A herpes simplex virus detection kit and application thereof

Abstract

The application selects highly conservative and excellent interspecies specificity UL49A gene as a target from multiple strains of HSV-1 and related herpes simplex virus (HSV-2, EBV, CMVh and VZV) coding sequences through bioinformatics whole genome alignment, designs and selects specific primer probe combination 124F / 124R / 124P, and establishes a HSV-1 probe method fluorescence quantitative PCR detection system targeting UL49A gene. Based on the primer probe group, the HSV-1 detection kit can be prepared, which is suitable for clinical biological samples such as lesion secretions, aqueous humor and blood, especially can provide a rapid, accurate and high-sensitivity etiological diagnosis scheme for HSV-1 related keratitis, and has good clinical application value.

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to a method, kit, and application of fluorescence quantitative PCR detection of herpes simplex virus type 1. Background Technology

[0002] Herpes simplex keratitis is a common and potentially blinding disease caused by the latent reactivation of herpes simplex virus type 1 (HSV-1). It is a leading cause of corneal ulceration and blindness worldwide. HSV-1 belongs to the Herpesviridae family, Alphaherpesvirinae subfamily, and Herpes simplex virus genus. It is a neurotropic double-stranded DNA virus with strong adaptability and universal susceptibility. After infection, it can remain latent in the trigeminal nerve cells and can be carried for life, commonly causing infections of the oral cavity, lips, and eyes. The initial infection of HSV-1 occurs after direct contact with mucous membranes or skin surfaces, and is usually subclinical and difficult to detect. After the initial infection, the virus enters the trigeminal ganglion and remains latent for a long period. Subsequent keratitis is mostly caused by viral reactivation.

[0003] Currently, clinical diagnostic methods for herpes simplex keratitis mainly include slit-lamp examination, viral culture, immunofluorescence, enzyme-linked immunosorbent assay (ELISA), and polymerase chain reaction (PCR). Among these, viral culture is cumbersome, time-consuming, and has limited sensitivity; immunological methods (such as ELISA and immunofluorescence) are easily affected by antibody cross-reactivity, resulting in low detection rates in early-stage infections or immunocompromised patients; while traditional PCR has high sensitivity, it is mostly an endpoint detection method and cannot accurately quantify viral load, and it carries the risk of cross-contamination. In recent years, quantitative real-time PCR (qPCR) technology has been applied in the detection of various pathogens due to its advantages such as high sensitivity, high specificity, quantification, and closed-tube detection. Invention patent CN116287432A discloses a method for identifying herpes simplex virus type 1 (HSV-1) and / or HSV-2 using quantitative real-time PCR (qPCR). This method effectively distinguishes HSV-1 and HSV-2 by designing qPCR primers targeting the US1 gene of HSV-1 and / or the UL26 gene of HSV-2. It exhibits good specificity, sensitivity, and repeatability, and is convenient and compatible. To further improve the specificity and sensitivity of HSV detection, existing technologies disclose qPCR detection methods based on a series of gene targets. Patent CN101979668B discloses PCR primers designed targeting the highly conserved HSV-1 gene—glycoprotein B. Using these primers for HSV-1 detection results in only 1.5 hours. In addition, invention patent CN113846190B discloses a triple fluorescent quantitative PCR detection composition containing specific primers and probes for HSV-1 UL49, HSV-2 gG and PRV UL24 genes, which can simultaneously detect the UL49 gene of HSV-1, the gG gene of HSV-2 and the UL24 gene of PRV, for the clinical differential diagnosis of HSV-1, HSV-2 and PRV infection.

[0004] However, existing qPCR detection methods for HSV-1 still differ in terms of primer and probe target region selection, amplification efficiency, detection sensitivity, and applicability to clinical samples. Some methods have high detection limits or insufficient detection capabilities for samples with low viral loads, such as corneal scrapings and aqueous humor, and cannot yet meet the clinical needs for early and rapid diagnosis. Summary of the Invention

[0005] Based on the sequence analysis of the entire HSV-1 viral genome, this invention designs primers and probes targeting specific, highly conserved genomic fragments, successfully establishing a real-time PCR detection method. Compared with existing technologies, this method has higher adaptability for HSV-1 detection, and its detection results exhibit better accuracy, specificity, and sensitivity. Based on this, this invention is completed.

