then performed. The resulting cell suspension was supplemented with FcR receptor antagonist (BD Pharminge). TM (553141) was incubated at 4℃ for 5 min, followed by staining and other steps with added antibody (all antibodies were BD Pharmaceuticals). TM(Specific catalog number is as follows). Finally, flow cytometry was used to detect the proportion of neutrophils and PD-L1 in tumor tissue. + Neutrophil ratio, Arg1 + Neutrophil ratio, CD8 + T cell percentage, GZMB + CD8 + T cell percentage and IFN-γ + CD8 + T cell ratio.

[0041] C57BL / 6 mouse model CD8 constructed using Lewis lung cancer cells + T depletion assay to investigate whether the knockdown of CSTB-mediated antitumor effect depends on CD8 in the tumor microenvironment. + T cells. Specific procedure: Using the constructed Lewis-shCSTB cell line (shRNA sequence shown below) and Lewis-shNC cell line, subcutaneous xenograft models were established in immunocompetent C57BL / 6 mice (5-6 weeks old) (1×10⁻⁶ cells were subcutaneously injected into the back of the mice). 6 On day 7 of model construction, mice were administered CD8 neutralizing antibody (BioXCell (BE0061), 10 mg / kg, intraperitoneal injection, every 3 days) or IgG, and tumor volume and weight were systematically monitored. When tumor growth reached the upper limit of ethical standards, the mice were anesthetized and sacrificed. Subcutaneous tumors were dissected and flow cytometry was performed (specific procedure as above) to detect CD8 in the tumor tissue. + T cell ratio.

[0042] shRNA sequence: Bottom strand:AATTCAAAAAACAGAAGTTTGATGTCTTTAAAACTCGAGTTTAAAGACATCAAACTTCTGCG Flow cytometry antibody catalog number: <![CDATA[APC-Cy TM 7 Rat Anti-Mouse CD45]]> 557659 PE-Cy7 Rat Anti-CD11b (M1 / 70) 552850 PE Rat Anti-Mouse Ly-6G (1A8) 551461 APC Rat Anti-Mouse CD274(PDL1) 564715 APC Rat Anti-Mouse CD45(30-F11) 561018 FITC Rat Anti-Mouse CD8a(53-6.7) 553030 BB700 Armenian Hamster Anti-Mouse CD3e(145-2C11) 566495

[0043] Example 2 Using the constructed LLC-shCSTB cell line (shRNA sequence as shown below) and LLC-shNC cell line, subcutaneous xenograft models were established in immunocompetent C57BL / 6 mice (5-6 weeks old) (1×10⁻⁶ cells were subcutaneously injected into the back of the mice). 6Subcutaneous xenografts (3 cells per group) were then removed from two groups and rapidly transferred to liquid nitrogen for freezing for 15 min before being stored at -80°C. Transcriptome sequencing was then used to explore downstream regulatory pathways and potential immunomodulatory mechanisms of CSTB. Results showed that CSTB may exert its effects by influencing the state of immune-related signaling pathways and the secretion of immunosuppressive cytokines. qRT-PCR was used to detect the gene levels of downstream CXCL3, IL-1β, CCL2, and PTGS2 (immunosuppressive molecules). Western blotting was used to detect NF-κB signaling pathway activation and CXCL3 protein levels, and the effect of CSTB on its expression was analyzed.

[0044] The primer sequences and primary antibody information used are as follows: Cxcl3-F AAGATACTGAAGAGCGGCAAGTC Cxcl3-R AGCAGGTAAAGACACATCCAGAC Il1b-F CAGCACATCAACAAGAGCTTCAG Il1b-R GAGGATGGGCTCTTCTTCAAAGA Ccl2-F GGTGTCCCAAAGAAGCTGTAGTT Ccl2-R AGCTTCAGATTTACGGGTCAACT Ptgs2-F GGTCATTGGTGGAGAGGTGTATC Ptgs2-R TGAGTCTGCTGGTTTGGAATAGT Cd274-F CAGGCGTTTACTGCTGCATAATC Cd274-R GATAACCCTCGGCCTGACATATT NF-kappaB Pathway Antibody Sampler Kit CST (9936T) CXCL3 / GRO Gamma Recombinat monolonal antibody Proteintech (86261-1-RR)

