Novel pyridoindole derivative compound and use thereof

The pyridoindole derivative compound addresses the underlying interaction between Tau and synaptogyrin-3 to prevent or treat tauopathy, providing a fundamental solution by inhibiting the binding of Tau to synaptic vesicles and restoring neurotransmitter secretion.

WO2026059395A1PCT designated stage Publication Date: 2026-03-19KOREA INST OF SCI & TECH
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/014306
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-13
Filing Date
2025-09-15
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Current treatments for tauopathy, a neurodegenerative disease caused by hyperphosphorylation and aggregation of Tau protein, primarily focus on symptomatic relief rather than addressing the underlying interaction between Tau protein and synaptogyrin-3, which contributes to the disease's progression.

Method used

A novel pyridoindole derivative compound that inhibits the interaction between Tau protein and synaptogyrin-3, blocking the binding of Tau to synaptic vesicles and restoring neurotransmitter secretion.

Benefits of technology

The compound effectively prevents or treats tauopathy by fundamentally eliminating the etiology of the disease, inhibiting the interaction between Tau and synaptogyrin-3, thereby restoring vesicle mobility and neurotransmitter secretion, offering a therapeutic strategy beyond symptomatic treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025014306_19032026_PF_FP_ABST
    Figure KR2025014306_19032026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides a composition for preventing or treating neurodegenerative diseases, containing a novel pyridoindole derivative compound as an active ingredient. The present invention departs from a conventional symptomatic treatment that focused on controlling peripheral symptoms of neurodegenerative diseases, particularly various tauopathies caused by Tau protein aggregation, so as to significantly inhibit the interaction between Tau protein and synaptogyrin-3, and thus can achieve the fundamental removal of the cause of neurodegeneration.
Need to check novelty before this filing date? Find Prior Art

Description

Novel pyridoyndole derivative compounds and their uses

[0001] The present invention relates to a novel pyridoindole compound that can be used as a pharmacological component for various tauopathy, such as degenerative brain disease, by inhibiting the interaction between tau protein and synaptogyrin 3.

[0002]

[0003] Microtubules are important components of the cytoskeleton involved in various intracellular processes, including mitosis, cytokinesis, and vesicular transport. Tau proteins are microtubule-associated proteins (MAPs) that interact with microtubules to stabilize them and induce microtubule formation; while present in various cells and tissues, they are particularly abundant in neurons. Since Tau plays a role in stabilizing microtubules, changes in its expression, activity, and function can affect various intracellular processes, which are the cause of numerous neurodegenerative diseases, including tauopathy.

[0004] Tauopathy is a subdiscipline of proteinopathy and includes various neurodegenerative diseases in which aggregates are formed due to the hyperphosphorylation of Tau protein in the brain. It has been reported that the mislocalization of Tau into dendritic spines or interference with glutamate receptors is the pathogenesis of tauopathy, but since pathological Tau is also present in the presynaptic compartment in addition to postsynaptic localization, presynaptic tau function is also predicted to contribute to the development of the disease.

[0005] Meanwhile, synaptogyrin-3, a transmembrane synaptic vesicle protein, mediates the binding between Tau and synaptic vesicles (Zhou et al., Nature Communications 8:15295 (2017)). When synaptogyrin-3 levels are reduced in neurons, the binding between Tau and synaptic vesicles is inhibited, thereby restoring Tau-induced defects in vesicle mobility and neurotransmitter secretion (J. McInnes et al., Neuron 97(4):823-835 (2018); Largo-Barrientos et al., Neuron 109:767-777 (2021)). Accordingly, inhibiting the expression or activity of synaptogyrin-3 itself, or the interaction between Tau and synaptogyrin-3, can be an effective therapeutic strategy for tauopathy; thus, there is a growing demand for the discovery of such inhibitors.

[0006]

[0007] Throughout this specification, numerous papers and patent documents are referenced and cited. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which the present invention pertains and the content of the present invention.

[0008]

[0009] The inventors have made diligent research efforts to discover an efficient small molecule therapeutic agent capable of fundamentally eliminating the etiology of various degenerative brain diseases caused by the hyperphosphorylation and aggregation of Tau protein. As a result, the present invention was completed by discovering that a pyridoindole derivative compound of Chemical Formula 1 described below significantly inhibits the interaction between Tau protein and synaptogyrin-3, thereby blocking the binding of Tau protein to synaptic vesicles mediated by this interaction and efficiently restoring neurotransmitter secretion.

[0010] Therefore, the objective of the present invention is to provide a novel pyridoyndole derivative compound and a composition for the prevention or treatment of degenerative brain diseases comprising the same as an active ingredient.

[0011] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims, and drawings.

[0012]

[0013] According to one aspect of the present invention, the present invention provides a compound represented by the following chemical formula 1:

[0014] Chemical formula 1

[0015]

[0016] In the above chemical formula,

[0017] R1 is an aryl of a 6-membered ring or a heteroaryl of a 5- to 6-membered ring that is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, halogen, and -CN;

[0018] R2 and R3 are each independently hydrogen or C1-C3 alkyl, or R2 and R3 are combined with each other to form a C3-C5 cycloalkyl;

[0019] R4 and R5 are each independently hydrogen or C1-C3 alkyl, or R4 and R5 are combined with each other to form a heterobicycle C7-C9 alkyl;

[0020] R6 is a hexagonal heterocycloalkyl; a C6-C that is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, halogen, and -CN. 10 It is an aryl or a heteroaryl of a 5 to 9-membered ring; a phenyl C1-C3 alkyl; or a tetrahydroisoquinoline;

[0021] R7 is hydrogen or C1-C3 alkyl;

[0022] L1 is -C(O)-, -C(O)NH-, -C(S)NH- or -S(O2)-;

[0023] n is an integer from 0 to 2.

[0024] The inventors have made diligent research efforts to discover an efficient therapeutic composition capable of fundamentally eliminating the etiology of various degenerative brain diseases caused by the hyperphosphorylation and aggregation of Tau protein. As a result, it was discovered that a pyridoindole derivative compound of Chemical Formula 1 significantly inhibits the interaction between Tau protein and synaptogyrin-3, thereby blocking the binding of Tau protein to synaptic vesicles mediated by this interaction and efficiently restoring neurotransmitter secretion.

[0025] In this specification, the term “alkyl” means a straight-chain or branched saturated hydrocarbon group, including, for example, methyl, ethyl, propyl, isopropyl, etc. C1-C3 alkyl means an alkyl group having alkyl units having 1 to 3 carbon atoms, and when C1-C3 alkyl is substituted, the number of carbon atoms of the substituent is not included.

[0026] In this specification, the term “alkoxy” means a radical formed by removing hydrogen from an alcohol, for example, C1-C3 alkoxy means a radical formed by removing hydrogen from an alcohol having 1 to 3 carbon atoms.

[0027] In this specification, the term “halogen” refers to a halogen group element, including, for example, fluoro, chloro, bromo, and iodo. According to a specific embodiment of the present invention, the halogen included in the compound of the present invention is fluoro or chloro.

[0028] In this specification, the term “aryl” means a monocyclic or polycyclic carbon ring that is wholly or partially unsaturated and has aromaticity.

[0029] In this specification, the term “heteroaryl” means a heterocyclic aromatic group containing oxygen, sulfur, or nitrogen within the ring as a heteroatom. The number of heteroatoms included within the ring is 1-3, specifically 1-2. The term “heteroaryl of a pentagonal to ninth ring” means a single or fused ring heteroaryl in which the number of atoms forming the ring, including both carbon and heteroatoms, is 5 to 9.

[0030] In this specification, the term “cycloalkyl” means a saturated hydrocarbon ring forming a single or multiple ring, and includes, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, etc. C3-C5 cycloalkyl means a saturated hydrocarbon ring composed of alkyl units having 3 to 5 carbon atoms, and when C3-C5 alkyl is substituted, the number of carbon atoms of the substituent is not included.

[0031] In this specification, the term “heterocycloalkyl” means a saturated carbon ring containing oxygen, sulfur, or nitrogen as heteroatoms within the ring. The number of heteroatoms is 1 to 3, more specifically 1 or 2. “Heterocycloalkyl of a hexagonal ring” means that the sum of the number of carbons and heteroatoms constituting the ring is 6.

[0032] In this specification, the term “heterobicycloalkyl” refers to a cycloalkyl that forms a bridged bicyclic structure by having two bridgehead carbons constituting another ring within the heterocycloalkyl, and means a saturated carbon ring containing oxygen, sulfur, or nitrogen as a heteroatom within the ring. According to the present invention, R4 and R5 can form a heterobicyclo C7-C9 alkyl by bonding to the bridgehead carbons and connecting to each other. The number of heteroatoms within the ring is one or two, more specifically, one. The heteroatom is nitrogen or oxygen, more specifically, nitrogen.

[0033] According to a specific embodiment of the present invention, R1 is an aryl or heteroaryl of a hexagonal ring that is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, halogen, and -CN.

[0034] According to a specific embodiment of the present invention, R1 is a phenyl, pyridine, pyrimidine, or pyrazole that is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C2 alkyl, C1-C2 alkoxy, halogen, and -CN. More specifically, R1 is a phenyl that is unsubstituted or substituted with one or more substituents selected from the group consisting of methyl, methoxy, halogen, and -CN; a pyridine that is unsubstituted or substituted with a C1-C2 alkyl; a pyrimidine that is unsubstituted or substituted with a C1-C2 alkyl; or a pyrazole substituted with a C1-C2 alkyl.

[0035] According to a specific embodiment of the present invention, R2 and R3 are simultaneously hydrogen or simultaneously C1-C2 alkyl, or R2 and R3 are combined with each other to form a C3-C4 cycloalkyl. More specifically, R2 and R3 are simultaneously hydrogen or simultaneously methyl, or R2 and R3 are combined with each other to form a cyclopropyl.

[0036] According to a specific embodiment of the present invention, R4 and R5 are each independently hydrogen or C1-C2 alkyl but not simultaneously C1-C2 alkyl, or R4 and R5 are combined with each other to form a heterobicyclooctane, and more specifically, R4 and R5 are each independently hydrogen or C1-C2 alkyl but not simultaneously C1-C2 alkyl, or R4 and R5 are combined with each other to form an epiminocycloheptane.

[0037] According to a specific embodiment of the present invention, the R6 is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, halogen, and -CN, C6-C 10 It is an aryl or a heteroaryl of a 5-6-membered ring.

[0038] According to a specific embodiment of the present invention, R6 is morpholine; phenyl, pyridine, pyridazine, oxazole, imidazole, pyrazine, pyrimidine, pyrazol, thiazole, isothiazol, benzothiazol, or imidazopyridine substituted with one or more substituents selected from the group consisting of C1-C2 alkyl, C1-C2 alkoxy, halogen, and -CN; phenyl methyl; or tetrahydroisoquinoline.

[0039] More specifically, when L1 is -S(O2)-, R6 is unsubstituted or a substituted phenyl consisting of a C1-C2 alkyl, C1-C2 alkoxy, halogen, and -CN.

[0040] According to a specific embodiment of the present invention, n is 0 or 1, and when n is 1, R2 to R5 are hydrogen.

[0041] According to a specific embodiment of the present invention, when R7 is a C1-C3 alkyl, L1 is -C(O)- and R6 is an unsubstituted phenyl.

[0042] According to a specific embodiment of the present invention, the compound represented by Formula 1 is selected from the group consisting of compounds represented by Formulas 2 to 134 below:

[0043] Chemical formula 2 Chemical formula 3

[0044]

[0045] Chemical formula 4 Chemical formula 5

[0046]

[0047] Chemical formula 6 Chemical formula 7

[0048]

[0049] Chemical formula 8 Chemical formula 9

[0050]

[0051] Chemical formula 10 Chemical formula 11

[0052]

[0053] Chemical formula 12 Chemical formula 13

[0054]

[0055] Chemical formula 14 Chemical formula 15

[0056]

[0057] Chemical formula 16 Chemical formula 17

[0058]

[0059] Chemical formula 18 Chemical formula 19

[0060]

[0061] Chemical formula 20 Chemical formula 21

[0062]

[0063] Chemical formula 22 Chemical formula 23

[0064]

[0065] Chemical formula 24 Chemical formula 25

[0066]

[0067] Chemical formula 26 Chemical formula 27

[0068]

[0069] Chemical formula 28 Chemical formula 29

[0070]

[0071] Chemical formula 30 Chemical formula 31

[0072]

[0073] Chemical formula 32 Chemical formula 33

[0074]

[0075] Chemical formula 34 Chemical formula 35

[0076]

[0077] Chemical formula 36 Chemical formula 37

[0078]

[0079] Chemical formula 38 Chemical formula 39

[0080]

[0081] Chemical formula 40 Chemical formula 41

[0082]

[0083] Chemical formula 42 Chemical formula 43

[0084]

[0085] Chemical formula 44 Chemical formula 45

[0086]

[0087] Chemical formula 46 Chemical formula 47

[0088]

[0089] Chemical formula 48 Chemical formula 49

[0090]

[0091] Chemical formula 50 Chemical formula 51

[0092]

[0093] Chemical formula 52 Chemical formula 53

[0094]

[0095] Chemical formula 54 Chemical formula 55

[0096]

[0097] Chemical formula 56 Chemical formula 57

[0098]

[0099] Chemical formula 58 Chemical formula 59

[0100]

[0101] Chemical formula 60 Chemical formula 61

[0102]

[0103] Chemical formula 62 Chemical formula 63

[0104]

[0105] Chemical formula 64 Chemical formula 65

[0106]

[0107] Chemical formula 66 Chemical formula 67

[0108]

[0109] Chemical formula 68 Chemical formula 69

[0110]

[0111] Chemical formula 70 Chemical formula 71

[0112]

[0113] Chemical formula 72 Chemical formula 73

[0114]

[0115] Chemical formula 74 Chemical formula 75

[0116]

[0117] Chemical formula 76 Chemical formula 77

[0118]

[0119] Chemical formula 78 Chemical formula 79

[0120]

[0121] Chemical formula 80 Chemical formula 81

[0122]

[0123] Chemical formula 82 Chemical formula 83

[0124]

[0125] Chemical formula 84 Chemical formula 85

[0126]

[0127] Chemical formula 86 Chemical formula 87

[0128]

[0129] Chemical formula 88 Chemical formula 89

[0130]

[0131] Chemical formula 90 Chemical formula 91

[0132]

[0133] Chemical formula 92 Chemical formula 93

[0134]

[0135] Chemical formula 94 Chemical formula 95

[0136]

[0137] Chemical formula 96 Chemical formula 97

[0138]

[0139] Chemical formula 98 Chemical formula 99

[0140]

[0141] Chemical formula 100 Chemical formula 101

[0142]

[0143] Chemical formula 102 Chemical formula 103

[0144]

[0145] Chemical formula 104 Chemical formula 105

[0146]

[0147] Chemical formula 106 Chemical formula 107

[0148]

[0149] Chemical formula 108 Chemical formula 109

[0150]

[0151] Chemical formula 110 Chemical formula 111

[0152]

[0153] Chemical formula 112 Chemical formula 113

[0154]

[0155] Chemical formula 114 Chemical formula 115

[0156]

[0157] Chemical formula 116 Chemical formula 117

[0158]

[0159] Chemical formula 118 Chemical formula 119

[0160]

[0161] Chemical formula 120 Chemical formula 121

[0162]

[0163] Chemical formula 122 Chemical formula 123

[0164]

[0165] Chemical formula 124 Chemical formula 125

[0166]

[0167] Chemical formula 126 Chemical formula 127

[0168]

[0169] Chemical formula 128 Chemical formula 129

[0170]

[0171] Chemical formula 130 Chemical formula 131

[0172]

[0173] Chemical formula 132 Chemical formula 133

[0174]

[0175] Chemical formula 134

[0176]

[0177]

[0178] According to another aspect of the present invention, the present invention provides a composition for the prevention or treatment of degenerative brain diseases comprising the compound of the present invention described above or a pharmaceutically acceptable salt thereof as an active ingredient.

[0179] According to another aspect of the present invention, the present invention provides a method for preventing or treating a degenerative brain disease comprising the step of administering the compound of the present invention or a pharmaceutically acceptable salt thereof to a subject.

[0180] In this specification, the term “neurodegenerative diseases” encompasses diseases in which structural and functional degeneration occurs due to the irreversible loss of brain tissue and the cells constituting it. Specifically, neurodegenerative diseases that can be prevented or treated through the composition of the present invention may be tauopathy, which can be treated by blocking the binding of Tau protein to synaptic vesicles. In this specification, the term “tauopathy” encompasses diseases or pathological conditions caused by the overexpression, hyperphosphorylation, aggregation, and / or accumulation of Tau protein within cells, tissues, or organs of the central nervous system.

[0181] According to a specific embodiment of the present invention, degenerative brain diseases that can be prevented or treated by the composition of the present invention include, for example, Alzheimer's disease, argyrophilic grain disease (AGD), Lewy body dementia, frontotemporal dementia, progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinson's syndrome (PSP-P), Richardson's syndrome, Pick's disease, Niemann-Pick disease, Rasmussen's syndrome, Parkinson's disease, atypical parkinsonism in Guadeloupe, FTDP-17 (frontotemporal dementia with parkinsonism associated with chromosome 17), progressive subcortical gliosis, primary progressive aphasia, and globular gliotauopathy. tauopathy), Lytico-Bodig disease, neurodegeneration with brain iron accumulation, pantothenate kinase-associated neurodegeneration (PKAN), postencephalitic parkinsonism, chronic traumatic encephalopathy;CTE), Familial British dementia, Familial Danish dementia, Huntington's disease, Down's syndrome, Gerstmann-Straussler-Scheinker disease, Myotonic dystrophy, Leukocyte tauopathy, Amyotrophic Lateral Sclerosis (ALS), cerebral amyloid angiopathy, Senile dementia of the neurofibrillary tangle type, Motor neuron disease with neurofibrillary tangles, Diffuse neurofibrillary tangles with calcification, corticobasal degeneration, primary age-related tauopathy Includes, but is not limited to, tauopathy and traumatic brain injury.

[0182]

[0183] According to a specific embodiment of the present invention, the composition inhibits the interaction between Tau and synaptogyrin 3.

[0184] Syngr3 mediates the binding between Tau and synaptic vesicles, and the composition of the present invention blocks the binding between Tau and synaptic vesicles by significantly inhibiting this interaction between Tau and Syngr3. In this specification, the term “inhibition of interaction” means inhibiting the binding between Tau and Syngr3 (or the mediation of binding between Tau and synaptic vesicles by Synaptozyrin-3) to a measurable degree compared to the control group, specifically, it means inhibiting to a degree that significantly restores defects in vesicle motility and / or neurotransmitter secretion caused by Tau, more specifically, it means inhibiting by 30% or more compared to the control group, even more specifically by 50% or more, and most specifically by 70% or more.