[0006] In a first aspect, the present invention provides a primer-probe set for detecting herpes simplex virus type 1 (HSV-1); wherein the upstream primer sequence is GGCCTGTTGTTTGTCTTGCTC (SEQ ID NO:1), the downstream primer sequence is CAGTGTTTTGGGTCTCGCAC (SEQ ID NO:2), and the probe sequence is GATGGGATCGGGGGCGCG (SEQ ID NO:3); the primers specifically target the UL49A gene of HSV-1.

[0007] Secondly, the present invention provides a detection reagent for detecting herpes simplex virus type 1 in biological samples. The reagent comprises primers and probes for targeting and amplifying the UL49A gene of herpes simplex virus type 1. The primers are an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2, and the probe sequence is SEQ ID NO:3.

[0008] Furthermore, the biological samples include lesion secretions, lesion tissue, aqueous humor, and blood.

[0009] Thirdly, the present invention provides a method for detecting herpes simplex virus type 1 in biological samples, the method comprising the following steps: S1, collect biological samples; S2, prepare the reaction solution. Extract nucleic acid from the biological sample collected in S1. Add the extracted nucleic acid sample to the reaction system containing primer pairs and probes targeting the UL49A gene of herpes simplex virus type 1 to obtain the reaction solution. S3. Place the reaction solution prepared in S2 into a qPCR instrument and set the following reaction program: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s, 60℃ for 30 s, 40 cycles. S4, obtain the qPCR test results.

[0010] Furthermore, in step S2, the reaction system is 20~50 μL.

[0011] Furthermore, the reaction system is 20~30 μL.

[0012] Preferably, the reaction system is 25 μL.

[0013] Further, in step S2, the reaction solution consists of 12.5 μL of 2× AceQ U+ Probe Master Mix; 1 μL each of upstream and downstream primers; 0.5 μL of probe; 0.5 μL of ROX; 8.5 μL of deionized water; and 1 μL of template.

[0014] Furthermore, the final concentration of the upstream primer is selected from 0.1 to 0.8 μM; the final concentration of the downstream primer is selected from 0.1 to 0.8 μM; and the final concentration of the probe is selected from 0.1 to 0.8 μM.

[0015] Preferably, the final concentration of the upstream primer is 0.4 μM; the final concentration of the downstream primer is 0.4 μM; and the final concentration of the probe is 0.2 μM.

[0016] Fourthly, the present invention provides a qPCR kit for detecting herpes simplex virus type 1, the kit containing reagents for detecting herpes simplex virus type 1, the reagents including primers and probes for targeting and amplifying the UL49A gene; the primers including an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2, and the probe sequence is SEQ ID NO:3.

[0017] Fifthly, the present invention provides the use of the primer-probe set as described in the first aspect in the preparation of a reagent for detecting herpes simplex virus type 1 in biological samples, wherein the primers are the upstream primer shown as SEQ ID NO:1 and the downstream primer shown as SEQ ID NO:2, and the probe sequence is SEQ ID NO:3.

[0018] Furthermore, the application is to prepare a reagent for detecting keratitis caused by herpes simplex virus type 1.

[0019] Beneficial effects This invention uses bioinformatics whole-genome alignment to screen the highly conserved UL49A gene with excellent interspecies specificity from the coding sequences of multiple HSV-1 and closely related herpesviruses (HSV-2, EBV, CMV, VZV) as a target. A specific primer-probe combination 124F / 124R / 124P was designed and screened to establish an HSV-1 probe-based real-time PCR detection system targeting the UL49A gene.