[0045] Example 3 Using the constructed LLC-shCSTB and LLC-shNC cell lines, subcutaneous xenograft models were established in immunocompetent C57BL / 6 mice (5-6 weeks old) (1×10⁻⁶ cells were subcutaneously injected into the back of the mice). 6 On day 7 of model construction, mice were administered a PD-1 antibody (BioXCell (BE0146), 10 mg / kg, intraperitoneally, every 2 days). Tumor volume and weight were systematically monitored. When tumor growth reached the ethical limit, the mice were anesthetized and euthanized. Subcutaneous tumors were dissected, and flow cytometry (the procedure was the same as before) was performed to detect CD8+ in the tumor tissue. + T cell percentage, GZMB + CD8 + T cell percentage and IFN-γ + CD8 + T cell ratio.

[0046] Analysis and Explanation (1) Expression characteristics of CSTB in lung adenocarcinoma and its effect on cell proliferation Figure 1 Figures A and C represent CSTB positivity and negativity in LUAD cancer tissues when subjected to IHC testing, respectively. Figure 1 B and 1D are representative images of CSTB positivity and negativity in IHC testing of adjacent non-tumor tissues in LUAD, as shown. Figure 1 As shown in Figure E, CSTB is significantly highly expressed in LUAD cancer tissue. Figure 2 As shown in A-2B, the knockdown efficiency of the Lewis-shCSTB cell line constructed was verified by qRT-PCR and WB technology, respectively. Figure 2CD confirmed through CCK8 assay and cell colony formation assay that knocking down CSTB had no significant effect on the proliferation of Lewis cells.

[0047] (2) Inhibition of CSTB reduces neutrophil infiltration and activates CD8 + T cell function, reshaping the tumor immune microenvironment like Figure 3 As shown, CSTB knockdown significantly reduced tumor size, CD8 + Increased T cell infiltration and decreased neutrophil infiltration. Knockdown of CSTB slowed tumor growth, significantly reduced tumor size, and significantly decreased tumor weight. Figure 3 A~C). Neutrophils (CD11b) + Ly6G + The infiltration rate of ) decreased significantly from approximately 9.4% in the control group to approximately 4.85% ( Figure 3 D); at the same time, the total CD8 + T cells (CD3) + CD8 + The infiltration rate of ) showed a significant upward trend. Figure 3 E). The above results indicate that CSTB has the function of recruiting neutrophils and inhibiting T cell infiltration in lung adenocarcinoma tissues.

[0048] CD8 + The results of T cell effector molecule expression detection showed that CD8 + Increased T-cell infiltration rate ( Figure 4 A), of which granzyme B (GZMB) + CD8 + The percentage of T cells increased from 0.9% in the control group to 2.26%. Figure 4 B), interferon-γ (IFN-γ) + CD8 + The percentage of T positive cells also increased from 0.72% to 1.8%. Figure 4 C). Further CD8 + T cell exhaustion assay Figure 4 (D~F) It can be seen that the anti-tumor effect of CSTB depends on CD8. + T cells. Figure 4 The results showed that inhibiting CSTB not only altered the ratio of immune cells, but also significantly reversed the functional suppression of tumor-infiltrating T cells.

[0049] (3) Knockdown of CSTB precisely eliminates immunosuppressive neutrophils that highly express Arg1 or PD-L1. like Figure 5As shown, knocking down CSTB significantly reduced immunosuppressive neutrophil infiltration in tumor tissue. Inhibition of CSTB led to a significant decrease in the total proportion of neutrophils infiltrating tumor tissue (see...). Figure 5 A). More importantly, in-depth scanning of the functional phenotype of neutrophils revealed (see...) Figure 5 (B) This decline is mainly reflected in Arg1, which has a strong immunosuppressive function. + Subgroups and PD-L1 + Targeted elimination of subpopulations. Arg1 + Neutrophil ratio ( Figure 5 B), in control neutrophils, arginase 1 (Arg1) is expressed. + The proportion of PD-L1 was as high as 16.4%, but after CSTB knockout, the proportion of this subgroup dropped significantly to 6%, a decrease of more than 60%. + Neutrophil ratio ( Figure 5 Similarly, the proportion of immunosuppressive neutrophils with high PD-L1 expression was significantly reduced from 12.3% in the control group to 9%. This means that the effect of CSTB inhibitors is not indiscriminate cell reduction, but rather precise elimination of immunosuppressive neutrophils with high Arg1 or PD-L1 expression, fundamentally removing the microenvironment's biochemical inhibition of T cells.