[0185]

[0186] In this specification, the term “prevention” means suppressing the occurrence of a disease or illness in subjects who have not been diagnosed with having such a disease or illness but are at risk of developing such a disease or illness.

[0187] In this specification, the term “treatment” means (a) inhibition of the progression of a disease, illness, or symptom; (b) alleviation of a disease, illness, or symptom; or (c) elimination of a disease, illness, or symptom. When the composition of the present invention is administered to a subject, the interaction between Tau and Syngr3 within the central nervous system is blocked and the binding of Tau protein to synaptic vesicles is inhibited, thereby serving to inhibit, eliminate, or alleviate the progression of symptoms caused by the hyperphosphorylation, aggregation, and excessive accumulation of Tau protein. Accordingly, the composition of the present invention may serve as a composition for treating these diseases on its own, or it may be applied as an adjuvant for treatment of said diseases when administered together with other pharmacological components. Accordingly, in this specification, the terms “treatment” or “therapeutic agent” include the meaning of “therapeutic aid” or “therapeutic adjuvant.”

[0188] In this specification, the terms “administration” or “to administer” refer to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that an equal amount is formed within the subject’s body.

[0189] In the present invention, the term “therapeutic effective amount” refers to the content of a composition in which the pharmacological component within the composition is contained in an amount sufficient to provide a therapeutic or preventive effect to an individual to whom the pharmaceutical composition of the present invention is to be administered, and includes the meaning of “preventive effective amount.”

[0190] In this specification, the term “object” includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons, or rhesus monkeys. Specifically, the object of the present invention is a human.

[0191] In this specification, the term “pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. Examples of suitable acids include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, trifluoroacetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, etc. Salts derived from suitable bases may include alkali metals such as sodium, alkaline earth metals such as magnesium, and ammonium, etc.

[0192]

[0193] When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention comprises a pharmaceutically acceptable carrier.

[0194] Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may additionally include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0195] The pharmaceutical composition of the present invention may be administered orally or parenterally, and specifically, may be administered orally, intravenously, or intraventricularly.

[0196] Suitable dosages of the pharmaceutical composition of the present invention can be prescribed in various ways depending on factors such as the formulation method, mode of administration, patient's age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity. Preferred dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg / kg for adults.

[0197] The pharmaceutical composition of the present invention may be prepared in a unit volume form or contained in a multi-volume container by formulation using a pharmaceutically acceptable carrier and / or excipient, according to a method that can be easily carried out by a person skilled in the art to which the invention belongs. In this case, the formulation may be in the form of a solution, suspension, syrup, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet, or capsule, and may additionally include a dispersant or a stabilizer.

[0198] According to another aspect of the present invention, the present invention provides a functional food composition for the improvement or prevention of degenerative brain diseases comprising the compound of the present invention described above or a food-grade salt thereof as an active ingredient.

[0199] According to another aspect of the present invention, the present invention provides a method for improving or preventing degenerative brain disease, comprising the step of administering to a subject a functional food composition comprising as an active ingredient a compound of the present invention or a food-grade salt thereof as described above.

[0200] Since the pyridoindole derivative compound of Formula 1 used in the present invention and the degenerative brain disease that can be improved or prevented through it have already been described above, the description is omitted to avoid excessive duplication.

[0201] In this specification, the term “food-grade acceptable salt” refers to a salt in which a cation and an anion are combined by electrostatic attraction and is of a form that can be used in a food composition, and specific examples thereof include the examples of “pharmaceutical-grade acceptable salt” described above.

[0202] According to another aspect of the present invention, the present invention provides a functional food composition for inhibiting the interaction between Tau and synaptogyrin 3, comprising the compound of the present invention described above or a food-grade salt thereof as an active ingredient.

[0203] According to another aspect of the present invention, the present invention provides a method for inhibiting the interaction between Tau and synaptogyrin 3, comprising the step of administering to a subject a functional food composition comprising as an active ingredient a compound of the present invention or a food-grade salt thereof described above.

[0204] When the composition of the present invention is prepared as a food composition, it may include not only the compound of the present invention as an active ingredient, but also carbohydrates, seasonings, and flavorings that are typically added during food manufacturing. Examples of carbohydrates include, but are not limited to, monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavorings, natural flavorings [taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)] and synthetic flavorings (saccharin, aspartame, etc.) may be used. For example, when the food composition of the present invention is prepared as a drink, in addition to the pine bark extract which is the active ingredient of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract, licorice extract, etc. may be additionally included.

[0205]

[0206] (a) The present invention provides a novel pyridoyndole derivative compound and a composition for the prevention or treatment of degenerative brain diseases comprising the same as an active ingredient.

[0207] (b) The present invention can achieve the fundamental elimination of the cause of neurodegeneration by significantly inhibiting the interaction between Tau protein and synaptogyrin-3, moving away from conventional symptomatic treatment that focused on controlling peripheral symptoms for degenerative brain diseases, specifically various tauopathy caused by the aggregation of Tau protein.

[0208]

[0209] Figure 1 shows EGFP-fused Tau(pTK231: P CMV -Tau-EGFP) and Synaptogyrin 3(pTK233:P CMV This is a fluorescence microscope image confirming the expression of both proteins 48 hours after transfection in HEK293T cell lines transfected with EGFP-Synaptogyrin 3).

[0210] Figure 2a is a schematic diagram of the Protein Complementary Assay (PCA) process using the split luciferase method. Split luciferase is luciferase divided into two fragments, a small bit (sBit) and a large bit (Lbit). Each fragment does not normally exhibit activity, but when they come close together due to interactions with fused proteins, they reconstruct and become active. When each fragment of split luciferase is fused to Tau and Synaptogyrin3, luciferase activity can be expected due to the interaction between Tau and Synaptogyrin3. Figure 2b shows the results of measuring luciferase activity 48 hours after co-transfecting HEK293T cells with all possible combinations of fusion proteins of Tau and Synaptogyrin3, and sBit and Lbit.

[0211] Figure 3a is a schematic diagram of a gene expression regulatory system regulated by floretin. This system consists of TtgA, a synthetic transcriptional activator constructed based on the flavonoid-regulated TtgR operon of the Pseudomonas putidaDOT-T1E strain, and P, a synthetic promoter. TtgR It includes. In the absence of floretin, TtgA is P TtgR It binds to and activates transcription (without phloretin), whereas in the presence of phloretin, TtgA detaches from DNA and transcription is not activated (with phloretin). Fig. 3b shows an EGFP expression plasmid (pTK269:P) regulated by phloretin. CAG -TtgA and pTK274: P TtgR This figure shows the results of measuring EGFP values ​​48 hours after co-expressing EGFP in HEK293T and treating with various concentrations of floretin (0-50 μM).

[0212] Figure 4a is a schematic diagram of a Tau competitive assay using a gene expression system regulated by floretin. In the stable cell line HEK293T-TK252 expressing Lbit-Tau and sBit-Synaptogyrin3, when Tau protein is expressed without fusion with split luciferase, Lbit-Tau and Tau compete for the binding site of sBit-Synaptogyrin3. Consequently, interactions between Tau and Synaptogyrin3 occur where split luciferase fragments do not meet, which may lead to luciferase signal downsizing. Tau expression plasmid (pTK269: P CAG -TtgA and pTK285:P TtgR HEK293T-TK252 clones were co-transfected with -Tau and treated with floretin at various concentrations (0, 10, and 50 μM). Figure 4b shows the luciferase activity values ​​of each clone after 48 hours. Figure 4c shows the EGFP measurements of each clone after 48 hours.

[0213]

[0214] The present invention will be described in more detail below through examples. These examples are intended solely to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.

[0215]

[0216] Examples

[0217] Experimental method

[0218] Plasmid Design

[0219] The design and structural characteristics of the plasmids and oligonucleotides used in the present invention are summarized in Table 1 and Table 2, respectively.

[0220] Refer to Nomenclature, Description, and Cloning Strategy pcDNA3.1+ Constructive Mammalian Expression Vector (Bgl II-P CMV -NheI-HindⅢ-KpnI -BamHI-EcoRI-EcoRV-NotI-XhoI-XbaI-ApaI).Invitrogen pCMV6-hTau-VC155 constitutive Tau-VC155 expression vector (P CMV -Tau-VC155).[1]pGC551P GTA -driven SEAP expression vector (P GTA -SEAP). P GTA -SEAP(BglⅡ-P GTA -NheI-HindⅢ-SEAP-BamHI-EcoRI) was synthesized (Genscript, NJ, USA), cleaved with BglII / EcoRI, and inserted into the corresponding site of pcDNA3.1+[2]. The present invention pL48 constitutive expression vector (P CAG -XbaI-XhoI-NotI-BglⅡ).Undisclosed pTK106 constitutive BMP2 expression, lentiviral vector(P EF1alpha -XbaI-BMP2-EcoRI-IRES-NheI-EGFP-BamHI / P PGK[SpeI]-puroR-XhoI) Undisclosed pTK107 constitutive BMP2 expression, lentiviral vector (P PGK -NheI- BamHI- BMP2-EcoRV-NotI-IRES-copGFP-T2A-puroR-EcoRI-SalI).Undisclosed pTK201 constitutive Tau expression vector(P CMV -Tau). Tau was PCR-amplified from pCMV6-hTau-VC155 using the oligonucleotides oTK205 / oTK206, and the amplified DNA (KpnI-XbaI-Tau-BamHI-EcoRI-stop-NotI-ApaI) was cleaved with KpnI / ApaI and inserted into the corresponding region of pcDNA3.1+. The present invention pTK202 constitutive Tau expression vector (P CMV -Tau). Tau was PCR-amplified from pCMV6-hTau-VC155 using the oligonucleotides oTK207 / oTK208, and the amplified DNA (KpnI-XbaI-XhoI-BamHI-Tau-stop-NotI-ApaI) was cleaved with KpnI / ApaI and inserted into the corresponding site of pcDNA3.1+. The present invention pTK225 constitutive Tau-sBit expression vector (P CMV -Tau-sBit). Tau was cleaved from pTK201 using XbaI / BamHI and inserted into the corresponding site on pTK245. The present invention pTK226 constitutive Tau-Lbit expression vector (P CMV -Tau-Lbit). Tau was cleaved from pTK201 using XbaI / BamHI and inserted into the corresponding site of pTK246. The present invention pTK227 constitutive sBit-Tau expression vector (P CMV -sBit-Tau). Tau was excised from pTK202 using BamHI / NotI and inserted into the corresponding site on pTK247. The present invention pTK228 constitutive Lbit-Tau expression vector (P CMV-Lbit-Tau). Tau was excised from pTK202 using BamHI / NotI and inserted into the corresponding site of pTK248. The present invention pTK231 constitutive Tau-EGFP expression vector (P CMV -Tau-EGFP). EGFP was PCR-amplified from pTK106 using the oligonucleotides oTK237 / oTK238, and the amplified DNA (BamHI-XbaI-EGFP-EcoRI-BamHI) was cleaved with BamHI / EcoRI and inserted into the corresponding site of pTK201. The present invention pTK233-constitutive EGFP-Synaptogyrin 3 expression vector (P CMV -EGFP- Synaptogyrin 3). EGFP was PCR-amplified from pTK106 using the oligonucleotides oTK237 / oTK238, and the amplified DNA (BamHI-XbaI-EGFP-EcoRI-BamHI) was cleaved with XbaI / BamHI and inserted into the corresponding site of pTK248. The present invention pTK236 constitutive sBit-Tau expression, lentiviral vector (P EF1alpha - sBit-Tau-IRES-EGFP / P PGK [SpeI]-puroR-XhoI).sBit-Tau was PCR-amplified from pTK227 using the oligonucleotide oTK243 / pTK244, and the amplified DNA (XbaI-sBit-Tau-stop-EcoRI) was cleaved with XbaI / EcoRI and inserted into the corresponding site of pTK106. The present invention pTK238 constitutive Lbit-Synaptogyrin 3, lentivirus expression vector (P PGK [SpeI]-Lbit-Synaptogyrin 3-IRES-copGFP-T2A-puroR-EcoRI-SalI). Lbit-Synaptogyrin 3 was cleaved from pTK248 using NheI / NotI and inserted into the corresponding site of pTK107. The present invention pTK245 constitutive Synaptogyrin 3-sBit expression vector (P CMV- Synaptogyrin 3-sBit). Synaptogyrin 3-sBit (XbaI-Synaptogyrin 3-BamHI-linker-sBit-stop-EcoRI) was synthesized (Cosmogenetech, Seoul, Korea), cleaved with XbaI / EcoRI, and inserted into the corresponding site of pTK201. The present invention pTK246 constitutive Synaptogyrin 3-Lbit expression vector (P CMV - Synaptogyrin 3-Lbit). Synaptogyrin 3-Lbit (XbaI-Synaptogyrin 3-BamHI-linker-Lbit-stop-EcoRI) was synthesized (Cosmogenetech, Seoul, Korea), cleaved with XbaI / EcoRI, and inserted into the corresponding site of pTK201. The present invention pTK247 constitutive sBit-Synaptogyrin 3 expression vector (P CMV -sBit-Synaptogyrin 3). sBit-Synaptogyrin 3 (XhoI-sBit-linker-BamHI-Synaptogyrin3-stop-NotI) was synthesized (Cosmogenetech, Seoul, Korea), cleaved with XhoI / NotI, and inserted into the corresponding site of pTK202. The present invention pTK248 constitutive Lbit-Synaptogyrin 3 expression vector (P CMV -Lbit-Synaptogyrin3). Lbit-Synaptogyrin 3 (XhoI-Lbit-linker-BamHI-Synpatogyrin3-stop-NotI) was synthesized (Cosmogenetech, Seoul, Korea), cleaved with XhoI / NotI, and inserted into the corresponding site of pTK202. The present invention pTK252-component sBit-Tau and Lbit-Synpatogyrin 3-expressing lentiviral vector (P EF1alpha -sBit-Tau-IRES-EGFP / P PGK -Lbit-Synaptogyrin 3-IRES-copGFP-T2A-puroR). P PGKSynaptogyrin 3-IRES-copGFP-T2A-puroR was excised from pTK238 using SpeI / SalI and inserted into a suitable site (SpeI / XhoI) of pTK236. pTK23P of the present invention ttg -driven SEAP expression vector (P ttg -SEAP). Using oligonucleotides oTK267 / oTK268 from pGC551 P ttg PCR-amplify and the amplified DNA (BglⅡ-P ttg -XhoI-HindⅢ-BamHI-stop-EcoRI-stop-XbaI) was cleaved into BglⅡ / HindⅢ and inserted into the corresponding site of pGC551[3], the present invention pTK269 constitutive TtgA expression vector (P CAG -TtgA). TtgA (KpnI-XhoI-TtgA-stop-BamHI) was synthesized (Cosmogenetech, Seoul, Korea), cleaved into XhoI / BamHI, and inserted into the corresponding site (XhoI / BglⅡ) of pL48.[3], the present invention pTK273P TtgR -driven expression vector (P TtgR -MCS). Using oligonucleotides oTK267 / oTK268, P from pGC551 ttg Amplify, and the amplified DNA (BglⅡ-P TtgR -XhoI-HindⅢ-BamHI-stop- EcoRI-stop-XbaI) was cut into BglⅡ / XbaI and inserted into the corresponding site of pGC551[3], the present invention pTK274P TtgR -driven EGFP expression vector (P TtgR -EGFP). EGFP using BamHI-EcoRI on pTK258(pP EF1alpha -KpnI-XhoI- Tau [0N4R]-BamHI-XbaI-EGFP-EcoRI) was excised and inserted into the corresponding site of pTK273[3], the present invention pTK285P TtgR -driven Tau expression vector (PTtgR -Tau[1N4R]). Tau[1N4R] was synthesized by assembly PCR using pTK201 and oligonucleotides oTK251 / oTK252 / oTK253 / oTK254, and the synthesized DNA (KpnI-XhoI-Tau[1N4R]-BamHI-EcoRI) was cleaved with XhoI / BamHI and inserted into the corresponding site of pTK273. The present invention

[0221]

[0222] GTA: Cyclic-GMP-Reactive Transcriptional Activator, IRES: Internal Ribosome Influx Site, Lbit: Large Bit (Large fragment of split luciferase), MCS: Multiple Cloning Site, P CMV : Synthetic mammalian promoter containing cytomegalovirus early enhancer and chicken beta-actin gene promoter, P CMV : Human cytomegalovirus-derived mammalian promoter, P EF1alpha : Mammalian promoter derived from human EF-1α (elongation factor 1α), P GTA : GTA-induced cyclic-GMP-reactive promoter (GTA-specific actuator and P CMV Minimal Promoter),P PGK : Phosphoglyceric acid kinase gene-derived mammalian promoter, P PGK [SpeI]:P PGK Present the SpeI restriction site within the promoter, P TtgR : TtgA-induced floretin-responsive promoter (TtgA-specific operator and P CMVMinimal promoter), puroR: Puromycin-resistance gene, sBit: Small Bit (small fragment of split luciferase), Tau: Microtubule-associated protein tau 2N4R isoform (UniProt P10636-8 [Tau-F], GenBank NM_005910), Tau[0N4R]: Microtubule-associated protein tau 0N4R subtype (UniProt P10636-6 [Tau-D]), Tau[1N4R]: Microtubule-associated protein tau 1N4R subtype (UniProt P10636-7 [Tau-E]), TtgA: Pholetin-responsive transcription activator (VP16-fused Peudomanas putidaTtgR), VC155: Venus fragment of the fluorescent protein of BiFC (Bimolecular fluorescence complementation)

[0223]

[0224] 명칭서열oTK205atgaggtacctcttctagagccaccatggctgagccccgccagoTK206ttatgggccctgcggccgcacttcagaattcacctgcggatcccaaaccctgcttggccagoTK207atgaggtacctcttctagagacatcctcgagaatgtaggatccgccaccatggctgagccccgccagoTK208ttatgggccctgcggccgcacttcacaaaccctgcttggccagoTK237aataggatcctcaggcagctctagagccaccatggtgagcaagggcgaggaoTK238ataaggatccgcttccgctgaattccttgtacagctcgtccatgccoTK243aattctagagccaccatggtgaccggctatcgcctoTK244attattgaattcctacaaaccctgcttggccagggoTK251aatggtacctccgcactcgaggccaccatggctgagccccgccaggagoTK252gccgattccggcctcctcggcttccgctgttggagtgctcttoTK253gccgaggaggccggaatcggcgacacccccagcctggaagacoTK254aatagaattcggcagcggatcccaaaccctgcttggccagggaoTK267aagagatctcagtatttacaaacaaccatgaatgtaagtatattccgtcgacgtcgagctcggtacccgggtcoTK268aatctagagctttagaattcgctttaggatccgctaagcttgctgctctcgaggctccctatagtgagtcg

[0225]

[0226] 세포 배양 및 형질감염

[0227] Human embryonic kidney cells (HEK293T, ATCC: CRL-11268) were cultured in a humidified CO2 (5%) incubator at 37°C with OptiMEM (Cat# 51985091 / Gibco. ThermoFisher Korea, Seoul, Korea) supplemented with 8% (v / v) fetal bovine serum (FBS, US origin Cat# 16140-089, Lot# 2394274P / Gibco. ThermoFisher Korea, Seoul, Korea). 18 hours prior to transfection, 10 6 Dog cells were seeded into 10 ml of culture medium in a 100 mm culture dish. 10 μg of DNA was added to 2 ml of OptiMEM, followed by the addition of 30 μg of PEI (1 μg / μl in distilled water, pH 7.4. Cat# 23966-100. Polyscience, PA, USA), and the mixture was vortexed immediately for 3 seconds. After incubating at room temperature for 30 minutes, the DNA-PEI mixture was added to the cells. When different types of cell culture plates were used, the cell number, DNA, and PEI amounts were adjusted according to the culture volume of the plate.