[0020] This invention optimizes the qPCR reaction system and amplification procedure, and systematically validates the methodological performance: the standard curve of this method has a linear correlation coefficient R0. 2=0.9907, indicating high detection sensitivity; intra-assay Ct value coefficient of variation is 0.201%~1.910%, showing good repeatability; specific amplification only occurs in HSV-1 nucleic acid samples, with no cross-amplification with HSV-2, EBV, CMV, and VZV, demonstrating excellent specificity. Bioinformatics analysis confirms that existing conventional detection targets such as UL30, UL49, US1, and gB have two major drawbacks: firstly, some HSV-1 strains have sequence conservation deletions; secondly, they are prone to homologous cross-amplification with HSV-2. The UL49A target of this invention can circumvent these drawbacks. Based on this primer and probe set, an HSV-1 detection kit can be prepared, suitable for clinical biological samples such as lesion secretions, lesion tissues, aqueous humor, and blood, especially providing a rapid, accurate, and highly sensitive etiological diagnostic solution for HSV-1-related keratitis, possessing good clinical application value. Attached Figure Description

[0021] Figure 1 HSV-1 conservative CDS analysis.

[0022] Figure 2 Specificity analysis of HSV-1 conserved CDS in different HSV-2 strains.

[0023] Figure 3 Specificity analysis of HSV-1 conserved CDS in different EBV strains.

[0024] Figure 4 Specificity analysis of HSV-1 conserved CDS in different CMV strains.

[0025] Figure 5 Specificity analysis of HSV-1 conserved CDS in different VZV strains.

[0026] Figure 6 Intersection analysis of HSV-2, EBV, CMV and VZV specific sequences.

[0027] Figure 7 Analysis of 10 HSV-1-specific conserved CDS sequences.

[0028] Figure 8 Preliminary verification of the 124F / R / P primer-probe combination.

[0029] Figure 9 Preliminary verification of the 88F / R / P primer-probe combination.

[0030] Figure 10 Preliminary verification of the 99F / R / P primer-probe combination.

[0031] Figure 11 Preliminary verification of the 146F / R / P primer-probe combination.

[0032] Figure 12 Preliminary verification of the 105F / R / P primer-probe combination.

[0033] Figure 13 : Standard curve of 124F / R / P primer-probe combination.

[0034] Figure 14 Specificity verification of the 124F / R / P primer-probe combination.

[0035] Figure 15 The conservation of the HSV-1 gene related to the existing publicly available technology is analyzed among different strains (similarity %). Red indicates very low similarity and the absence of the corresponding gene in the strain.

[0036] Figure 16 The following is a continuation of the analysis of the conservation of the HSV-1 gene in different strains (similarity %), where red indicates very low similarity and the absence of the corresponding gene in the strain.

[0037] Figure 17 The specificity analysis (% similarity) of existing publicly available genes related to HSV-2 virus with different strains is shown. The red markers indicate that the gene has a highly homologous sequence in HSV-2 strains and is prone to cross-amplification. Detailed Implementation

[0038] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions of embodiments are for the purpose of helping to understand the present invention, but do not constitute a limitation thereof.

[0039] Unless otherwise specified, the raw materials, reagents, instruments and equipment involved in the embodiments of this invention can all be obtained by purchase.

[0040] The plasmids and genome samples used in this invention are: Plasmid: The standard for herpes simplex virus type 1 is the pEASY®-Blunt Zero vector containing a specific nucleotide fragment of the UL49A gene (nucleotides 106719 to 106994 of GenBank: U61140.1), and is named pEASY-HSV1.

[0041] Genomes: The genomes of herpes simplex virus type 1, herpes simplex virus type 2, Epstein-Barr virus, cytomegalovirus, and varicella-zoster virus are preserved in our laboratory.

[0042] The reagents and instruments used in this invention are: Biospin All-in-One Genomic Extraction Kit was purchased from BioFlux; AceQ® U+ Probe MasterMix Detection Kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; and Q5 Real-Time PCR Instrument was purchased from Applied Biosystems.

[0043] Aqueous humor: A colorless, transparent fluid inside the eyeball that fills the anterior and posterior chambers and is secreted by the ciliary body inside the eye.