[0050] (4) Knockdown of CSTB can block the NF-κB signaling pathway and synergistically downregulate the expression of multiple immunosuppressive factors. Figure 6 Results showed that CSTB downregulation significantly inhibited NF-κB pathway activation, manifested as a simultaneous decrease in the phosphorylation levels of p-IKKα / β, p-IκBα, and p-NF-κB proteins, leading to NF-κB pathway inactivation. Simultaneously, the expression level of the downstream key effector protein CXCL3 was significantly downregulated. Figure 6 B). After CSTB knockdown, the mRNA levels of immunosuppression-related factors such as CXCL3, CCL2, and Ptgs2 decreased. Figure 6 C).

[0051] (5) Knockdown of CSTB can increase the effect of PD-1 inhibitors Combined drug trials revealed that inhibiting CSTB significantly enhanced the anti-tumor efficacy of PD-1 antibodies, as evidenced by an order-of-magnitude decrease in tumor volume and weight in the combined treatment group (Sh-Cstb + αPD-1) compared to the monotherapy group. Figure 7 (A~B) This synergistic effect essentially stems from the deep remodeling of the microenvironment, namely, the combination therapy induces CD8+ in tumor tissue. + A significant increase in the proportion of T cell infiltration ( Figure 7 C), and synergistically activated T cells to secrete the cytotoxic factor granzyme B (GZMB).+ ) and interferon-γ (IFN-γ) + ) functional activity ( Figure 7 (D~E), thus providing solid pharmacodynamic evidence for the development of combination drugs to reverse resistance to immunotherapy.

[0052] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. An application of a CSTB inhibitor, characterized in that, Used to prepare drugs for tumor microenvironment remodeling.

2. The application of the CSTB inhibitor according to claim 1, characterized in that, The tumor microenvironment remodeling drug improves intratumoral CD8... + Drugs that target T cell distribution.

3. The application of the CSTB inhibitor according to claim 1, characterized in that, The tumor microenvironment remodeling drug is a drug that can downregulate the expression of CXCL3 and / or CCL2.

4. The application of the CSTB inhibitor according to claim 1, characterized in that, The tumor microenvironment remodeling drug is a drug that inhibits the shielding of tumor neutrophils.

5. The application of the CSTB inhibitor according to any one of claims 3 to 4, characterized in that, The tumor microenvironment remodeling drug is a CXCL3 and / or CCL2-mediated PD-L1 reduction drug. + Neutrophils or Arg1 + Drugs that induce neutrophil infiltration.

6. The application of the CSTB inhibitor according to claim 1, characterized in that, The tumor is an immune checkpoint inhibitor resistant tumor and / or an immune rejection tumor.

7. An application of a CSTB inhibitor, characterized in that, Used to prepare PD-1 / PD-L1 inhibitor sensitizers.

8. A composition for reshaping the immune microenvironment of solid tumors, characterized in that, Its active ingredients include a CSTB inhibitor and at least one of a PD-1 inhibitor or a PD-L1 inhibitor.

9. A kit for detecting the sensitivity of tumor samples to immune checkpoint inhibitors, characterized in that, The kit contains a formulation for detecting CSTB expression levels, and also contains formulations for detecting CXCL3 expression levels and PD-L1 expression levels. + Neutrophil infiltration level, CD8 + At least one of the preparations for increasing T-cell infiltration levels.

10. A method for screening tumor immunosensitizing drugs, characterized in that, Includes the following steps: The test drug was added to a biological system expressing CSTB as the experimental group, and a biological system expressing CSTB without the test drug was used as the control group. The activity of CSTB, the expression level of CXCL3, and / or the chemotactic ratio of suppressor neutrophils were detected in the experimental group and the control group, respectively. If the activity of CSTB, the expression level of CXCL3, and / or the chemotactic ratio of suppressor neutrophils in the experimental group were lower than those in the control group, then the test drug was a tumor immunosensitizing drug.

Images