[0228]

[0229] measurement

[0230] SEAP: The production of SEAP (Secreted alkaline phosphatase) in cell culture medium was quantified by absorbance analysis using 4-nitrophenylphosphate (pNpp. CarboSynth, Berkshire, UK) [1].

[0231] Luciferase Assay: The activity of luciferase expressed in living cells was measured using the NanoGlo® Live Cell Assay System (Cat# N2012. Promega, WI, USA) according to the manufacturer's instructions. All microplate-based measurements were performed using the BioTek Synergy H1 (Agilent. CA, USA).

[0232]

[0233] cell line

[0234] To construct a stable cell line for drug screening, pTK252 linearized with Bgl II restriction enzyme was transfected into HEK293T cells (HEK293T-TK252). 24 hours after transfection, cells were cultured for 9 days in culture medium containing 1 μg / ml puromycin (10 mM in DMSO, Cat# J61278 / Alfa Aesar. ThermoFisher Korea, Seoul, Korea). Regular medium changes were performed every 3 days with a predetermined concentration of puromycin. Selected cells were treated with trypsin, diluted to 5 cells / ml, seeded into 4 x 96-well plates (100 μl / well), and cultured for 11 days in culture medium containing 1 μg / ml puromycin. Eighteen wells containing only GFP-positive cells were selected and cultured for 14 days in a culture medium containing 0.1-0.2 μg / ml puromycin. Ten clones that showed non-GFP cells were excluded, and the performance of eight clones was evaluated. The selected clone (1E2) was cultured in a medium containing 0.5 μg / ml puromycin and used for subsequent experiments.

[0235]

[0236] IC of the novel derivative 50 measurement

[0237] 3 μmol each of 199 novel derivatives was dissolved in 300 μl DMSO (10 mM) and stored at -80°C. 48 hours prior to compound treatment, 4 x 10 4 HEK293T-TK252-1E2 cells were seeded into 100 μl of culture medium in 96 Whitewell cell culture plates (Cat# 30196. SPL, Seoul, Korea). IC 50For the dose-dependent test for measurement, the amount of compound to be diluted to 0, 0.5, 1, 2.5, 5, 10, and 20 μM per well was adjusted to the volumes described above. 48 hours after compound treatment, the cells were washed once with OptiMEM, and luciferase activity, fluorescence intensity, and fluorescence area were measured.

[0238] Number Structure Formula Number Structure Formula 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134

[0239] Preparation Example 1: Preparation of 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compounds 1-7)

[0240] Preparation Example 1-1: Preparation of 8-Bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 1-3)

[0241]

[0242] (4-bromophenyl)hydrazine hydrochloride (1 g, 4.47 mmol) and tert-butyl 2-methyl-4-oxopiperidine-1-carboxylate (1 g, 4.7 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.56 mL, 8 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 3 hours. After the reaction was complete, the mixture was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered through diethyl ether to obtain 505 mg (yield 43%) of the title compound.

[0243] 1H NMR (400 MHz, DMSO) δ 10.93 (s, 1H), 7.49 (s, 1H), 7.22 (d, J = 8.5 Hz, 1H), 7.09 (dd, J = 8.5, 2.0 Hz, 1H), 3.90 (d, J = 14.8 Hz, 1H), 3.81 (d, J = 14.8 Hz, 1H), 2.94 (dq, J = 10.6, 5.0, 4.5 Hz, 1H), 2.69 (dd, J = 15.6, 3.9 Hz, 1H), 2.36 (dd, J = 16.0, 9.8 Hz, 1H), 1.19 (d, J = 6.2 Hz, 3H).

[0244]

[0245] Preparation Example 1-2: Preparation of tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 1-4)

[0246]

[0247] 8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (505 mg, 1.9 mmol) was dissolved in a THF solution under nitrogen, and then Boc2O (0.483 mL, 2.1 mmol) was added. The reaction mixture was stirred at room temperature for 15 hours. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with hexane to obtain 617 mg (yield 89%) of the title compound.

[0248] 1H NMR (400 MHz, DMSO) δ 11.12 (s, 1H), 7.60 (d, J = 1.8 Hz, 1H), 7.26 (d, J = 8.5 Hz, 1H), 7.15 (dd, J = 8.5, 1.8 Hz, 1H), 4.84 (d, J = 15.9) Hz, 1H), 4.74 (s, 1H), 4.08 (d, J = 15.7 Hz, 1H), 3.04 (dd, J = 16.4, 6.1 Hz, 1H), 2.57 (d, J = 16.4 Hz, 1H), 1.45 (s, 9H), 1.10 (d, J = 6.8 Hz, 3H).

[0249]

[0250] Preparation Examples 1-3: Preparation of tert-butyl 3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 1-6)

[0251]

[0252] Tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.55 mmol), p-tolylboronic acid (231 mg, 1.7 mmol), and Pd(PPh3)4 (29 mg, 0.025 mmol) were dissolved in a toluene:EtOH (1:1) solution. 1M Na2CO3 (1.4 mL, 1.4 mmol) was added. The reaction mixture was stirred at 100 °C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was analyzed by column chromatography to obtain 167 mg (yield 80%) of the title compound.

[0253] 1H NMR (400 MHz, DMSO) δ 10.93 (s, 1H), 7.64 (s, 1H), 7.58 (d, J = 8.2 Hz, 2H), 7.39 - 7.29 (m, 2H), 7.24 (d, J = 8.0 Hz, 2H), 4.91 (d, J = 15.8 Hz, 1H), 4.77 (s, 1H), 4.15 (s, 1H), 3.06 (d, J = 11.8 Hz, 1H), 2.58 (d, J = 16.3 Hz, 1H), 2.34 (s, 3H), 1.46 (s, 9H), 1.13 (d, J = 6.8 Hz, 3H).

[0254]

[0255] Preparation Examples 1-4: Preparation of 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 1-7)

[0256]

[0257] tert-butyl 3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (167 mg, 0.44 mmol) was dissolved in a 1,4-dioxane solution. An HCl solution (4 M in dioxane) (2.2 mL, 8.8 mmol) was added. The mixture was stirred at room temperature for 6 hours. After the reaction was complete, the solution was removed under reduced pressure. The resulting solid was filtered through ethyl acetate to obtain 100 mg of the title compound (yield 73%).

[0258] 1H NMR (400 MHz, DMSO) δ 11.21 (s, 1H), 9.49 (d, J = 10.8 Hz, 1H), 9.25 (s, 1H), 7.77 (s, 1H), 7.58 (d, J = 7.8 Hz, 2H), 7.40 (s, 2H), 7.26 (d, J = 7.8 Hz, 2H), 4.44 (d, J = 14.6 Hz, 1H), 4.33 (d, J = 10.4 Hz, 1H), 3.70 (s, 1H), 3.12 (dd, J = 16.8, 4.8 Hz, 1H), 2.84 (dd, J = 16.8, 9.9 Hz, 1H), 2.35 (s, 3H), 1.46 (d, J = 6.5 Hz, 3H).

[0259]

[0260] Preparation Example 2: Preparation of (3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 2)

[0261]

[0262] 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (25 mg, 0.08 mmol) was dissolved in dimethylformamide under nitrogen. Benzoic acid (15 mg, 0.12 mmol), EDCI (61 mg, 0.32 mmol), and DIPEA (0.056 mL, 0.32 mmol) were added. The reaction mixture was stirred at room temperature for 15 hours. Upon completion of the reaction, extraction was performed using distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 4 mg (yield 13%) of the title compound.

[0263] 1H NMR (400 MHz, DMSO) δ 11.00 (s, 1H), 7.76 (s, 1H), 7.60 (s, 1H), 7.49 (s, 6H), 7.36 (s, 2H), 7.24 (s, 2H), 5.44 (d, J=16.6 Hz, 1H), 4.52(s, 1H), 4.29(s, 1H), 3.22-3.13(m, 1H), 2.61(s, 1H), 2.34(s, 3H), 1.20(s, 3H).

[0264]

[0265] Preparation Example 3: Preparation of (3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 3)

[0266]

[0267] 20 mg (yield 53%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), 4-methylbenzoic acid (20 mg, 0.15 mmol), EDCI (75 mg, 0.39 mmol), and DIPEA (0.068 mL, 0.39 mmol) in the same manner as in Preparation Example 2.

[0268] 1 H NMR (400 MHz, DMSO) δ 10.99 (s, 1H), 7.75 (s, 1H), 7.59 (s, 2H), 7.36 (d, J = 7.5 Hz, 4H), 7.30 (s, 2H), 7.24 (s, 2H), 5.39 (s, 1H), 4.33 (s, 1H), 4.21 (s, 1H), 3.16 (d, J = 12.9 Hz, 1H), 2.60 (s, 1H), 2.37 (s, 3H), 2.34 (s, 3H), 1.20 (s, 3H).

[0269]

[0270] Preparation Example 4: Preparation of (3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(6-methylpyridine-3-yl)methanone (Compound 4)

[0271]

[0272] 20 mg (yield 53%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), 6-methylnicotinic acid (21 mg, 0.15 mmol), EDCI (75 mg, 0.39 mmol), and DIPEA (0.068 mL, 0.39 mmol) in the same manner as in Preparation Example 2.

[0273] 1 H NMR (400 MHz, DMSO) δ 11.00 (s, 1H), 8.56 (s, 1H), 7.78 (d, J = 15.2 Hz, 1H), 7.60 (s, 2H), 7.54 (s, 1H), 7.37 (d, J = 9.0 Hz, 3H), 7.24 (s, 2H), 5.48 - 5.28 (m, 1H), 4.43 (d, J = 137.4 Hz, 2H), 3.20 (s, 1H), 2.61 (s, 1H), 2.54 (s, 3H), 2.34 (s, 3H), 1.22 (s, 3H).

[0274]

[0275] Preparation Example 5: Preparation of (4,4-dimethyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 5)

[0276] Preparation Example 5-1: Preparation of 8-Bromo-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 5-2)

[0277]

[0278] (4-bromophenyl)hydrazine hydrochloride (1 g, 4.47 mmol) and tert-butyl 3,3-dimethyl-4-oxopiperidine-1-carboxylate (1.07 g, 4.7 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.56 ml, 8.0 M) was added to the reaction mixture while stirring at 0 °C. The mixture was stirred at 110 °C for 3 hours using a sealed tube. After the reaction was complete, the mixture was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered with diethyl ether to obtain 936 mg (yield 75%) of the title compound.

[0279] 1 H NMR (400 MHz, DMSO) δ 11.01 (s, 1H), 7.47 (d, J = 2.0 Hz, 1H), 7.23 (d, J = 8.5 Hz, 1H), 7.10 (dd, J = 8.5, 2.0 Hz, 1H), 3.78 (s, 2H), 2.71 (s, 2H), 1.25 (s, 6H).

[0280]

[0281] Preparation Example 5-2: Preparation of tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 5-3)

[0282]

[0283] 993 mg (yield 71%) of the title compound was obtained using 8-bromo-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (1.03 g, 3.69 mmol) and Boc2O (0.93 mL, 4.06 mmol) in the same manner as in Preparation Example 1-2.

[0284] 1H NMR (400 MHz, DMSO) δ 11.19 (s, 1H), 7.60 (d, J = 2.0 Hz, 1H), 7.27 (d, J = 8.5 Hz, 1H), 7.15 (dd, J = 8.6, 2.0 Hz, 1H), 4.51 (s, 2H), 3.45 (s, 2H), 1.44 (s, 9H), 1.26 (s, 6H).

[0285]

[0286] Preparation Example 5-3: Preparation of tert-butyl 4,4-dimethyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 5-4)

[0287]

[0288] 197 mg (yield 58%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (330 mg, 0.87 mmol), p-tolylboronic acid (355 mg, 2.61 mmol), Pd(PPh3)4 (51 mg, 0.04 mmol) and 1 M Na2CO3 (2.18 mL, 2.18 mmol) in the same manner as in Preparation Examples 1-3.

[0289] 1 H NMR (400 MHz, DMSO) δ 11.00 (s, 1H), 7.64 (s, 1H), 7.57 (d, J = 7.9 Hz, 2H), 7.35 (d, J = 3.3 Hz, 2H), 7.24 (d, J = 7.8 Hz, 2H), 4.59 (s, 2H), 3.47 (s, 2H), 2.34 (s, 3H), 1.45 (s, 9H), 1.28 (s, 6H).

[0290]

[0291] Preparation Example 5-4: Preparation of 4,4-dimethyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 5-5)

[0292]

[0293] 125 mg (yield 86%) of the title compound was obtained using tert-butyl 4,4-dimethyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (197 mg, 0.51 mmol) and an HCl solution (4 M in dioxane) (2.5 mL, 10.0 mmol) in the same manner as in Preparation Examples 1-4.

[0294] 1 H NMR (400 MHz, DMSO) δ 11.33 (s, 1H), 9.26 (s, 2H), 7.78 (d, J = 1.3 Hz, 1H), 7.57 (d, J = 8.2 Hz, 2H), 7.41 (d, J = 1.3 Hz, 2H), 7.26 (d, J) = 7.9 Hz, 2H), 4.33 (s, 2H), 3.32 (s, 2H), 2.35 (s, 3H), 1.43 (s, 6H).

[0295]

[0296] Preparation Example 5-5: Preparation of (4,4-dimethyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 5)

[0297]

[0298] 22 mg (yield 61%) of the title compound was obtained using 4,4-dimethyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.09 mmol), benzoic acid (17 mg, 0.14 mmol), EDCI (71 mg, 0.37 mmol), and DIPEA (0.06 mL, 0.37 mmol) in the same manner as in Preparation Example 2.

[0299] 1H NMR (400 MHz, DMSO) δ 11.06 (d, J = 24.9 Hz, 1H), 7.67 (d, J = 59.6 Hz, 2H), 7.46 (d, J = 13.4 Hz, 6H), 7.37 (s, 2H), 7.22 (d, J = 20.5 Hz, 2H), 4.89 (s, 1H), 4.60 (s, 1H), 3.81 (s, 1H), 3.47 (s, 1H), 2.32 (s, 3H), 1.37 (s, 3H), 1.18 (s, 3H).

[0300]

[0301] Preparation Example 6: Preparation of (4,4-dimethyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 6)

[0302]

[0303] 21 mg (yield 56%) of the title compound was obtained using 4,4-dimethyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.09 mmol), 4-methylbenzoic acid (19 mg, 0.14 mmol), EDCI (71 mg, 0.37 mmol), and DIPEA (0.06 mL, 0.37 mmol) in the same manner as in Preparation Example 2.

[0304] 1 H NMR (400 MHz, DMSO) δ 11.07 (s, 1H), 7.74 (s, 1H), 7.50 (s, 2H), 7.34 (d, J = 8.2 Hz, 4H), 7.28 (d, J = 7.8 Hz, 3H), 7.22 (s, 1H), 4.87 (s, 1H), 4.62 (s, 1H), 3.80 (s, 1H), 3.49 (s, 1H), 2.35 (d, J = 14.8 Hz, 6H), 1.36 (s, 3H), 1.19 (s, 3H).

[0305]

[0306] Preparation Example 7: Preparation of (4,4-dimethyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(6-methylpyridine-3-yl)methanone (Compound 7)

[0307]

[0308] 25 mg (yield 66%) of the title compound was obtained using 4,4-dimethyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.09 mmol), 6-methylnicotinic acid (19 mg, 0.14 mmol), EDCI (71 mg, 0.37 mmol), and DIPEA (0.06 mL, 0.37 mmol) in the same manner as in Preparation Example 2.

[0309] 1 H NMR (400 MHz, DMSO) δ 11.06 (d, J = 18.9 Hz, 1H), 8.55 (s, 1H), 7.87 - 7.64 (m, 2H), 7.56 (d, J = 28.6 Hz, 2H), 7.37 (s, 3H), 7.22 (d, J = 17.6 Hz, 2H), 4.89 (s, 1H), 4.65 (s, 1H), 3.81 (s, 1H), 3.49 (s, 1H), 2.54 (s, 3H), 2.33 (d, J = 9.3 Hz, 3H), 1.37 (s, 3H), 1.20 (s, 3H).

[0310]

[0311] Preparation Example 8: Preparation of 4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 8)

[0312] Preparation Example 8-1: Preparation of tert-butyl 8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 8-2)

[0313]

[0314] 144 mg (yield 45%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), (4-cyanophenyl)boronic acid (361 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol) and 1 M Na2CO3 (2.05 mL, 2.05 mmol) in the same manner as in Preparation Examples 1-3.

[0315] 1 H NMR (400 MHz, DMSO) δ 11.09(s, 1H), 7.93 (d, J=8.6 Hz, 2H), 7.91-7.82(m, 3H), 7.46(dd, J=8.5, 1.8Hz, 1H), 7.41(dd, J=8.4, 0.7 Hz, 1H), 4.94(d, J=15.9 Hz, 1H), 4.77(s, 1H), 4.17(d, J=15.5 Hz, 1H), 3.07 (dd, J=16.1, 6.1 Hz, 1H), 2.59(d, J = 16.3 Hz, 1H), 1.46(s, 9H), 1.13(d, J=6.8 Hz, 3H).