[0044] Example 1: Screening of target genes Obtaining the viral genome CDS sequence Using the R language's rentrez package as the data retrieval tool and the NCBI database as the sequence source, the coding region (CDS) sequences of herpes simplex virus type 1 (HSV-1, classification number txid10298), herpes simplex virus type 2 (HSV-2, classification number txid10310), Epstein-Barr virus (EBV, classification number txid10376), cytomegalovirus (CMV, classification number txid10359), and varicella-zoster virus (VZV, classification number txid10335) were downloaded. The selection criteria were strains annotated as "complete". Ultimately, whole-genome CDS sequence datasets of 71 HSV-1 strains, 12 HSV-2 strains, 264 EBV strains, 247 CMV strains, and 18 VZV strains were obtained.

[0045] HSV-1 conserved target gene screening Using the ViralProj15217 strain of HSV-1 as the reference strain, the pairwiseAlignment function in the pwalign package of R was used to align each CDS sequence of the reference strain with all CDS sequences of 71 HSV-1 strains one by one. The alignment score of each CDS sequence of the reference strain with the highest similarity among the aligned strains was obtained. Based on these scores, a screening criterion was set. In the reference strain, CDS sequences with ≥90% homologous sequence similarity in all aligned HSV-1 strains were considered candidate sequences for conserved HSV-1 target genes. Based on this criterion, 24 candidate sequences for conserved HSV-1 target genes were finally selected (see...). Figure 1 ).

[0046] Specific screening of conserved target gene sequences The `pairwiseAlignment` function of the `pwalign` package in R was used to cross-align the 24 HSV-1 conserved target gene candidate sequences obtained from the above screening with the full CDS sequences of all strains of four non-target viruses: HSV-2, Epstein-Barr Virus (EBV), Cytomegalovirus (CMV), and Varicella-zoster virus (VZV). A sequence score matrix of the highest similarity among different non-target virus strains was constructed for each candidate sequence. A specificity screening criterion was set: if a candidate sequence had a similarity of ≤70% with any CDS sequence in all aligned non-target virus strains, then the sequence was considered a specific sequence for the target virus (HSV-1).

[0047] The comparison results are as follows Figure 2-5 As shown, after comparison with HSV-2, 10 HSV-1 specific sequences were obtained (see...). Figure 2 After comparison with EBV, 24 HSV-1 specific sequences were obtained (see...). Figure 3 After comparison with CMV, 24 HSV-1 specific sequences were obtained (see...). Figure 4 After comparison with VZV, 24 HSV-1 specific sequences were obtained (see...). Figure 5 ).

[0048] Intersection analysis of the HSV-1 specific sequences targeting HSV-2, EBV, CMV, and VZV yielded 10 conserved target gene sequences that are specific to all four non-target viruses (see [link to analysis]). Figure 6 Further comprehensive evaluation of these 10 sequences (see...) Figure 7 The UL49A gene (GenBank accession number: AEQ77081.1) was identified as the final target gene for subsequent primer and probe design.

[0049] Example 2: Design and Synthesis of Primers and Probes Using a specific gene fragment from the plasmid standard of herpes simplex virus type 1 as a template, primers and probes were designed and screened for the conserved and specific UL49A gene fragment of herpes simplex virus type 1 screened in Example 1 using Primer design software (Primer 3Plus (version: 3.3.0)). The results are shown in Table 1.

[0050] Table 1 Primers and probes for herpes simplex virus type 1

[0051] Note: "F" represents the upstream primer, "R" represents the downstream primer, and "P" represents the probe.

[0052] Example 3: Validation of Primers and Probes With 10 -1 10 1 10 2 10 3 10 4 10 5 and 10 6 Using a copy / μL pEASY-HSV1 plasmid as a template, the primers and probes were initially evaluated using the following reaction system and conditions.

[0053] The reaction system consisted of: 12.5 μL of 2× AceQ U+ Probe Master Mix; 1 μL each of upstream and downstream primers (final concentration 0.5 μM); 1 μL of probe (final concentration 0.5 μM); 0.5 μL of ROX; 8 μL of deionized water; and 1 μL of template.

[0054] Reaction conditions: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s, 60℃ for 30 s (collecting fluorescence), 40 cycles. Deionized water was used as a negative control.

[0055] 124F / R / P primer and probe combination The primer-probe set 124F / R / P for herpes simplex virus type 1 (HSV-1) in Table 1 of Example 2 was validated. Experimental results showed that the primer-probe combination performed ideally, exhibiting good linearity in its standard curve, typical amplification curves, and no non-specific signals. Figure 8 ).