[0316]

[0317] Preparation Example 8-2: Preparation of 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 8-3)

[0318]

[0319] 104 mg (yield 87%) of the title compound was obtained using tert-butyl 8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (144 mg, 0.37 mmol) and an HCl solution (4 M in dioxane) (1.9 mL, 7.4 mmol) in the same manner as in Preparation Examples 1-4.

[0320] 1H NMR (400 MHz, DMSO) δ 11.38 (s, 1H), 9.59 - 9.48 (m, 1H), 9.30 (d, J = 9.7 Hz, 1H), 7.94 (dd, J = 18.5, 1.4 Hz, 5H), 7.56 - 7.43 (m, 2H), 4.44 (d, J = 14.6 Hz, 1H), 4.38 - 4.28 (m, 1H), 3.71 (s, 1H), 3.13 (dd, J = 17.0, 4.7 Hz, 1H), 2.85 (dd, J = 16.9, 9.9 Hz, 1H), 1.47 (d, J = 6.5 Hz, 3H).

[0321]

[0322] Preparation Example 8-3: Preparation of 4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 8)

[0323]

[0324] 18 mg (yield 60%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (25 mg, 0.08 mmol), benzoic acid (15 mg, 0.12 mmol), EDCI (60 mg, 0.31 mmol), and DIPEA (0.054 mL, 0.31 mmol) in the same manner as in Preparation Example 2.

[0325] 1 H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 7.92 (d, J = 33.2 Hz, 5H), 7.46 (d, J = 21.0 Hz, 7H), 5.47 (d, J = 16.3 Hz, 1H), 4.59 - 4.21 (m, 2H), 3.16 (s, 1H), 2.61 (s, 1H), 1.20 (s, 3H).

[0326]

[0327] Preparation Example 9: Preparation of 4-(3-methyl-2-(4-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 9)

[0328]

[0329] 14 mg (yield 45%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (25 mg, 0.08 mmol), 4-methylbenzoic acid (16 mg, 0.12 mmol), EDCI (60 mg, 0.31 mmol), and DIPEA (0.054 mL, 0.31 mmol) in the same manner as in Preparation Example 2.

[0330] 1 H NMR (400 MHz, DMSO) δ 11.15 (s, 1H), 7.94 (s, 1H), 7.87 (s, 3H), 7.40 (dd, J = 32.8, 9.6 Hz, 5H), 7.29 (d, J = 7.7 Hz, 2H), 5.50 - 5.24 (m, 1H), 4.59 (d, J = 64.2 Hz, 1H), 4.28 (d, J = 46.6 Hz, 1H), 3.22 - 3.13 (m, 1H), 2.61 (s, 1H), 2.37 (s, 3H), 1.19 (s, 3H).

[0331]

[0332] Preparation Example 10: Preparation of 4-(3-methyl-2-(6-methylnicotinoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 10)

[0333]

[0334] 20 mg (yield 49%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (25 mg, 0.08 mmol), 6-methylnicotinic acid (16 mg, 0.12 mmol), EDCI (60 mg, 0.31 mmol), and DIPEA (0.054 mL, 0.31 mmol) in the same manner as in Preparation Example 2.

[0335] 1 H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 8.56 (s, 1H), 7.96 (s, 2H), 7.87 (s, 3H), 7.80 (s, 1H), 7.45 (d, J = 16.4 Hz, 2H), 7.37 (d, J = 8.1 Hz, 1H), 5.51 - 5.30 (m, 1H), 4.62 (s, 1H), 4.24 (d, J = 22.7 Hz, 1H), 3.21 (s, 1H), 2.54 (s, 4H), 1.21 (s, 3H).

[0336]

[0337] Preparation Example 11: Preparation of (1-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 11)

[0338] Preparation Example 11-1: Preparation of a mixture of 8-bromo-1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole / 8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 11-1 / 1-3)

[0339]

[0340] (4-bromophenyl)hydrazine hydrochloride (1 g, 4.47 mmol) and tert-butyl 2-methyl-4-oxopiperidine-1-carboxylate (1 g, 4.7 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.56 mL, 8 M) was added to the reaction mixture while stirring at 0°C. Using a sealed tube, the reaction mixture was stirred at 110°C for 3 hours. After the reaction was complete, it was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure. After filtration with diethyl ether and subsequent concentration under reduced pressure, 420 mg of a positional isomer mixture was obtained.

[0341]

[0342] Preparation Example 11-2: Preparation of a mixture of tert-butyl 8-bromo-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 11-2 / 1-4)

[0343]

[0344] 225 mg of a positional isomer mixture was obtained using a mixture of 8-bromo-1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole / 8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (compound 11-1 / 1-3) (420 mg, 1.58 mmol) and Boc2O (0.40 mL, 1.75 mmol) in the same manner as in Preparation Example 1-2.

[0345]

[0346] Preparation Example 11-3: Preparation of a mixture of tert-butyl 1-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 11-3 / 1-6)

[0347]

[0348] In the same manner as in Preparation Examples 1-3, 153 mg of a positional isomer mixture was obtained using a mixture of tert-butyl 8-bromo-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compound 11-2 / 1-4) (215 mg, 0.59 mmol), p-tolylboronic acid (241 mg, 1.77 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1 M Na2CO3 (1.48 mL, 1.48 mmol).

[0349]

[0350] Preparation Example 11-4: Preparation of a mixture of 1-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 11-4 / 1-7).

[0351]

[0352] In the same manner as in Preparation Examples 1-4, 93 mg of a positional isomer mixture was obtained using a mixture (153 mg, 0.41 mmol) of tert-butyl 1-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 11-3 / 1-6) and an HCl solution (4 M in dioxane) (2.1 mL, 8.2 mmol).

[0353]

[0354] Preparation Example 11-5: Preparation of (1-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 11)

[0355]

[0356] A mixture of 1-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (compound 11-4 / 1-7) (30 mg, 0.096 mmol) was dissolved in dimethylformamide under nitrogen. Benzoic acid (17 mg, 0.14 mmol), EDCI (75 mg, 0.39 mmol), and DIPEA (0.067 mL, 0.39 mmol) were added. The reaction mixture was stirred at room temperature for 15 hours, and after the reaction was complete, it was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtered liquid was concentrated under reduced pressure and purified through column chromatography, and then subjected to preparative thin-layer chromatography to obtain 8 mg (yield 22%) of the above-mentioned compound (11).

[0357] 1H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 7.74 (s, 1H), 7.61 (d, J = 7.7 Hz, 2H), 7.48 (s, 4H), 7.42 (s, 1H), 7.36 (s, 1H), 7.25 (d, J = 7.8) Hz, 2H), 7.19 (s, 1H), 5.80 (d, J = 7.0 Hz, 1H), 4.85 (d, J = 78.1 Hz, 1H), 3.74 (d, J = 12.2 Hz, 1H), 3.04 - 2.92 (m, 1H), 2.76 (d, J = 36.4 Hz, 1H), 2.33 (d, J = 16.4 Hz, 3H), 1.57 (d, J = 7.0 Hz, 3H).

[0358]

[0359] Preparation Example 12: Preparation of (1-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 12)

[0360]

[0361] In the same manner as in Preparation Example 11-5, 8 mg (yield 21%) of the title compound (12) was prepared using a mixture of 1-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 11-4 / 1-7) (30 mg, 0.096 mmol), 4-methylbenzoic acid (19 mg, 0.14 mmol), EDCI (75 mg, 0.39 mmol), and DIPEA (0.067 mL, 0.39 mmol).

[0362] 1H NMR (400 MHz, DMSO) δ 11.01(s, 1H), 7.73(s, 1H), 7.61(d, J=7.8 Hz, 1H), 7.48(d, J=26.7 Hz, 1H), 7.35(s, 2H), 7.27(dd, J=15.8, 7.8 Hz, 5H), 7.19 (s, 1H), 5.78 (s, 1H), 4.98 (s, 1H), 3.77(s, 1H), 2.95 (d, J=11.3 Hz, 1H), 2.75 (d, J=31.5 Hz, 1H), 2.36(d, J=9.4 Hz, 6H), 1.56(d, J=6.5 Hz, 3H).

[0363]

[0364] Preparation Example 13: Preparation of 4-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 13)

[0365] Preparation Example 13-1: Preparation of tert-butyl 8-(4-cyanophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 13-1)

[0366]

[0367] 197 mg (yield 56%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (330 mg, 0.87 mmol), (4-cyanophenyl)boronic acid (384 mg, 2.62 mmol), Pd(PPh3)4 (51 mg, 0.04 mmol) and 1 M Na2CO3 (2.18 mL, 2.18 mmol) in the same manner as in Preparation Examples 1-3.

[0368] 1H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 7.96 - 7.81 (m, 5H), 7.50 - 7.38 (m, 2H), 4.61 (s, 2H), 3.48 (s, 2H), 1.45 (s, 9H), 1.29 (s, 6H).

[0369]

[0370] Preparation Example 13-2: Preparation of 4-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 13-2)

[0371]

[0372] 135 mg (yield 82%) of the title compound was obtained using tert-butyl 8-(4-cyanophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (197 mg, 0.49 mmol) and an HCl solution (4 M in dioxane) (2.5 mL, 9.8 mmol) in the same manner as in Preparation Examples 1-4.

[0373] 1 H NMR (400 MHz, DMSO) δ 11.49 (s, 1H), 9.22 (s, 2H), 7.97 (d, J = 1.8 Hz, 1H), 7.91 (s, 4H), 7.54 (dd, J = 8.5, 1.8 Hz, 1H), 7.47 (d, J = 8.4 Hz, 1H), 4.35 (s, 2H), 3.33 (s, 2H), 1.43 (s, 6H).

[0374]

[0375] Preparation Example 13-3: Preparation of 4-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 13)

[0376]

[0377] In the same manner as in Preparation Example 2, 20 mg (yield 55%) of the above-mentioned title compound was obtained using 4-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.089 mmol), benzoic acid (16 mg, 0.13 mmol), EDCI (69 mg, 0.36 mmol), and DIPEA (0.063 mL, 0.36 mmol).

[0378] 1 H NMR (400 MHz, DMSO) δ 11.21 (d, J = 23.3 Hz, 1H), 7.96 (s, 1H), 7.84 (s, 3H), 7.66 (s, 1H), 7.52 - 7.40 (m, 7H), 4.91 (s, 1H), 4.62 (s, 1H), 3.82 (s, 1H), 3.48 (s, 1H), 1.38 (s, 3H), 1.20 (s, 3H).

[0379]

[0380] Preparation Example 14: Preparation of 4-(4,4-dimethyl-2-(4-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 14)

[0381]

[0382] 27 mg (yield 72%) of the title compound was obtained using 4-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.089 mmol), 4-methylbenzoic acid (18 mg, 0.13 mmol), EDCI (69 mg, 0.36 mmol), and DIPEA (0.063 mL, 0.36 mmol) in the same manner as in Preparation Example 2.

[0383] 1H NMR (400 MHz, DMSO) δ 11.22 (s, 1H), 7.94 (s, 1H), 7.86 (s, 3H), 7.69 (s, 1H), 7.42 (d, J = 8.3 Hz, 2H), 7.35 (d, J = 7.8 Hz, 2H), 7.28 (d, J = 7.8 Hz, 2H), 4.89 (s, 1H), 4.65 (s, 1H), 3.80 (s, 1H), 3.50 (s, 1H), 2.37 (s, 3H), 1.37 (s, 3H), 1.20 (s, 3H).

[0384]

[0385] Preparation Example 15: Preparation of 4-(4,4-dimethyl-2-(6-methylnicotinoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 15)

[0386]

[0387] 23 mg (yield 62%) of the title compound was obtained using 4-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.089 mmol), 6-methylnicotinic acid (18 mg, 0.13 mmol), EDCI (69 mg, 0.36 mmol), and DIPEA (0.063 mL, 0.36 mmol) in the same manner as in Preparation Example 2.

[0388] 1 H NMR (400 MHz, DMSO) δ 11.22 (d, J = 18.4 Hz, 1H), 8.55 (s, 1H), 7.96 (s, 1H), 7.85 (s, 3H), 7.83 - 7.72 (m, 2H), 7.44 (d, J = 8.1 Hz, 2H), 7.37 (d, J = 7.9 Hz, 1H), 4.91 (s, 1H), 4.67 (s, 1H), 3.82 (s, 1H), 3.50 (s, 1H), 2.54 (s, 3H), 1.38 (s, 3H), 1.21 (s, 3H).

[0389]

[0390] Preparation Example 16: Preparation of 4-(2-benzoyl-1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 16)

[0391] Preparation Example 16-1: Preparation of tert-butyl 8-(4-cyanophenyl)-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 16-1)

[0392]

[0393] 80 mg (yield 47%) of the title compound was obtained using a mixture of tert-butyl 8-bromo-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compound 11-2 / 1-4) (162 mg, 0.44 mmol), (4-cyanophenyl)boronic acid (195 mg, 1.33 mmol), Pd(PPh3)4 (23 mg, 0.02 mmol), and 1MNa2CO3 (1.1 mL, 1.1 mmol) in the same manner as in Preparation Examples 1-3.

[0394] 1 H NMR (400 MHz, DMSO) δ 11.11 (s, 1H), 7.97-7.86 (m, 4H), 7.83 (s, 1H), 7.49-7.38 (m, 2H), 5.33 (d, J = 41.8 Hz, 1H), 4.25 (d, J = 50.7 Hz, 1H), 3.26 - 3.13 (m, 1H), 2.79(d, J=11.5 Hz, 1H), 2.72(s, 1H), 1.46(s, 12H).

[0395]

[0396] Preparation Example 16-2: Preparation of 4-(1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 16-2)

[0397]

[0398] 56 mg (yield 81%) of the title compound was obtained using tert-butyl 8-(4-cyanophenyl)-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (80 mg, 0.21 mmol) and HCl solution (4 M in dioxane) (1.1 mL, 4.2 mmol) in the same manner as in Preparation Examples 1-4.

[0399] 1 H NMR (400 MHz, DMSO) δ 11.40(s, 1H), 9.51(s, 1H), 9.09(s, 1H), 7.97 - 7.87(m, 5H), 7.55 - 7.44(m, 2H), 4.80 (s, 1H), 3.55(d, J=6.1 Hz, 1H), 3.42 (d, J=7.6 Hz, 1H), 3.04(d, J=5.8 Hz, 2H), 1.72(d, J=6.7 Hz, 3H).

[0400]

[0401] Preparation Example 16-3: Preparation of 4-(2-benzoyl-1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 16)

[0402]

[0403] 4 mg (yield 17%) of the title compound was obtained using 4-(1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), benzoic acid (11 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 2.

[0404] 1H NMR (400 MHz, DMSO) δ 11.17 (s, 1H), 7.97 (t, J = 6.8 Hz, 2H), 7.89 (d, J = 8.4 Hz, 2H), 7.74 (d, J = 68.7 Hz, 1H), 7.45 (d, J = 25.1 Hz, 7H), 5.83 (d, J = 6.9 Hz, 1H), 4.85 (d, J = 95.0 Hz, 1H), 3.74 (s, 1H), 2.97 (d, J = 11.0 Hz, 1H), 2.75 (dd, J = 36.8, 17.5 Hz, 1H), 1.58 (d, J = 6.8 Hz, 3H).

[0405]

[0406] Preparation Example 17: Preparation of 4-(1-methyl-2-(4-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 17)

[0407]

[0408] 7 mg (yield 29%) of the title compound was obtained using 4-(1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), 4-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 2.

[0409] 1H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 8.01 - 7.92 (m, 2H), 7.88 (d, J = 8.5 Hz, 2H), 7.75 (d, J = 62.2 Hz, 1H), 7.53 - 7.31 (m, 4H), 7.29 (d, J = 8.2 Hz, 2H), 5.81 (d, J = 6.7 Hz, 1H), 4.86 (d, J = 119.1 Hz, 1H), 3.80 - 3.51 (m, 1H), 2.97 (s, 1H), 2.74 (d, J = 45.0 Hz, 1H), 2.37 (s, 3H), 1.57 (d, J = 6.5 Hz, 3H).

[0410]

[0411] Preparation Example 18: Preparation of (8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 18)

[0412] Preparation Example 18-1: Preparation of tert-butyl 8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 18-2)

[0413]

[0414] 225 mg (yield 69%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), (4-chlorophenyl)boronic acid (385 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (2.1 mL, 2.1 mmol) in the same manner as in Preparation Examples 1-3.

[0415] 1H NMR (400 MHz, DMSO) δ 11.00 (s, 1H), 7.76 - 7.68 (m, 3H), 7.52 - 7.44 (m, 2H), 7.41 - 7.32 (m, 2H), 4.92 (d, J = 15.9 Hz, 1H), 4.77 (s, 1H), 4.16 (d, J = 15.9 Hz, 1H), 3.06 (dd, J = 16.5, 6.2 Hz, 1H), 2.59 (d, J = 16.3 Hz, 1H), 1.46 (s, 9H), 1.13 (d, J = 6.8 Hz, 3H).

[0416]

[0417] Preparation Example 18-2: Preparation of 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 18-3)

[0418]

[0419] 158 mg (yield 83%) of the title compound was obtained using tert-butyl 8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (225 mg, 0.57 mmol) and HCl solution (4 M in dioxane) (2.8 mL, 11.3 mmol) in the same manner as in Preparation Examples 1-4.

[0420] 1 H NMR (400 MHz, DMSO) δ 11.28 (s, 1H), 9.42 (d, J = 10.9 Hz, 1H), 9.19 (d, J = 9.8 Hz, 1H), 7.83 (s, 1H), 7.76 - 7.68 (m, 2H), 7.54 - 7.41 (m, 4H), 4.45 (d, J = 14.6 Hz, 1H), 4.35 (s, 1H), 3.71 (s, 1H), 3.13 (dd, J = 16.8, 4.7 Hz, 1H), 2.84 (dd, J = 16.9, 9.8 Hz, 1H), 1.46 (d, J = 6.5 Hz, 3H).

[0421]

[0422] Preparation Example 18-3: Preparation of (8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 18)

[0423]

[0424] 7 mg (yield 19%) of the title compound was obtained using 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.09 mmol), benzoic acid (17 mg, 0.14 mmol), EDCI (69 mg, 0.36 mmol), and DIPEA (0.063 mL, 0.36 mmol) in the same manner as in Preparation Example 2.

[0425] 1 H NMR (400 MHz, DMSO) δ 11.07 (s, 1H), 7.79 (d, J = 32.3 Hz, 3H), 7.48 (s, 7H), 7.39 (s, 2H), 5.44 (s, 1H), 4.27 (d, J = 28.2 Hz, 2H), 3.18 (d, J = 16.4 Hz, 1H), 2.68 (s, 1H), 1.20 (s, 3H).

[0426]

[0427] Preparation Example 19: Preparation of (8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 19)

[0428]

[0429] 4 mg (yield 11%) of the title compound was obtained using 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.09 mmol), 4-methylbenzoic acid (19 mg, 0.14 mmol), EDCI (69 mg, 0.36 mmol), and DIPEA (0.063 mL, 0.36 mmol) in the same manner as in Preparation Example 2.

[0430] 1 H NMR (400 MHz, DMSO) δ 11.06(s, 1H), 7.78(d, J=35.8 Hz, 3H), 7.47 (s, 2H), 7.36(d, J=9.5 Hz, 4H), 7.29(d, J=7.7 Hz, 2H), 5.40(s, 1H), 4.53-4.19 (m, 2H), 3.21-3.13(m, 1H), 2.60(s, 1H), 2.37(s, 3H), 1.19(s, 3H).

[0431]

[0432] Preparation Example 20: Preparation of (8-(4-chlorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 20)

[0433] Preparation Example 20-1: Preparation of tert-butyl 8-(4-chlorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 20-1)

[0434]

[0435] 50 mg (yield 14%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (33 mg, 0.87 mmol), (4-chlorophenyl)boronic acid (408 mg, 2.61 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (2.2 mL, 2.2 mmol) in the same manner as in Preparation Examples 1-3.

[0436] 1 H NMR (400 MHz, DMSO) δ 11.06(s, 1H), 7.75-7.67(m, 3H), 7.51-7.45 (m, 2H), 7.42-7.33(m, 2H), 4.59(s, 2H), 3.48(s, 2H), 1.45(s, 9H), 1.28(s, 6H).

[0437]

[0438] Preparation Example 20-2: Preparation of 8-(4-chlorophenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 20-2)

[0439]

[0440] 16 mg (yield 38%) of the title compound was obtained using tert-butyl 8-(4-chlorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (50 mg, 0.12 mmol) and HCl solution (4 M in dioxane) (0.6 mL, 2.4 mmol) in the same manner as in Preparation Examples 1-4.

[0441] 1 H NMR (400 MHz, DMSO) δ 11.40 (s, 1H), 9.25 (s, 2H), 7.84 (s, 1H), 7.74 - 7.67 (m, 2H), 7.54 - 7.47 (m, 2H), 7.44 (d, J = 1.3 Hz, 2H), 4.34 (s, 2H), 3.32 (s, 2H), 1.43 (s, 6H).

[0442]

[0443] Preparation Example 20-3: Preparation of (8-(4-chlorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 20)

[0444]

[0445] 12 mg (yield 63%) of the title compound was obtained using 8-(4-chlorophenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride) (16 mg, 0.046 mmol), benzoic acid (8 mg, 0.069 mmol), EDCI (36 mg, 0.19 mmol), and DIPEA (0.033 mL, 0.19 mmol) in the same manner as in Preparation Example 2.

[0446] 1 H NMR (400 MHz, DMSO) δ 11.13 (d, J = 23.2 Hz, 1H), 7.82 (s, 1H), 7.74 (s, 1H), 7.64 (s, 1H), 7.54 - 7.42 (m, 7H), 7.39 (s, 2H), 4.90 (s, 1H), 4.61 (s, 1H), 3.82 (s, 1H), 3.48 (s, 1H), 1.38 (s, 3H), 1.18 (s, 3H).

[0447]

[0448] Preparation Example 21: Preparation of (8-(4-chlorophenyl)-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 21)

[0449] Preparation Example 21-1: Preparation of a mixture of tert-butyl 8-(4-chlorophenyl)-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 21-1 / 18-2).

[0450]

[0451] 156 mg of a positional isomer mixture was obtained using a mixture of tert-butyl 8-bromo-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compound 11-2 / 1-4) (270 mg, 0.74 mmol), (4-chlorophenyl)boronic acid (347 mg, 2.22 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (1.9 mL, 1.9 mmol) in the same manner as in Preparation Examples 1-3.

[0452]

[0453] Preparation Example 21-2: Preparation of a mixture of 8-(4-chlorophenyl)-1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 21-2 / 18-3)

[0454]

[0455] In the same manner as in Preparation Examples 1-4, 111 mg of a positional isomer mixture was obtained using a mixture of tert-butyl 8-(4-chlorophenyl)-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compound 21-1 / 18-2) (156 mg, 0.39 mmol) and an HCl solution (4 M in dioxane) (1.97 mL, 1.97 mmol).

[0456]

[0457] Preparation Example 21-3: Preparation of (8-(4-chlorophenyl)-1-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 21)

[0458]

[0459] In the same manner as in Preparation Example 11-5, 12 mg (yield 25%) of the title compound (21) was obtained using a mixture of 8-(4-chlorophenyl)-1-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (compound 21-2 / 18-3) (40 mg, 0.12 mmol), benzoic acid (22 mg, 0.18 mmol), EDCI (92 mg, 0.48 mmol), and DIPEA (0.084 mL, 0.48 mmol).

[0460] 1H NMR (400 MHz, DMSO) δ 11.09(s, 1H), 7.84 - 7.73(m, 3H), 7.65(s, 1H), 7.49(s, 6H), 7.39(s, 2H), 5.81(d, J = 7.2 Hz, 1H), 4.75(s, 1H), 3.74(s, 1H), 2.96(d, J=11.8 Hz, 1H), 2.70(d, J=17.7 Hz, 1H), 1.57(d, J=7.1 Hz, 3H).

[0461]

[0462] Preparation Example 22: Preparation of 3-methyl-2-(phenylsulfonyl)-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 22)

[0463]

[0464] 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol) was dissolved in a dichloromethane solution under nitrogen. Benzenesulfonyl chloride (0.018 mL, 0.14 mmol) and TEA (0.04 mL, 0.29 mmol) were added. The reaction mixture was stirred at room temperature for 4 hours. Upon completion of the reaction, extraction was performed using distilled water and dichloromethane, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 15 mg (yield 38%) of the title compound.

[0465] 1H NMR (400 MHz, DMSO) δ 10.90 (s, 1H), 7.87 (dd, J = 7.1, 1.8 Hz, 2H), 7.74 (s, 1H), 7.69 - 7.53 (m, 5H), 7.33 (t, J = 1.5 Hz, 2H), 7.24 (d, J = 7.9 Hz, 2H), 4.91 (d, J = 15.3 Hz, 1H), 4.57 (p, J = 6.6 Hz, 1H), 4.19 (d, J = 15.4 Hz, 1H), 2.92 (dd, J = 16.5, 6.2 Hz, 1H), 2.54 (s, 1H), 2.34 (s, 3H), 0.95 (d, J = 6.7 Hz, 3H).

[0466]

[0467] Preparation Example 23: Preparation of 3-methyl-N-phenyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxamide (Compound 23)

[0468]

[0469] 9 mg (yield 36%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), isocyanatobenzene (0.01 mL, 0.096 mmol), and TEA (0.036 mL, 0.26 mmol) in the same manner as in Preparation Example 22.

[0470] 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 8.57 (s, 1H), 7.66 (d, J = 1.5 Hz, 1H), 7.59 - 7.49 (m, 4H), 7.39 - 7.32 (m, 2H), 7.28 - 7.23 (m, 4H), 6.95 (t, J = 7.3 Hz, 1H), 5.09 (d, J = 15.2 Hz, 1H), 4.96 (t, J = 6.6 Hz, 1H), 4.30 (d, J = 15.3 Hz, 1H), 3.12 (d, J = 5.9 Hz, 1H), 2.63 (d, J = 16.2 Hz, 1H), 2.34 (s, 3H), 1.17 (d, J = 6.7 Hz, 3H).

[0471]

[0472] Preparation Example 24: Preparation of 3-methyl-N-phenyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carbothioamide (Compound 24)

[0473]

[0474] 18 mg (yield 46%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), isothiocyanatobenzene (0.017 mL, 0.14 mmol), and TEA (0.053 mL, 0.38 mmol) in the same manner as in Preparation Example 22.

[0475] 1H NMR (400 MHz, DMSO) δ 11.03 (s, 1H), 9.37 (s, 1H), 7.62 (s, 1H), 7.56 (d, J = 7.8 Hz, 2H), 7.35 (h, J = 8.2 Hz, 6H), 7.24 (d, J = 7.9 Hz, 2H), 7.14 (d, J = 6.7 Hz, 1H), 5.89 (s, 1H), 5.47 (d, J = 15.5 Hz, 1H), 4.51 (d, J = 15.9 Hz, 1H), 3.22 (dd, J = 17.1, 6.0 Hz, 1H), 2.71 (d, J = 16.6 Hz, 1H), 2.34 (s, 3H), 1.23 (d, J = 6.9 Hz, 3H).

[0476]

[0477] Preparation Example 25: Preparation of (R)-(3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 25)

[0478] Preparation Example 25-1: Preparation of (R)-8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 25-2)

[0479]

[0480] (4-bromophenyl)hydrazine hydrochloride (1.0 g, 4.47 mmol) and tert-butyl(R)-2-methyl-4-oxopiperidine-1-carboxylate (1.0 g, 4.7 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.56 mL, 8.0 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 3 hours. After the reaction was complete, it was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered with diethyl ether to obtain 623 mg (yield 52%) of the title compound.

[0481] 1 H NMR (400 MHz, DMSO) δ 10.92(s, 1H), 7.48(d, J=2.0 Hz, 1H), 7.22(d, J=8.5 Hz, 1H), 7.08(dd, J=8.5, 2.0 Hz, 1H), 3.90(d, J=14.8 Hz, 1H), 3.81(dt, J=14.6, 2.2 Hz, 1H), 2.93(ddd, J=10.3, 6.5, 4.0 Hz, 1H), 2.73 - 2.64(m, 1H), 2.36(dd, J=15.8, 9.8 Hz, 1H), 1.19(d, J=6.3 Hz, 3H).

[0482]

[0483] Preparation Example 25-2: Preparation of tert-butyl(R)-8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 25-3)

[0484]

[0485] 673 mg (yield 80%) of the title compound was obtained using (R)-8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (623 mg, 2.3 mmol) and Boc2O (0.581 mL, 2.53 mmol) in the same manner as in Preparation Examples 1-2.

[0486] 1 H NMR (400 MHz, DMSO) δ 11.11 (s, 1H), 7.60 (d, J = 2.0 Hz, 1H), 7.26 (d, J = 8.5 Hz, 1H), 7.14 (dd, J = 8.5, 2.0 Hz, 1H), 4.84 (d, J = 15.9 Hz, 1H), 4.74 (s, 1H), 4.08 (d, J = 16.0 Hz, 1H), 3.04 (dd, J = 16.4, 6.1 Hz, 1H), 2.57 (d, J = 16.4 Hz, 1H), 1.45 (s, 9H), 1.10 (d, J = 6.8 Hz, 3H).

[0487]

[0488] Preparation Example 25-3: Preparation of tert-butyl(R)-3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 25-4)

[0489]

[0490] 172 mg (yield 82%) of the title compound was obtained using tert-butyl(R)-8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.55 mmol), p-tolylboronic acid (224 mg, 1.65 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1MNa2CO3 (1.38 mL, 1.38 mmol) in the same manner as in Preparation Examples 1-3.

[0491] 1 H NMR (400 MHz, DMSO) δ 10.93 (s, 1H), 7.64 (s, 1H), 7.58 (d, J = 7.9 Hz, 2H), 7.39 - 7.29 (m, 2H), 7.24 (d, J = 7.8 Hz, 2H), 4.91 (d, J = 15.8 Hz, 1H), 4.77 (s, 1H), 4.16 (d, J = 16.0 Hz, 1H), 3.06 (d, J = 13.1 Hz, 1H), 2.58 (d, J = 16.3 Hz, 1H), 2.34 (s, 3H), 1.46 (s, 9H), 1.13 (d, J = 6.8 Hz, 3H).

[0492]

[0493] Preparation Example 25-4: Preparation of (R)-3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 25-5)

[0494]

[0495] 111 mg (yield 79%) of the title compound was obtained using tert-butyl (R)-3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (172 mg, 0.45 mmol) and an HCl solution (4 M in dioxane) in the same manner as in Preparation Examples 1-4.

[0496] 1 H NMR (400 MHz, DMSO) δ 11.20 (s, 1H), 9.44 (d, J = 10.8 Hz, 1H), 9.21 (s, 1H), 7.76 (s, 1H), 7.58 (d, J = 7.8 Hz, 2H), 7.40 (s, 2H), 7.26 (d, J = 7.8 Hz, 2H), 4.44 (d, J = 14.5 Hz, 1H), 4.34 (d, J = 9.4 Hz, 1H), 3.71 (s, 1H), 3.12 (dd, J = 16.9, 4.8 Hz, 1H), 2.84 (dd, J = 16.9, 9.9 Hz, 1H), 2.35 (s, 3H), 1.46 (d, J = 6.4 Hz, 3H).

[0497]

[0498] Preparation Example 25-5: Preparation of (R)-(3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 25)

[0499]

[0500] 21 mg (yield 58%) of the title compound was obtained using (R)-3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), benzoic acid (17 mg, 0.14 mmol), EDCI (73 mg, 0.38 mmol), and DIPEA (0.066 mL, 0.38 mmol) in the same manner as in Preparation Example 2.

[0501] 1H NMR (400 MHz, DMSO) δ 11.00(s, 1H), 7.76(s, 1H), 7.60(s, 2H), 7.49(s, 5H), 7.36(s, 2H), 7.24(s, 2H), 5.43(s, 1H), 4.55(s, 1H), 4.27 (d, J=25.7 Hz, 1H), 3.22-3.13 (m, 1H), 2.60(s, 1H), 2.34(s, 3H), 1.20(s, 3H).

[0502]

[0503] Preparation Example 26: Preparation of (R)-(3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 26)

[0504]

[0505] 21 mg (yield 55%) of the title compound was obtained using (R)-3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), 4-methylbenzoic acid (20 mg, 0.14 mmol), EDCI (73 mg, 0.38 mmol), and DIPEA (0.066 mL, 0.38 mmol) in the same manner as in Preparation Example 2.

[0506] 1 H NMR (400 MHz, DMSO) δ 10.99 (s, 1H), 7.75 (s, 1H), 7.58 (s, 2H), 7.36 (d, J = 7.4 Hz, 4H), 7.29 (d, J = 7.5 Hz, 2H), 7.24 (s, 2H), 5.39 (s, 1H), 4.54 (s, 1H), 4.27 (d, J = 47.7 Hz, 1H), 3.16 (d, J = 16.4 Hz, 1H), 2.64 (d, J = 32.8 Hz, 1H), 2.36 (d, J = 13.7 Hz, 6H), 1.20 (s, 3H).

[0507]

[0508] Preparation Example 27: Preparation of (R)-4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 27)

[0509] Preparation Example 27-1: Preparation of tert-butyl (R)-8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 27-1)

[0510]

[0511] 100 mg (yield 47%) of the title compound was obtained using tert-butyl(R)-8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.55 mmol), (4-cyanophenyl)boronic acid (242 mg, 1.65 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1M Na2CO3 (1.38 mL, 1.38 mmol) in the same manner as in Preparation Examples 1-3.

[0512] 1 H NMR (400 MHz, DMSO) δ 11.09 (s, 1H), 7.93 (d, J = 8.2 Hz, 2H), 7.91 - 7.82 (m, 3H), 7.49 - 7.38 (m, 2H), 4.94 (d, J = 15.9 Hz, 1H), 4.77 (s, 1H), 4.17 (d, J = 16.1 Hz, 1H), 3.07 (dd, J = 16.6, 6.0 Hz, 1H), 2.59 (d, J = 16.4 Hz, 1H), 1.46 (s, 9H), 1.13 (d, J = 6.8 Hz, 3H).

[0513]

[0514] Preparation Example 27-2: Preparation of (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 27-2)

[0515]

[0516] 73 mg (yield 87%) of the title compound was obtained using tert-butyl (R)-8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (100 mg, 0.26 mmol) and an HCl solution (4 M in dioxane) (1.3 mL, 5.16 mmol) in the same manner as in Preparation Examples 1-4.

[0517] 1 H NMR (400 MHz, DMSO) δ 11.35 (s, 1H), 9.38 (d, J = 10.8 Hz, 1H), 9.16 (s, 1H), 7.94 (d, J = 17.3 Hz, 5H), 7.56 - 7.49 (m, 1H), 7.47 (d, J = 8.5 Hz, 1H), 4.46 (d, J = 14.5 Hz, 1H), 4.35 (s, 1H), 3.72 (s, 1H), 3.14 (dd, J = 16.8, 4.7 Hz, 1H), 2.84 (dd, J = 16.9, 10.0 Hz, 1H), 1.46(d, J=6.4 Hz, 3H).

[0518]

[0519] Preparation Example 27-3: Preparation of (R)-4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 27)

[0520]

[0521] 10 mg (yield 41%) of the title compound was obtained using (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), benzoic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0522] 1H NMR (400 MHz, DMSO) δ 11.15 (s, 1H), 7.95 (s, 2H), 7.87 (s, 3H), 7.48 (s, 5H), 7.42 (d, J = 8.1 Hz, 2H), 5.47 (s, 1H), 4.59 (s, 1H), 4.29 (s, 1H), 3.21 - 3.14 (m, 1H), 2.62 (s, 1H), 1.21 (s, 3H).

[0523]

[0524] Preparation Example 28: Preparation of (R)-4-(3-methyl-2-(4-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 28)

[0525]

[0526] 5 mg (yield 20%) of the title compound was obtained using (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 4-methylbenzoic acid (13 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0527] 1 H NMR (400 MHz, DMSO) δ11.14(s, 1H), 7.93(s, 2H), 7.87(s, 2H), 7.40 (dd, J=33.1, 9.1 Hz, 5H), 7.29(d, J=7.7 Hz, 2H), 5.44(s, 1H), 4.34(s, 1H), 4.22(s, 1H), 3.17(d, J=10.2 Hz, 1H), 2.62(s, 1H), 2.37(s, 3H), 1.20(s, 3H).

[0528]

[0529] Preparation Example 29: Preparation of (S)-4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 29)

[0530] Preparation Example 29-1: Preparation of (S)-8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 29-2)

[0531]

[0532] (4-bromophenyl)hydrazine hydrochloride (1.0 g, 4.47 mmol) and tert-butyl(S)-2-methyl-4-oxopiperidine-1-carboxylate (1.0 g, 4.7 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.56 mL, 8.0 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 3 hours. After the reaction was complete, the mixture was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered with diethyl ether to obtain 682 mg (yield 56%) of the title compound.