[0056] 88F / R / P primer and probe combination The 88F / R / P primer-probe set for herpes simplex virus type 1 (HSV-1) in Example 2 was validated. Experimental results showed that this primer-probe combination had poor amplification efficiency, the amplification curve did not match the template concentration well, and the amplification curve was atypical. Figure 9 ).

[0057] 99F / R / P primer and probe combination The 99F / R / P primer-probe set for herpes simplex virus type 1 (HSV-1) in Example 2 was validated. Experimental results showed that the amplification curves of this primer-probe combination did not match the template concentration well, the amplification curves were atypical, and the amplification curves were not smooth. Figure 10 ).

[0058] 146F / R / P primer and probe combination The primer and probe set for herpes simplex virus type 1 (HSV-1) 146F / R / P in Example 2 was validated. Experimental results showed that this primer and probe combination had extremely low amplification efficiency, the amplification curve did not match the template concentration well, the amplification curve was atypical, and the amplification curve was not smooth. Figure 11 ).

[0059] 105F / R / P primer and probe combination The 105F / R / P primers and probes in Table 1 of Example 2 were validated. The detection results are as follows: Figure 12 As shown, the primer-probe combination has the best score, but the experimental results of this primer-probe combination indicate that its amplification efficiency is not ideal.

[0060] Among the PCR results above, the 124F / R / P primer-probe combination scored best in HSV-1 genomic PCR, and this primer-probe combination showed ideal performance, with good linearity in its standard curve, typical amplification curve, and no non-specific signals. This primer-probe combination was subsequently selected for establishing the real-time PCR reaction system.

[0061] Example 4: Establishment of a real-time quantitative PCR reaction system for herpes simplex virus type 1. Test methods The reaction system and reaction conditions for real-time PCR were determined using AceQ. ® The U+ Probe Master MIX kit manual recommends using a 25 μL volume for quantitative PCR.

[0062] The optimal concentrations of primers and probes were cross-screened using primers and probes with final concentrations of 0.1, 0.2, 0.4, and 0.8 μM, respectively.

[0063] The reaction conditions were optimized by setting gradient annealing temperatures of 58℃, 60℃, 62℃ and 64℃ respectively.

[0064] Sterile nuclease-free water was used as a blank control, and positive plasmid standards were used as the test samples (diluted to 10⁻⁶ with sterile nuclease-free water). 4 (Copies / μL), and the reaction conditions were explored based on the primer and probe sets screened in Example 3. The reaction conditions with the lowest Ct value and specificity were ultimately selected as the optimal reaction parameters.

[0065] Test results The Ct value was the lowest when the final primer concentration was 0.4 μM and the probe concentration was 0.2 μM (Tables 3 and 4).

[0066] The results of annealing temperature optimization show that when the final primer concentration is 0.4 μM and the probe concentration is 0.2 μM, the Ct value is the smallest when the annealing temperature is 60℃ (Table 5).

[0067] Table 3 Results of real-time PCR with different primer concentrations

[0068] Table 4. Results of real-time PCR with different probe concentrations

[0069] Table 5. Results of real-time PCR at different annealing temperatures

[0070] The optimal reaction system for quantitative real-time PCR was determined to be: 12.5 μL of 2× AceQ U+ Probe Master Mix; 1 μL each of upstream and downstream primers (final concentration 0.4 μM); 0.5 μL of probe (final concentration 0.2 μM); 0.5 μL of ROX; 8.5 μL of deionized water; and 1 μL of template.

[0071] The optimal reaction conditions were: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s, 60℃ for 30 s (collecting fluorescence), 40 cycles.