[0533] 1 H NMR (400 MHz, DMSO) δ 10.91(s, 1H), 7.48 (d, J=2.0 Hz, 1H), 7.22(d, J=8.5 Hz, 1H), 7.08(dd, J=8.5, 2.0 Hz, 1H), 3.90(d, J=14.7 Hz, 1H), 3.81(dt, J=14.8, 2.2 Hz, 1H), 2.93(ddt, J=8.7, 6.2, 3.2 Hz, 1H), 2.69(ddd, J=15.9, 4.1, 1.7 Hz, 1H), 2.36 (dd, J=15.9, 9.7) Hz, 1H), 1.19(d, J=6.3 Hz, 3H).

[0534]

[0535] Preparation Example 29-2: Preparation of tert-butyl(S)-8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 29-3)

[0536]

[0537] 734 mg (yield 80%) of the title compound was obtained using (S)-8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (682 mg, 2.5 mmol) and Boc2O (0.65 mL, 2.83 mmol) in the same manner as in Preparation Example 1-2.

[0538] 1 H NMR (400 MHz, DMSO) δ 11.10 (s, 1H), 7.60 (d, J = 1.9 Hz, 1H), 7.27 (d, J = 8.5 Hz, 1H), 7.15 (dd, J = 8.5, 1.9 Hz, 1H), 4.84 (d, J = 16.0 Hz, 1H), 4.75 (s, 1H), 4.09 (d, J = 16.0 Hz, 1H), 3.04 (dd, J = 16.6, 6.1 Hz, 1H), 2.58 (d, J = 16.4 Hz, 1H), 1.45 (s, 9H), 1.10 (d, J = 6.9 Hz, 3H).

[0539]

[0540] Preparation Example 29-3: Preparation of tert-butyl(S)-8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 29-4)

[0541]

[0542] 133 mg (yield 62%) of the title compound was obtained using tert-butyl(S)-8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.55 mmol), (4-cyanophenyl)boronic acid (242 mg, 1.65 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1 M Na2CO3 (1.38 mL, 1.38 mmol) in the same manner as in Preparation Examples 1-3.

[0543] 1H NMR (400 MHz, DMSO) δ 11.07(s, 1H), 7.96-7.82(m, 5H), 7.43(q, J=8.6 Hz, 2H), 4.94(d, J=15.9 Hz, 1H), 4.77(s, 1H), 4.16(d, J=15.7) Hz, 1H), 3.10-3.01(m, 1H), 2.59(d, J=16.3 Hz, 1H), 1.46 (s, 9H), 1.13(d, J=6.8 Hz, 3H).

[0544]

[0545] Preparation Example 29-4: Preparation of (S)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 29-5)

[0546]

[0547] 88 mg (yield 80%) of the title compound was obtained using tert-butyl (S)-8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (133 mg, 0.34 mmol) and an HCl solution (4 M in dioxane) (1.72 mL, 6.86 mmol) in the same manner as in Preparation Examples 1-4.

[0548] 1 H NMR (400 MHz, DMSO) δ 11.35 (s, 1H), 9.35 (s, 1H), 9.15 (s, 1H), 7.96 (s, 1H), 7.91 (s, 4H), 7.56 - 7.49 (m, 1H), 7.47 (d, J = 8.5 Hz, 1H), 4.46 (d, J = 14.5 Hz, 1H), 4.36 (s, 1H), 3.73 (s, 1H), 3.14 (dd, J = 17.1, 4.8 Hz, 1H), 2.84 (dd, J = 16.9, 9.9 Hz, 1H), 1.46 (d, J = 6.4 Hz, 3H).

[0549]

[0550] Preparation Example 29-5: Preparation of (S)-4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 29)

[0551]

[0552] 17 mg (yield 70%) of the title compound was obtained using (S)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), benzoic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0553] 1 H NMR (400 MHz, DMSO) δ 11.14 (s, 1H), 7.95 (s, 3H), 7.88 (s, 2H), 7.49 (s, 5H), 7.44 (s, 2H), 5.47 (s, 1H), 4.44 (d, J = 114.1 Hz, 2H), 3.19 (d, J = 16.4 Hz, 1H), 2.62 (s, 1H), 1.22 (s, 3H).

[0554]

[0555] Preparation Example 30: Preparation of (S)-4-(3-methyl-2-(4-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 30)

[0556]

[0557] 17 mg (yield 68%) of the title compound was obtained using (S)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 4-methylbenzoic acid (13 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0558] 1 H NMR (400 MHz, DMSO) δ 11.13 (s, 1H), 7.93 (s, 2H), 7.87 (s, 3H), 7.40 (dd, J = 33.6, 8.6 Hz, 4H), 7.29 (d, J = 7.8 Hz, 2H), 5.43 (s, 1H), 4.34 (s, 2H), 3.17 (d, J = 12.4 Hz, 1H), 2.62 (s, 1H), 2.37 (s, 3H), 1.21(s, 3H).

[0559]

[0560] Preparation Example 31: Preparation of 4-(2-benzoyl-3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 31)

[0561] Preparation Example 31-1: Preparation of 8-Bromo-3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 31-2)

[0562]

[0563] (4-bromophenyl)hydrazine hydrochloride (749 mg, 3.35 mmol) and tert-butyl 2-ethyl-4-oxopiperidine-1-carboxylate (800 mg, 3.52 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.42 mL, 8.0 M) was added to the reaction mixture while stirring at 0 °C. The reaction mixture was stirred at 110 °C for 3 hours using a sealed tube. After the reaction was complete, the mixture was based with a 1-normal aqueous sodium hydroxide solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered with diethyl ether to obtain 500 mg of the title compound (yield 53%).

[0564] 1H NMR (400 MHz, DMSO) δ 10.91 (s, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.23 (d, J = 8.5 Hz, 1H), 7.09 (dd, J = 8.4, 1.9 Hz, 1H), 3.92 (d, J = 14.8) Hz, 1H), 3.79 (d, J = 15.1 Hz, 1H), 2.76 - 2.67 (m, 2H), 2.37 (dd, J = 16.4, 10.1 Hz, 1H), 1.54 (dp, J = 17.0, 6.9 Hz, 2H), 0.99 (t, J = 7.4 Hz, 3H).

[0565]

[0566] Preparation Example 31-2: Preparation of tert-butyl 8-bromo-3-ethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 31-3)

[0567]

[0568] 485 mg (yield 71%) of the title compound was obtained using 8-bromo-3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (500 mg, 1.79 mmol) and Boc2O (0.453 mL, 1.97 mmol) in the same manner as in Preparation Examples 1-2.

[0569] 1 H NMR (400 MHz, DMSO) δ 11.09 (s, 1H), 7.59 (d, J = 1.9 Hz, 1H), 7.25 (d, J = 8.5 Hz, 1H), 7.14 (dd, J = 8.4, 1.9 Hz, 1H), 4.86 (d, J = 15.8) Hz, 1H), 4.52 (d, J = 32.5 Hz, 1H), 4.02 (s, 1H), 3.02 (d, J = 16.3 Hz, 1H), 2.63 (d, J = 16.6 Hz, 1H), 1.45 (s, 11H), 0.85 (t, J = 7.0) Hz, 3H).

[0570]

[0571] Preparation Example 31-3: Preparation of tert-butyl 8-(4-cyanophenyl)-3-ethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 31-4)

[0572]

[0573] 132 mg (yield 62%) of the title compound was obtained using tert-butyl 8-bromo-3-ethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.53 mmol), (4-cyanophenyl)boronic acid (235 mg, 1.6 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1MNa2CO3 (1.33 mL, 1.33 mmol) in the same manner as in Preparation Examples 1-3.

[0574] 1 H NMR (400 MHz, DMSO) δ 11.06 (s, 1H), 7.92 (d, J=8.3 Hz, 2H), 7.88 (d, J=8.2 Hz, 2H), 7.83(s, 1H), 7.45(d, J=8.5 Hz, 1H), 7.40(d, J = 8.4 Hz, 1H), 4.97 (s, 1H), 4.55 (d, J = 36.5 Hz, 1H), 4.18-3.98 (m, 1H), 3.04 (d, J = 14.7 Hz, 1H), 2.65 (d, J = 16.6 Hz, 1H), 1.46(s, 11H), 0.90-0.85(m, 3H).

[0575]

[0576] Preparation Example 31-4: Preparation of 4-(3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 31-5)

[0577]

[0578] 63 mg (57%) of the title compound was obtained using tert-butyl 8-(4-cyanophenyl)-3-ethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (132 mg, 0.33 mmol) and an HCl solution (4 M in dioxane) (1.64 mL, 6.58 mmol) in the same manner as in Preparation Examples 1-4.

[0579] 1 H NMR (400 MHz, DMSO) δ 11.34 (s, 1H), 9.33 (s, 1H), 9.22 (s, 1H), 7.97 (s, 1H), 7.92 (d, J = 2.0 Hz, 4H), 7.53 (dd, J = 8.5, 1.8 Hz, 1H), 7.47 (d, J = 8.5 Hz, 1H), 4.46 (d, J = 14.5 Hz, 1H), 4.36 (s, 1H), 3.57 (s, 1H), 3.19 - 3.09 (m, 1H), 2.85 (dd, J = 17.0, 10.2 Hz, 1H), 1.97 - 1.87 (m, 1H), 1.75 (dt, J = 14.2, 7.5 Hz, 1H), 1.06 (t, J = 7.5 Hz, 3H).

[0580]

[0581] Preparation Example 31-5: Preparation of 4-(2-benzoyl-3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 31)

[0582]

[0583] 13 mg (yield 53%) of the title compound was obtained using 4-(3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), benzoic acid (11 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 2.

[0584] 1H NMR (400 MHz, DMSO) δ 11.15 (s, 1H), 7.96 (s, 2H), 7.93 - 7.78 (m, 3H), 7.49 (s, 7H), 5.27 (d, J = 117.0 Hz, 1H), 4.67 - 4.42 (m, 1H), 4.16 - 4.02 (m, 1H), 3.19 (d, J = 33.0 Hz, 1H), 2.70 (dd, J = 43.0, 16.0 Hz, 1H), 1.67 (s, 1H), 1.44 (s, 1H), 0.89 (d, J = 99.5 Hz, 3H).

[0585]

[0586] Preparation Example 32: Preparation of 4-(3-ethyl-2-(4-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 32)

[0587]

[0588] 11 mg (yield 44%) of the title compound was obtained using 4-(3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), 4-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 2.

[0589] 1H NMR (400 MHz, DMSO) δ 11.14 (s, 1H), 7.95 (s, 1H), 7.92 - 7.79 (m, 3H), 7.69 - 7.40 (m, 3H), 7.37 (d, J = 7.8 Hz, 2H), 7.30 (d, J = 7.6 Hz, 2H), 5.40 (d, J = 16.5 Hz, 1H), 4.57 (d, J = 55.0 Hz, 1H), 4.12 (d, J = 19.4 Hz, 1H), 3.26 - 3.12 (m, 1H), 2.64 (d, J = 17.7 Hz, 1H), 2.38 (s, 3H), 1.66 (s, 1H), 1.44 (s, 1H), 0.88 (d, J = 99.4 Hz, 3H).

[0590]

[0591] Preparation Example 33: Preparation of 4-(2'-benzoyl-1',2',3',5'-tetrahydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-8'-yl)benzonitrile (Compound 33)

[0592] Preparation Example 33-1: Preparation of 8'-Bromo-1',2',3',5'-tetrahydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole] (Compound 33-2)

[0593]

[0594] (4-bromophenyl)hydrazine hydrochloride (94 mg, 0.42 mmol) and tert-butyl 8-oxo-5-azaspiro[2.5]octane-5-carboxylate (100 mg, 0.44 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.05 mL, 8.0 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 3 hours. After the reaction was complete, it was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered with diethyl ether to obtain 11 mg (yield 10%) of the title compound.

[0595] 1 H NMR (400 MHz, DMSO) δ 10.65(s, 1H), 7.47(s, 1H), 7.18(d, J=8.5 Hz, 1H), 7.07(d, J=8.5 Hz, 1H), 3.90(s, 2H), 2.82(s, 2H), 1.06(s, 2H), 0.85(s, 2H).

[0596]

[0597] Preparation Example 33-2: Preparation of tert-butyl 8'-bromo-1',5'-dihydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-2'(3'H)-carboxylate (Compound 33-3)

[0598]

[0599] 20 mg (yield 30%) of the title compound was obtained using 8'-bromo-1',2',3',5'-tetrahydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole] (51 mg, 0.18 mmol) and Boc2O (0.05 mL, 0.20 mmol) in the same manner as in Preparation Examples 1-2.

[0600] 1H NMR (400 MHz, DMSO) δ 10.83 (s, 1H), 7.58 (d, J = 1.8 Hz, 1H), 7.21 (d, J = 8.6 Hz, 1H), 7.13 (dd, J = 8.5, 2.0 Hz, 1H), 4.59 (s, 2H), 3.54 (s, 2H), 1.43 (s, 9H), 1.12 (s, 2H), 0.98 (q, J = 4.4 Hz, 2H).

[0601]

[0602] Preparation Example 33-3: Preparation of tert-butyl 8'-(4-cyanophenyl)-1',5'-dihydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-2'(3'H)-carboxylate (Compound 33-4)

[0603]

[0604] 29 mg (yield 40%) of the title compound was obtained using tert-butyl 8'-bromo-1',5'-dihydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-2'(3'H)-carboxylate (70 mg, 0.18 mmol), (4-cyanophenyl)boronic acid (82 mg, 0.56 mmol), Pd(PPh3)4 (10 mg, 0.09 mmol), and 1M Na2CO3 (0.45 mL, 0.45 mmol) in the same manner as in Preparation Examples 1-3.

[0605] 1 H NMR (400 MHz, DMSO) δ 10.79 (s, 1H), 7.98 - 7.79 (m, 5H), 7.45 (d, J = 8.4 Hz, 1H), 7.36 (d, J = 8.4 Hz, 1H), 4.69 (s, 2H), 3.57 (s, 2H), 1.44 (s, 9H), 1.14 (s, 2H), 0.99 (s, 2H).

[0606]

[0607] Preparation Example 33-4: Preparation of 4-(1',2',3',5'-tetrahydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-8'-yl)benzonitrile hydrochloride (Compound 33-5)

[0608]

[0609] 13 mg (yield 53%) of the title compound was obtained using tert-butyl 8'-(4-cyanophenyl)-1',5'-dihydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-2'(3'H)-carboxylate (29 mg, 0.073 mmol) and HCl solution (4 M in dioxane) (0.36 mL, 1.45 mmol) in the same manner as in Preparation Examples 1-4.

[0610] 1 H NMR (400 MHz, DMSO) δ 11.08 (s, 1H), 9.29 (s, 2H), 7.91 (s, 5H), 7.51 (d, J = 8.3 Hz, 1H), 7.41 (d, J = 8.5 Hz, 1H), 4.46 (s, 2H), 3.41 (s, 2H), 1.28 (s, 2H), 1.16 (s, 2H).

[0611]

[0612] Preparation Example 33-5: Preparation of 4-(2'-benzoyl-1',2',3',5'-tetrahydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-8'-yl)benzonitrile (Compound 33)

[0613]

[0614] 4 mg (yield 40%) of the title compound was obtained using 4-(1',2',3',5'-tetrahydrospiro[cyclopropane-1,4'-pyrido[4,3-b]indole]-8'-yl)benzonitrile hydrochloride (13 mg, 0.04 mmol), benzoic acid (7 mg, 0.06 mmol), EDCI (31 mg, 0.16 mmol), and DIPEA (0.03 mL, 0.16 mmol) in the same manner as in Preparation Example 2.

[0615] 1 H NMR (400 MHz, DMSO) δ 10.85 (s, 1H), 7.95 (s, 2H), 7.87 (s, 3H), 7.64 (s, 1H), 7.48 (s, 5H), 7.38 (s, 1H), 4.98 (s, 1H), 4.75 (s, 1H), 3.89 (s, 1H), 3.52 (s, 1H), 1.13 (s, 2H), 0.75 (s, 2H).

[0616]

[0617] Preparation Example 34: Preparation of 4-(11-benzoyl-5,6,7,8,9,10-hexahydro-7,10-epiminocyclohepta[b]indole-2-yl)benzonitrile (Compound 34)

[0618] Preparation Example 34-1: Preparation of 2-bromo-5,6,7,8,9,10-hexahydro-7,10-epiminocyclohepta[b]indole (Compound 34-2)

[0619]

[0620] (4-bromophenyl)hydrazine hydrochloride (500 mg, 2.24 mmol) and tert-butyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (529 mg, 2.35 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.28 mL, 8.0 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 4 hours. After the reaction was complete, the mixture was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and 220 mg (yield 35%) of the title compound was obtained from the concentrate via column chromatography.

[0621] 1H NMR (400 MHz, DMSO) δ 10.89 (s, 1H), 7.58 (d, J=2.0 Hz, 1H), 7.20 (d, J=8.5 Hz, 1H), 7.05(dd, J=8.5, 2.0 Hz, 1H), 4.37(d, J=5.1 Hz, 1H), 3.87 - 3.79(m, 1H), 3.11-3.04(m, 1H), 2.43(d, J=16.1 Hz, 1H), 1.94 (ddd, J=26.4, 12.1, 7.4 Hz, 2H), 1.77(t, J=9.7 Hz, 1H), 1.45(q, J=8.8, 7.7 Hz, 1H).

[0622]

[0623] Preparation Example 34-2: Preparation of (2-bromo-5,6,7,8,9,10-hexahydro-7,10-epiminocyclohepta[b]indole-11-yl)(phenyl)methanone (Compound 34-3)

[0624]

[0625] 80 mg (yield 53%) of the title compound was obtained using 2-bromo-5,6,7,8,9,10-hexahydro-7,10-epiminocyclohepta[b]indole (110 mg, 0.4 mmol), benzoic acid (73 mg, 0.6 mmol), EDCI (230 mg, 1.2 mmol), and DIPEA (0.21 mL, 1.2 mmol) in the same manner as in Preparation Example 2.

[0626] 1 H NMR (400 MHz, DMSO) δ 11.18 (d, J = 13.8 Hz, 1H), 7.79 (s, 1H), 7.69 - 7.33 (m, 4H), 7.27 (s, 1H), 7.24 (s, 1H), 7.12 (s, 1H), 5.14 (s, 1H), 4.69 (d, J = 260.7 Hz, 1H), 3.25 - 3.13 (m, 1H), 2.68 (t, J = 20.0 Hz, 1H), 2.18 (d, J = 66.8 Hz, 2H), 1.98 - 1.83 (m, 1H), 1.68 (s, 1H).