[0072] Example 5: Establishment and Sensitivity Assessment of Standard Curve for Quantitative Real-Time PCR Test methods The pEASY-HSV1 plasmid standard was serially diluted 10-fold (1.0 × 10⁻⁶). 5 ~1.0×10 -1 Sensitivity was evaluated using the optimized reaction system and conditions from Example 4 (copies / μL). The reaction system consisted of 12.5 μL of 2× AceQ U + Probe Master Mix; 1 μL each of upstream and downstream primers (final concentration 0.4 μM); 0.5 μL of probe (final concentration 0.2 μM); 0.5 μL of ROX; 8.5 μL of deionized water; and 1 μL of template. The reaction conditions were: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s and 60℃ for 30 s (fluorescence collection), 40 cycles. Deionized water was used as a negative control. The sensitivity of the detection method for the two templates was verified based on the amplification curves, and a standard curve was plotted based on the measured Ct values ​​and gene copy numbers. The detection limit for the template samples was also evaluated.

[0073] Test results The results showed that when the plasmid template was 1.0 × 10⁻⁶, 5 ~1.0×10 -1Within the copy / μL range, a good linear relationship was observed between different template concentrations (see [link]). Figure 13 Correlation coefficient (R) 2 The value is 0.9907. Under the optimal conditions obtained in Example 4, the detection method of the present invention can detect a plasmid standard containing one copy of the target gene of herpes simplex virus type 1.

[0074] Example 6: Intra-batch repeatability test of herpes simplex virus type 1 (HSV-1) using real-time quantitative PCR Test methods The pEASY-HSV1 plasmid standard was serially diluted 10-fold (1.0 × 10⁻⁶). 5 ~1.0×10 -1 The repeatability test was performed using the optimized reaction system and conditions from Example 4, with the following reaction system: 2× AceQ U + Probe Master Mix 12.5 μL; upstream and downstream primers 1 μL each (final concentration 0.4 μM); probe 0.5 μL (final concentration 0.2 μM); ROX 0.5 μL; deionized water 8.5 μL; template 1 μL. The reaction conditions were: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s, 60℃ for 30 s (fluorescence collection), 40 cycles. Deionized water was used as a negative control. Each concentration sample was tested three times, and the coefficient of variation (CV%) for the same sample at the same concentration was calculated based on the Ct value. Test results The results showed that the CV% of the Ct value of herpes simplex virus type 1 ranged from 0.201 to 1.910. This result indicates that the method has good intra-batch reproducibility.

[0075] Example 7 Specific Detection of Herpes Simplex Virus Type 1 by Real-Time Fluorescent PCR Test methods Using pEASY-HSV1 plasmid standard (1.0 × 10⁻⁶) 3 (Copies / μL) was used as a positive control for the genomes of herpes simplex virus type 1, herpes simplex virus type 2, Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and pEASY-HSV1 plasmid (1.0 × 10⁻⁶ copies / μL). 3The sample was detected using copies / μL. Sensitivity was evaluated using the optimized reaction system and conditions from Example 4: 2× AceQ U+ Probe MasterMix 12.5 μL; upstream and downstream primers 1 μL each (final concentration 0.4 μM); probe 0.5 μL (final concentration 0.2 μM); ROX 0.5 μL; deionized water 8.5 μL; template 1 μL. The reaction conditions were: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s, 60℃ for 30 s (fluorescence collection), 50 cycles (10 extra cycles were added for experimental rigor to ensure non-target samples did not show amplification curves). Deionized water served as a negative control.

[0076] Test results The results showed that the genome of herpes simplex virus type 1 and 10 3 Copying the pEASY-HSV1 plasmid standard showed a specific amplification curve, while other pathogen genome samples did not (see...). Figure 14 ).

[0077] Example 8: Defect analysis of existing publicly available qPCR targets in the detection of HSV-1 and HSV-2 Existing technologies disclose target genes for detecting herpes simplex virus type 1, including UL30, UL49, UL29, UL52, ICP0 (early diagnosis), US1, gB (UL27), gG (US4), and gD (US6) genes.