[0627]

[0628] Preparation Example 34-3: Preparation of 4-(11-benzoyl-5,6,7,8,9,10-hexahydro-7,10-epiminocyclohepta[b]indole-2-yl)benzonitrile (Compound 34)

[0629]

[0630] 48 mg (yield 57%) of the title compound was obtained using (2-bromo-5,6,7,8,9,10-hexahydro-7,10-epiminocyclohepta[b]indole-11-yl)(phenyl)methanone (80 mg, 0.21 mmol), (4-cyanophenyl)boronic acid (93 mg, 0.63 mmol), Pd(PPh3)4 (12 mg, 0.01 mmol), and 1M Na2CO3 (0.53 mL, 0.53 mmol) in the same manner as in Preparation Examples 1-3.

[0631] 1 H NMR (400 MHz, DMSO) δ 11.15 (d, J = 14.5 Hz, 1H), 8.07 - 7.94 (m, 1H), 7.87 (d, J = 16.5 Hz, 3H), 7.78 (s, 1H), 7.51 (s, 2H), 7.41 (t, J = 16.4 Hz, 5H), 5.53 (d, J = 237.1 Hz, 1H), 4.72 (d, J = 265.5 Hz, 1H), 3.31 - 3.19 (m, 1H), 2.70 (dd, J = 24.2, 16.1 Hz, 1H), 2.33 - 2.23 (m, 1H), 2.11 (d, J = 14.6 Hz, 1H), 1.95 (t, J = 10.0 Hz, 1H), 1.70 (s, 1H).

[0632]

[0633] Preparation Example 35: Preparation of 4-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-chlorobenzonitrile (Compound 35)

[0634] Preparation Example 35-1: Preparation of (8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 35-1)

[0635]

[0636] 225 mg (yield 81%) of the title compound was obtained using 8-bromo-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (200 mg, 0.72 mmol), benzoic acid (134 mg, 1.1 mmol), EDCI (5556 mg, 2.9 mmol), and DIPEA (0.505 mL, 2.9 mmol) in the same manner as in Preparation Example 2.

[0637] 1 H NMR (400 MHz, DMSO) δ 11.25 (s, 1H), 7.76 - 7.33 (m, 6H), 7.28 (d, J = 8.4 Hz, 1H), 7.16 (s, 1H), 4.82 (s, 1H), 4.53 (s, 1H), 3.79 (s, 1H), 3.46 (s, 1H), 1.35 (s, 3H), 1.17 (s, 3H).

[0638]

[0639] Preparation Example 35-2: Preparation of 4-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-chlorobenzonitrile (Compound 35)

[0640]

[0641] 11 mg (yield 19%) of the title compound was obtained using (8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (50 mg, 0.13 mmol), (3-chloro-4-cyanophenyl)boronic acid (71 mg, 0.39 mmol), Pd(PPh3)4 (8 mg, 0.007 mmol), and 1M Na2CO3 (0.33 mL, 0.33 mmol) in the same manner as in Preparation Examples 1-3.

[0642] 1 H NMR (400 MHz, DMSO) δ 11.26 (d, J = 22.2 Hz, 1H), 8.13 (d, J = 32.3 Hz, 1H), 8.03 (s, 1H), 7.95 (s, 1H), 7.81 (d, J = 25.3 Hz, 2H), 7.47 (d, J = 11.6 Hz, 6H), 4.92 (s, 1H), 4.63 (s, 1H), 3.82 (s, 1H), 3.48 (d, J = 4.4 Hz, 1H), 1.38 (s, 3H), 1.20 (s, 3H).

[0643]

[0644] Preparation Example 36: Preparation of 4-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-methylbenzonitrile (Compound 36)

[0645]

[0646] 25 mg (yield 51%) of the title compound was obtained using (8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (50 mg, 0.13 mmol), (4-cyano-3-methylphenyl)boronic acid (63 mg, 0.39 mmol), Pd(PPh3)4 (8 mg, 0.007 mmol), and 1M Na2CO3 (0.33 mL, 0.33 mmol) in the same manner as in Preparation Examples 1-3.

[0647] 1 H NMR (400 MHz, DMSO) δ 11.19 (s, 1H), 7.91 (d, J = 30.8 Hz, 1H), 7.75 (s, 2H), 7.63 (s, 1H), 7.46 (dq, J = 12.0, 7.5, 5.3 Hz, 7H), 4.91(s, 1H), 4.62(s, 1H), 3.82(s, 1H), 3.49(s, 1H), 2.55(s, 3H), 1.38(s, 3H), 1.20(s, 3H).

[0648]

[0649] Preparation Example 37: Preparation of 5-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-chlorobenzonitrile (Compound 37)

[0650]

[0651] 13 mg (yield 23%) of the title compound was obtained using (8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (50 mg, 0.13 mmol), (4-chloro-3-cyanophenyl)boronic acid (71 mg, 0.39 mmol), Pd(PPh3)4 (8 mg, 0.007 mmol), and 1M Na2CO3 (0.33 mL, 0.33 mmol) in the same manner as in Preparation Examples 1-3.

[0652] 1 H NMR (400 MHz, DMSO) δ 11.21(s, 1H), 8.32(d, J=49.3 Hz, 1H), 8.05(d, J=38.2 Hz, 2H), 7.74(s, 2H), 7.52 - 7.39(m, 6H), 4.91(s, 1H), 4.63(s, 1H), 3.82(s, 1H), 3.54 - 3.46(m, 1H), 1.38(s, 3H), 1.20(s, 3H).

[0653]

[0654] Preparation Example 38: Preparation of 4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-chlorobenzonitrile (Compound 38)

[0655] Preparation Example 38-1: Preparation of (8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 38-1)

[0656]

[0657] 204 mg (yield 46%) of the title compound was obtained using 8-bromo-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (318 mg, 1.2 mmol), benzoic acid (220 mg, 1.8 mmol), EDCI (920 mg, 4.8 mmol), and DIPEA (0.836 mL, 4.8 mmol) in the same manner as in Preparation Example 2.

[0658] 1 H NMR (400 MHz, DMSO) δ 11.18(s, 1H), 7.69(s, 1H), 7.50 - 7.42(m, 5H), 7.28(d, J=8.5 Hz, 1H), 7.16(s, 1H), 5.35(s, 1H), 4.48(s, 1H), 4.27(s, 1H), 3.15(dd, J=18.2, 5.7 Hz, 1H), 2.58(d, J=14.8 Hz, 1H), 1.18(s, 3H).

[0659]

[0660] Preparation Example 38-2: Preparation of 4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-chlorobenzonitrile (Compound 38)

[0661]

[0662] 28 mg (yield 47%) of the title compound was obtained using (8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (50 mg, 0.14 mmol), (3-chloro-4-cyanophenyl)boronic acid (76 mg, 0.42 mmol), Pd(PPh3)4 (8 mg, 0.007 mmol), and 1M Na2CO3 (0.35 mL, 0.35 mmol) in the same manner as in Preparation Examples 1-3.

[0663] 1H NMR (400 MHz, DMSO) δ 11.20(s, 1H), 8.16(s, 1H), 8.09(s, 1H), 7.98 (s, 2H), 7.49(s, 5H), 7.43(d, J=8.4 Hz, 2H), 5.41(d, J=60.6) Hz, 1H), 4.59 (d, J=52.1 Hz, 1H), 4.28(d, J=25.7 Hz, 1H), 3.17(s, 1H), 2.62(s, 1H), 1.21(s, 3H).

[0664]

[0665] Preparation Example 39: Preparation of 4-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-methylbenzonitrile (Compound 39)

[0666]

[0667] 22 mg (yield 39%) of the title compound was obtained using (8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (50 mg, 0.14 mmol), (4-cyano-3-methylphenyl)boronic acid (68 mg, 0.42 mmol), Pd(PPh3)4 (8 mg, 0.007 mmol), and 1MNa2CO3 (0.35 mL, 0.35 mmol) in the same manner as in Preparation Examples 1-3.

[0668] 1 H NMR (400 MHz, DMSO) δ 11.14 (s, 1H), 7.97 (s, 1H), 7.88 (s, 1H), 7.78 (s, 2H), 7.49 (s, 5H), 7.43 (s, 2H), 5.40 (d, J = 48.9 Hz, 1H), 4.55 (s, 1H), 4.30 (s, 1H), 3.16 (s, 1H), 2.59 (d, J = 24.5 Hz, 4H), 1.21 (s, 3H).

[0669]

[0670] Preparation Example 40: Preparation of 5-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)-2-chlorobenzonitrile (Compound 40)

[0671]

[0672] 32 mg (yield 54%) of the title compound was obtained using (8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (50 mg, 0.14 mmol), (4-chloro-3-cyanophenyl)boronic acid (76 mg, 0.42 mmol), Pd(PPh3)4 (8 mg, 0.007 mmol), and 1 M Na2CO3 (0.35 mL, 0.35 mmol) in the same manner as in Preparation Examples 1-3.

[0673] 1 H NMR (400 MHz, DMSO) δ 11.14 (s, 1H), 8.38 (s, 1H), 8.10 (s, 1H), 8.02 (s, 1H), 7.77 (s, 1H), 7.49 (s, 5H), 7.41 (d, J = 8.2 Hz, 2H), 5.41 (d, J = 57.1 Hz, 1H), 4.57 (d, J = 51.0 Hz, 1H), 4.27 (d, J = 29.5 Hz, 1H), 3.18 (d, J = 16.2 Hz, 1H), 2.62 (s, 1H), 1.21 (s, 3H).

[0674]

[0675] Preparation Example 41: Preparation of 4-(3-methyl-2-nicotinoyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 41)

[0676]

[0677] 18 mg (yield 74%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), nicotinic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0678] 1 H NMR (400 MHz, DMSO) δ 11.15 (s, 1H), 8.69 (s, 2H), 7.89 (s, 6H), 7.57 - 7.45 (m, 2H), 7.44 (s, 1H), 5.50 (d, J = 15.7 Hz, 1H), 4.61 (s, 1H), 4.26 (s, 1H), 3.21 (s, 1H), 2.63 (s, 1H), 1.24 (s, 3H).

[0679]

[0680] Preparation Example 42: Preparation of 4-(3-methyl-2-(pyrazine-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 42)

[0681]

[0682] 8 mg (yield 33%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), pyrazine-2-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0683] 1H NMR (400 MHz, DMSO) δ 11.15 (s, 1H), 8.89 (d, J = 20.9 Hz, 1H), 8.80 (s, 1H), 8.74 (s, 1H), 8.03 - 7.94 (m, 2H), 7.89 (d, J = 8.0 Hz, 1H), 7.78 (d, J = 55.5 Hz, 2H), 7.52 - 7.40 (m, 2H), 5.59 - 5.37 (m, 1H), 4.78 - 4.52 (m, 1H), 4.41 - 4.26 (m, 1H), 3.28 - 3.15 (m, 1H), 2.76 - 2.59 (m, 1H), 1.29 (dd, J = 20.1, 6.9 Hz, 3H).

[0684]

[0685] Preparation Example 43: Preparation of 4-(2-isonicotinoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 43)

[0686]

[0687] 15 mg (yield 62%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), isonicotinic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0688] 1 H NMR (400 MHz, DMSO) δ 11.16(s, 1H), 8.72(s, 2H), 7.97(d, J=10.0 Hz, 2H), 7.91-7.71(m, 3H), 7.47(dd, J=22.6, 7.2 Hz, 4H), 5.55-5.35(m, 1H), 4.52 (s, 1H), 4.27-4.15(m, 1H), 3.17(s, 1H), 2.67(d, J=50.1 Hz, 1H), 1.31-1.20 (m, 3H).

[0689]

[0690] Preparation Example 44: Preparation of 4-(3-methyl-2-(thiazole-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 44)

[0691]

[0692] 13 mg (yield 53%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), thiazole-2-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0693] 1 H NMR (400 MHz, DMSO) δ 11.18 (s, 1H), 8.08 (s, 2H), 7.96 (d, J = 8.8 Hz, 2H), 7.92 - 7.76 (m, 3H), 7.46 (d, J = 12.2 Hz, 2H), 6.25 - 6.03 (m, 1H), 5.50 - 5.34 (m, 1H), 4.51 (d, J = 115.2 Hz, 1H), 3.22 (t, J = 11.6 Hz, 1H), 2.73 (d, J = 16.4 Hz, 1H), 1.31 (d, J = 6.7 Hz, 3H).

[0694]

[0695] Preparation Example 45: Preparation of 4-(3-methyl-2-(pyrimidine-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 45)

[0696]

[0697] 8 mg (yield 33%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), pyrimidine-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 2.

[0698] 1 H NMR (400 MHz, DMSO) δ 11.17 (s, 1H), 9.32 (s, 1H), 8.98 (d, J = 12.2 Hz, 2H), 7.97 (d, J = 11.7 Hz, 2H), 7.92 - 7.79 (m, 3H), 7.55 - 7.34 (m, 2H), 5.55 - 5.33 (m, 1H), 4.67 (s, 1H), 4.29 (s, 1H), 3.21 (d, J = 2.0 Hz, 1H), 2.66 (d, J = 32.3 Hz, 1H), 1.29 (d, J = 22.6) Hz, 3H).

[0699]

[0700] Preparation Example 46: Preparation of 4-(3-methyl-2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 46)

[0701]

[0702] 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol) was dissolved in dichloromethane under nitrogen. Thiazole-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) were added, and the reaction mixture was stirred at room temperature for 15 hours. After the reaction was complete, the mixture was extracted with distilled water and dichloromethane, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 11 mg (yield 45%) of the title compound.

[0703] 1 H NMR (400 MHz, Chloroform) δ 8.92(s, 1H), 8.16(s, 1H), 8.02(s, 1H), 7.73(d, J=2.2 Hz, 4H), 7.66(s, 1H), 7.43(s, 2H), 5.33(s, 2H), 4.60(s, 1H), 3.33(d, J=15.1 Hz, 1H), 2.67(d, J=16.1 Hz, 1H), 1.39(d, J=6.9 Hz, 3H).

[0704]

[0705] Preparation Example 47: Preparation of 4-(3-methyl-2-(oxazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 47)

[0706]

[0707] 16 mg (yield 68%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), oxazole-5-carboxylic acid (11 mg, 0.093 mmol), EDCI (44 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0708] 1 H NMR (400 MHz, Chloroform) δ 8.01 (s, 2H), 7.73 (d, J = 2.1 Hz, 5H), 7.66 (s, 1H), 7.43 (s, 2H), 5.24 (d, J = 181.5 Hz, 3H), 3.35 (d, J = 16.2 Hz, 1H), 2.69 (d, J = 16.1 Hz, 1H), 1.39 (d, J = 6.9 Hz, 3H).

[0709]

[0710] Preparation Example 48: Preparation of 4-(3-methyl-2-(pyridazine-3-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 48)

[0711]

[0712] 11 mg (yield 45%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), pyridazine-3-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0713] 1H NMR (400 MHz, DMSO) δ 11.17 (d, J = 6.1 Hz, 1H), 9.36 (d, J = 5.2 Hz, 1H), 8.04 - 7.91 (m, 3H), 7.90 - 7.69 (m, 4H), 7.51 - 7.37 (m, 2H), 5.61 - 5.41 (m, 1H), 4.70 - 4.54 (m, 1H), 4.32 (d, J = 16.8 Hz, 1H), 3.25 - 3.16 (m, 1H), 2.78 - 2.59 (m, 1H), 1.30 (dd, J = 24.7, 6.8 Hz, 3H).

[0714]

[0715] Preparation Example 49: Preparation of (R)-4-(3-methyl-2-nicotinoyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 49)

[0716]

[0717] 18 mg (yield 74%) of the title compound was obtained using (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), nicotinic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0718] 1 H NMR (400 MHz, DMSO) δ 11.16(s, 1H), 8.69(s, 2H), 7.96(s, 2H), 7.88 (s, 4H), 7.53(s, 1H), 7.46(d, J=15.5 Hz, 2H), 5.54 - 5.34(m, 1H), 4.61(s, 1H), 4.27(s, 1H), 3.26 - 3.18(m, 1H), 2.61(d, J=17.2 Hz, 1H), 1.24(s, 3H).

[0719]

[0720] Preparation Example 50: Preparation of 4-(3-methyl-2-picolinoyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 50)

[0721]

[0722] 8 mg (yield 41%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (16 mg, 0.05 mmol), picolinic acid (9 mg, 0.075 mmol), EDCI (38 mg, 0.2 mmol), and DIPEA (0.035 mL, 0.2 mmol) in the same manner as in Preparation Example 46.

[0723] 1 H NMR (400 MHz, DMSO) δ 11.14 (d, J = 7.5 Hz, 1H), 8.65 (s, 1H), 7.97 (d, J = 8.3 Hz, 3H), 7.92 - 7.79 (m, 3H), 7.68 - 7.53 (m, 2H), 7.53 - 7.48 (m, 1H), 7.44 (d, J = 9.7 Hz, 1H), 5.57 - 5.38 (m, 1H), 4.60 (dd, J = 81.0, 16.1 Hz, 1H), 4.36 - 4.24 (m, 1H), 3.23 - 3.13 (m, 1H), 2.66 (d, J = 36.1 Hz, 1H), 1.26 (dd, J = 25.4, 7.0 Hz, 3H).

[0724]

[0725] Preparation Example 51: Preparation of (R)-4-(3-methyl-2-picolinoyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 51)

[0726]

[0727] 11 mg (yield 45%) of the title compound was obtained using (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), picolinic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0728] 1 H NMR (400 MHz, DMSO) δ 11.15 (d, J=7.5 Hz, 1H), 8.65 (d, J=4.9 Hz, 1H), 7.96 (d, J=8.4 Hz, 3H), 7.91 - 7.80 (m, 3H), 7.65 - 7.42 (m, 4H), 5.57 - 5.36 (m, 1H), 4.60 (dd, J = 80.3, 15.9 Hz, 1H), 4.36 - 4.23(m, 1H), 3.21-3.16(m, 1H), 2.59(d, J=16.4 Hz, 1H), 1.26(dd, J=25.6, 6.8 Hz, 3H).