[0078] In this embodiment, when screening for conserved genes within viruses and specific to other viruses using bioinformatics methods, it was found that the aforementioned target genes have certain deficiencies in terms of conservation or specificity. For example... Figure 15-16 As shown, UL27 lacks conservation in strain GCA027936225.1; UL30 lacks conservation in strains GCA027937355.1, GCA027938525.1, and GCA027939335.1; UL49 lacks conservation in strain GCA027938525.1; US1 lacks conservation in strain GCA027937425.1; US4 lacks conservation in strains GCA027937865.1 and GCA027938525.1; and the US6 gene lacks conservation in strain GCA027939335.1. Figure 17 As shown, the UL29, UL30, UL52, and US6 genes exhibit cross-reactivity with HSV-2. However, as seen in Examples 1-7 above, the UL49A gene... Figure 15-16 The 71 herpes simplex virus type 1 strains shown are highly conserved and show no cross-reactivity with herpes simplex virus type 2 strains.

[0079] In summary, this application provides a qPCR detection method for herpes simplex virus type 1 based on the UL49A gene. The standard curve of this method has a linear correlation coefficient R. 2 =0.9907, indicating high detection sensitivity; the coefficient of variation of intra-batch Ct values ​​is 0.201%~1.910%, indicating good repeatability; only HSV-1 nucleic acid samples showed specific amplification, and there was no cross-amplification with HSV-2, EBV, CMV, and VZV, demonstrating excellent specificity.

[0080] Meanwhile, this application proposes for the first time to use the UL49A gene as a target for detecting herpes simplex virus type 1. This target has high specificity and is highly conserved among herpes simplex virus type 1 strains.

Claims

1. A primer-probe set for detecting herpes simplex virus type 1; wherein the upstream primer sequence is GGCCTGTTGTTTGTCTTGCTC (SEQ ID NO:1), the downstream primer sequence is CAGTGTTTTGGGTCTCGCAC (SEQ ID NO:2), and the probe sequence is GATGGGATCGGGGGCGCG (SEQ ID NO:3); the primers specifically target the UL49A gene of herpes simplex virus type 1.

2. A detection reagent for detecting herpes simplex virus type 1 in biological samples, the reagent comprising primers and probes for targeting and amplifying the UL49A gene of herpes simplex virus type 1, wherein the primers are an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2, and the probe sequence is SEQ ID NO:

3.

3. The detection reagent as described in claim 2, wherein the biological sample includes lesion secretions, lesion tissue, aqueous humor, and blood.

4. A method for detecting herpes simplex virus type 1 in biological samples, the method comprising the following steps: S1, collect biological samples; S2, prepare the reaction solution by adding the biological sample collected in S1 to the reaction system containing primer pairs and probes that target the UL49A gene of herpes simplex virus type 1, and obtain the reaction solution. S3. Place the reaction solution prepared in S2 into a qPCR instrument and set the following reaction program: 37℃ for 2 min, 1 cycle; 95℃ for 5 min, 1 cycle; 95℃ for 10 s, 60℃ for 30 s, 40 cycles. S4. Obtain the qPCR test results.

5. The method according to claim 4, wherein in step S2, the reaction system is 25 μL, and the reaction solution consists of 12.5 μL of 2× AceQ U+ Probe Master Mix; 1 μL each of upstream and downstream primers; 0.5 μL of probe; 0.5 μL of ROX; 8.5 μL of deionized water; and 1 μL of template.

6. The method of claim 4, wherein the final concentration of the upstream primer is selected from 0.1 to 0.8 μM; the final concentration of the downstream primer is selected from 0.1 to 0.8 μM; and the final concentration of the probe is selected from 0.1 to 0.8 μM.

7. A qPCR kit for detecting herpes simplex virus type 1, the kit containing reagents for detecting herpes simplex virus type 1, the reagents comprising primers and probes for targeting and amplifying the UL49A gene; the primers comprising an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2, and the probe sequence being SEQ ID NO:

3.

8. The use of the primer-probe set as described in claim 1 in the preparation of a reagent for detecting herpes simplex virus type 1 in biological samples, wherein the primers are the upstream primer as shown in SEQ ID NO:1 and the downstream primer as shown in SEQ ID NO:2, and the probe sequence is SEQ ID NO:

3.

9. The application as described in claim 7, wherein the primers specifically amplify the UL49A gene of herpes simplex virus type 1.

10. The application as described in claim 7, wherein the application is for preparing a reagent for detecting keratitis caused by herpes simplex virus type 1.

Images