[0729]

[0730] Preparation Example 52: Preparation of (R)-4-(3-methyl-2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 52)

[0731]

[0732] 9 mg (yield 36%) of the title compound was obtained using (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), thiazole-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0733] 1H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 9.27 (s, 1H), 8.35 (s, 1H), 7.93 (d, J = 7.3 Hz, 3H), 7.87 (d, J = 8.1 Hz, 2H), 7.48 (d, J = 8.5 Hz, 1H), 7.43 (d, J = 8.5 Hz, 1H), 5.05 (d, J = 218.2 Hz, 3H), 3.23 (d, J = 5.3 Hz, 1H), 2.69 (d, J = 16.1 Hz, 1H), 1.27 (d, J = 6.8 Hz, 3H).

[0734]

[0735] Preparation Example 53: Preparation of (S)-4-(3-methyl-2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 53)

[0736]

[0737] 18 mg (yield 73%) of the title compound was obtained using (S)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), thiazole-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0738] 1H NMR (400 MHz, DMSO) δ 11.17 (s, 1H), 9.28 (s, 1H), 8.35 (s, 1H), 7.93 (d, J = 8.4 Hz, 3H), 7.87 (d, J = 8.0 Hz, 2H), 7.51 - 7.44 (m, 1H), 7.43 (d, J = 8.4 Hz, 1H), 5.28 (s, 1H), 4.75 (s, 1H), 4.36 (s, 1H), 3.23 (s, 1H), 2.69 (d, J = 16.3 Hz, 1H), 1.27 (d, J = 6.8 Hz, 3H).

[0739]

[0740] Preparation Example 54: Preparation of (S)-4-(3-methyl-2-nicotinoyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 54)

[0741]

[0742] 8 mg (yield 33%) of the title compound was obtained using (S)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), nicotinic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0743] 1 H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 8.69 (s, 2H), 7.96 (s, 2H), 7.89 (s, 4H), 7.53 (s, 1H), 7.46 (d, J = 15.4 Hz, 2H), 5.52 (s, 1H), 4.60 (s, 1H), 4.27 (s, 1H), 3.21 (s, 1H), 2.63 (s, 1H), 1.23 (s, 3H).

[0744]

[0745] Preparation Example 55: Preparation of (8-(4-fluorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 55)

[0746] Preparation Example 55-1: Preparation of tert-butyl 8-(4-fluorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 55-2)

[0747]

[0748] 236 mg (yield 76%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), (4-fluorophenyl)boronic acid (343 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1M Na2CO3 (2.05 mL, 2.05 mmol) in the same manner as in Preparation Examples 1-3.

[0749] 1 H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 7.71 (td, J = 5.7, 1.9 Hz, 2H), 7.66 (s, 1H), 7.40 - 7.31 (m, 2H), 7.26 (t, J = 8.8 Hz, 2H), 4.92 (d, J=15.9 Hz, 1H), 4.77 (s, 1H), 4.16 (d, J = 15.7 Hz, 1H), 3.06(dd, J=16.4, 6.1 Hz, 1H), 2.59 (d, J=16.3 Hz, 1H), 1.46(s, 9H), 1.13(d, J=6.8 Hz, 3H).

[0750]

[0751] Preparation Example 55-2: Preparation of 8-(4-fluorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 55-3)

[0752]

[0753] 172 mg (yield 88%) of the title compound was obtained using tert-butyl 8-(4-fluorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (236 mg, 0.62 mmol) and an HCl solution (4 M in dioxane) (3.1 mL, 12.4 mmol) in the same manner as in Preparation Examples 1-4.

[0754] 1 H NMR (400 MHz, DMSO) δ 11.22(s, 1H), 9.26(s, 1H), 9.07(s, 1H), 7.80 - 7.75(m, 1H), 7.73 - 7.67(m, 2H), 7.45 - 7.38(m, 2H), 7.31 - 7.25 (m, 2H), 4.45 (d, J = 14.5 Hz, 1H), 4.36 (s, 1H), 3.72 (s, 1H), 3.13 (dd, J = 16.9, 4.7 Hz, 1H), 2.83 (dd, J = 17.0, 9.8 Hz, 1H), 1.45(d, J = 6.5 Hz, 3H).

[0755]

[0756] Preparation Example 55-3: Preparation of (8-(4-fluorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 55)

[0757]

[0758] 15 mg (yield 62%) of the title compound was obtained using 8-(4-fluorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.063 mmol), benzoic acid (12 mg, 0.095 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0759] 1H NMR (400 MHz, DMSO) δ 11.03(s, 1H), 7.73(s, 3H), 7.49(q, J=8.0, 5.7 Hz, 5H), 7.38(d, J=8.2 Hz, 2H), 7.25(s, 2H), 5.43 (s, 1H), 4.55 (s, 1H), 4.26 (d, J=28.6 Hz, 1H), 3.17(dd, J=16.2, 5.9 Hz, 1H), 2.61(s, 1H), 1.20(s, 3H).

[0760]

[0761] Preparation Example 56: Preparation of 4-(8-(4-fluorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-2-carbonyl)benzonitrile (Compound 56)

[0762]

[0763] 13 mg (yield 50%) of the title compound was obtained using 8-(4-fluorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.063 mmol), 4-cyanobenzoic acid (14 mg, 0.095 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0764] 1H NMR (400 MHz, DMSO) δ 11.04 (s, 1H), 7.98 (d, J = 8.0 Hz, 2H), 7.79 (s, 1H), 7.74 (s, 1H), 7.68 (d, J = 7.6 Hz, 2H), 7.58 (d, J = 49.4 Hz, 1H), 7.37 (d, J = 5.7 Hz, 2H), 7.31 - 7.19 (m, 2H), 5.52 - 5.32 (m, 1H), 4.50 (s, 1H), 4.28 - 4.12 (m, 1H), 3.17 (dd, J = 16.2, 5.9 Hz, 1H), 2.56 (d, J = 16.1 Hz, 1H), 1.25 (d, J = 31.8 Hz, 3H).

[0765]

[0766] Preparation Example 57: Preparation of (8-(4-fluorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(4-methoxyphenyl)methanone (Compound 57)

[0767]

[0768] 15 mg (yield 57%) of the title compound was obtained using 8-(4-fluorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.063 mmol), 4-methoxybenzoic acid (14 mg, 0.095 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0769] 1H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 7.71 (s, 3H), 7.47 - 7.41 (m, 2H), 7.38 (d, J = 8.3 Hz, 1H), 7.33 (d, J = 8.5 Hz, 1H), 7.24 (t, J = 8.5 Hz, 2H), 7.02 (d, J = 8.6 Hz, 2H), 5.34 (s, 1H), 4.42 (s, 2H), 3.82 (s, 3H), 3.18 (d, J = 15.4 Hz, 1H), 2.61 (d, J = 16.4 Hz, 1H), 1.22 (s, 3H).

[0770]

[0771] Preparation Example 58: Preparation of (8-(4-methoxyphenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 58)

[0772] Preparation Example 58-1: Preparation of tert-butyl 8-(4-methoxyphenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 58-2)

[0773]

[0774] 290 mg (yield 90%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), (4-methoxyphenyl)boronic acid (374 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (2.05 mL, 2.05 mmol) in the same manner as in Preparation Examples 1-3.

[0775] 1H NMR (400 MHz, DMSO) δ 10.90(s, 1H), 7.61(dd, J=6.5, 2.3 Hz, 3H), 7.38 - 7.26(m, 2H), 7.01(d, J=8.6 Hz, 2H), 4.91(d, J=15.8 Hz, 1H), 4.77(s, 1H), 4.16(d, J=15.9 Hz, 1H), 3.80(s, 3H), 3.06(dd, J=16.6, 6.1 Hz, 1H), 2.58 (d, J=16.3 Hz, 1H), 1.46 (s, 9H), 1.13(d, J=6.8 Hz, 3H).

[0776]

[0777] Preparation Example 58-2: Preparation of 8-(4-methoxyphenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 58-3)

[0778]

[0779] 242 mg (yield 99%) of the title compound was obtained using tert-butyl 8-(4-methoxyphenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (290 mg, 0.74 mmol) and an HCl solution (4 M in dioxane) (3.7 mL, 14.8 mmol) in the same manner as in Preparation Examples 1-4.

[0780] 1 H NMR (400 MHz, DMSO) δ 11.18(s, 1H), 9.43(d, J=10.9 Hz, 1H), 9.19(s, 1H), 7.72(s, 1H), 7.67-7.58(m, 2H), 7.43-7.33(m, 2H), 7.02(d, J=8.6 Hz, 2H), 4.44 (d, J=14.6 Hz, 1H), 4.35(s, 1H), 3.80(s, 3H), 3.71(s, 1H), 3.12(dd, J=17.0, 4.7 Hz, 1H), 2.84(dd, J=16.9, 9.9 Hz, 1H), 1.46 (d, J=6.5 Hz, 3H).

[0781]

[0782] Preparation Example 58-3: Preparation of (8-(4-methoxyphenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 58)

[0783]

[0784] 17 mg (yield 70%) of the title compound was obtained using 8-(4-methoxyphenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.061 mmol), benzoic acid (11 mg, 0.092 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[0785] 1 H NMR (400 MHz, DMSO) δ 10.97 (s, 1H), 7.72 (s, 1H), 7.63 (s, 2H), 7.49 (s, 5H), 7.35 (s, 2H), 7.00 (s, 2H), 5.43 (s, 1H), 4.54 (s, 1H), 4.28 (s, 1H), 3.80 (s, 3H), 3.15 (s, 1H), 2.60 (s, 1H), 1.21 (s, 3H).

[0786]

[0787] Preparation Example 59: Preparation of (3-chlorophenyl)(8-(4-methoxyphenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 59)

[0788]

[0789] 16 mg (yield 61%) of the title compound was obtained using 8-(4-methoxyphenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.061 mmol), 3-chlorobenzoic acid (14 mg, 0.092 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[0790] 1 H NMR (400 MHz, DMSO) δ 10.97(s, 1H), 7.72(s, 1H), 7.64(s, 1H), 7.54 (d, J=11.0 Hz, 4H), 7.44(s, 1H), 7.35(s, 2H), 7.00(s, 2H), 5.48-5.31(m, 1H), 4.54(s, 1H), 4.24(s, 1H), 3.80(s, 3H), 3.18(d, J=17.3 Hz, 1H), 2.68(s, 1H), 1.22 (s, 3H).

[0791]

[0792] Preparation Example 60: Preparation of (8-(4-methoxyphenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(m-tolyl)methanone (Compound 60)

[0793]

[0794] 16 mg (yield 64%) of the title compound was obtained using 8-(4-methoxyphenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.061 mmol), 3-methylbenzoic acid (13 mg, 0.092 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[0795] 1H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 7.67 (d, J = 32.8 Hz, 3H), 7.36 (d, J = 8.3 Hz, 2H), 7.30 (d, J = 7.6 Hz, 2H), 7.26 (s, 2H), 7.00 (s, 2H), 5.43 (s, 1H), 4.52 (s, 1H), 4.27 (d, J = 36.8 Hz, 1H), 3.80 (s, 3H), 3.16 (d, J = 17.0 Hz, 1H), 2.68 (s, 1H), 2.37 (s, 3H), 1.20 (s, 3H).

[0796]

[0797] Preparation Example 61: Preparation of (3-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 61)

[0798] Preparation Example 61-1: Preparation of tert-butyl 3-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 61-2)

[0799]

[0800] 251 mg (yield 84%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), pyridine-3-ylboronic acid (302 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (2.05 mL, 2.05 mmol) in the same manner as in Preparation Examples 1-3.

[0801] 1H NMR (400 MHz, DMSO) δ 11.03(s, 1H), 8.92(s, 1H), 8.50(d, J=4.6 Hz, 1H), 8.09(dd, J=7.9, 2.1 Hz, 1H), 7.78(s, 1H), 7.45(dd, J=8.1, 5.0 Hz, 1H), 7.41(s, 2H), 4.94(d, J=15.9 Hz, 1H), 4.77(s, 1H), 4.17(d, J=15.9 Hz, 1H), 3.07(dd, J=16.2, 6.0 Hz, 1H), 2.60(d, J=16.3 Hz, 1H), 1.46(s, 9H), 1.13(d, J = 6.8 Hz, 3H).

[0802]

[0803] Preparation Example 61-2: Preparation of 3-methyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 61-3)

[0804]

[0805] 198 mg (yield 96%) of the title compound was obtained using tert-butyl 3-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (251 mg, 0.69 mmol) and an HCl solution (4 M in dioxane) (3.45 mL, 13.8 mmol) in the same manner as in Preparation Examples 1-4.

[0806] 1H NMR (400 MHz, DMSO) δ 11.50 (s, 1H), 9.81 (d, J = 10.7 Hz, 1H), 9.55 (d, J = 10.1 Hz, 1H), 9.22 (s, 1H), 8.80 (dd, J = 11.8, 6.8 Hz, 2H), 8.11 (s, 1H), 8.04 (t, J = 6.9 Hz, 1H), 7.62 (d, J = 8.5 Hz, 1H), 7.53 (d, J = 8.5 Hz, 1H), 4.41 (d, J = 14.6 Hz, 1H), 4.32 (d, J = 17.2 Hz, 1H), 3.71 (d, J = 10.4 Hz, 1H), 3.15 (dd, J = 17.0, 4.6 Hz, 1H), 2.89 (dd, J = 17.0, 9.9 Hz, 1H), 1.49 (d, J = 6.4 Hz, 3H).

[0807]

[0808] Preparation Example 61-3: Preparation of (3-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 61)

[0809]

[0810] 18 mg (yield 73%) of the title compound was obtained using 3-methyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.067 mmol), benzoic acid (12 mg, 0.1 mmol), EDCI (52 mg, 0.27 mmol), and DIPEA (0.047 mL, 0.27 mmol) in the same manner as in Preparation Example 46.

[0811] 1H NMR (400 MHz, DMSO) δ 11.10 (s, 1H), 8.94 (s, 1H), 8.50 (s, 1H), 8.10 (s, 1H), 7.89 (s, 1H), 7.51 - 7.41 (m, 8H), 5.40 (d, J = 51.0 Hz, 1H), 4.52 (s, 1H), 4.30 (s, 1H), 3.18 (dd, J = 16.7, 5.8 Hz, 1H), 2.62 (s, 1H), 1.21 (s, 3H).

[0812]

[0813] Preparation Example 62: Preparation of (3-methoxyphenyl)(3-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 62)

[0814]

[0815] In the same manner as in Preparation Example 46, 11 mg (yield 41%) of the title compound was obtained using 3-methyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.067 mmol), 3-methoxybenzoic acid (15 mg, 0.1 mmol), EDCI (52 mg, 0.27 mmol), and DIPEA (0.047 mL, 0.27 mmol).

[0816] 1 H NMR (400 MHz, DMSO) δ 11.09(s, 1H), 8.94(s, 1H), 8.50(s, 1H), 8.11 (s, 1H), 7.89(s, 1H), 7.42(s, 4H), 7.08 - 6.93(m, 3H), 5.47(s, 1H), 4.30(s, 1H), 4.22(s, 1H), 3.80(s, 3H), 3.17(d, J=16.0 Hz, 1H), 2.68(s, 1H), 1.21(s, 3H).

[0817]

[0818] Preparation Example 63: Preparation of (4-chlorophenyl)(3-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 63)

[0819]

[0820] In the same manner as in Preparation Example 46, 15 mg (yield 56%) of the title compound was obtained using 3-methyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.067 mmol), 4-chlorobenzoic acid (16 mg, 0.1 mmol), EDCI (52 mg, 0.27 mmol), and DIPEA (0.047 mL, 0.27 mmol).

[0821] 1 H NMR (400 MHz, DMSO) δ 11.09(s, 1H), 8.93(s, 1H), 8.49(s, 1H), 8.10 (s, 1H), 7.89(s, 1H), 7.58-7.45(m, 5H), 7.44-7.39(m, 2H), 5.45(s, 1H), 4.58(s, 1H), 4.25(s, 1H), 3.18(d, J=16.6 Hz, 1H), 2.67(s, 1H), 1.22 (s, 3H).

[0822]

[0823] Preparation Example 64: Preparation of (3-methyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 64)

[0824] Preparation Example 64-1: Preparation of tert-butyl 3-methyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 64-2)

[0825]

[0826] 261 mg (yield 84%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), m-tolylboronic acid (334 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (2.05 mL, 2.05 mmol) in the same manner as in Preparation Examples 1-3.

[0827] 1 H NMR (400 MHz, DMSO) δ 10.93(s, 1H), 7.66(s, 1H), 7.53-7.43(m, 2H), 7.40 - 7.29(m, 3H), 7.11(d, J=7.5 Hz, 1H), 4.92(d, J=15.9 Hz, 1H), 4.77(s, 1H), 4.17(d, J=16.0 Hz, 1H), 3.06(dd, J=16.3, 6.2 Hz, 1H), 2.59 (d, J=16.3 Hz, 1H), 2.39(s, 3H), 1.46(s, 9H), 1.13(d, J=6.8 Hz, 3H).

[0828]

[0829] Preparation Example 64-2: Preparation of 3-methyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 64-3)

[0830]

[0831] 187 mg (yield 87%) of the title compound was obtained using tert-butyl 3-methyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (261 mg, 0.69 mmol) and an HCl solution (4 M in dioxane) (3.47 mL, 13.9 mmol) in the same manner as in Preparation Examples 1-4.

[0832] 1H NMR (400 MHz, DMSO) δ 11.22 (s, 1H), 9.58 (d, J = 10.8 Hz, 1H), 9.40 - 9.27 (m, 1H), 7.78 (s, 1H), 7.53 - 7.44 (m, 2H), 7.41 (s, 2H), 7.33 (t, J = 7.5 Hz, 1H), 7.12 (d, J = 7.5 Hz, 1H), 4.44 (d, J = 14.6 Hz, 1H), 4.37 - 4.27 (m, 1H), 3.70 (s, 1H), 3.12 (dd, J = 16.6, 4.7 Hz, 1H), 2.85 (dd, J = 16.8, 9.9 Hz, 1H), 2.39 (s, 3H), 1.47 (d, J = 6.4 Hz, 3H).

[0833]

[0834] Preparation Example 64-3: Preparation of (3-methyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 64)

[0835]

[0836] 16 mg (yield 66%) of the title compound was obtained using 3-methyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), benzoic acid (12 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[0837] 1H NMR (400 MHz, DMSO) δ 11.01 (s, 1H), 7.78 (s, 1H), 7.48 (d, J = 6.9 Hz, 7H), 7.37 (s, 2H), 7.31 (s, 1H), 7.10 (d, J = 7.2 Hz, 1H), 5.44 (s, 1H), 4.57 (s, 1H), 4.26 (d, J = 26.5 Hz, 1H), 3.17 (dd, J = 16.5, 6.0 Hz, 1H), 2.59 (d, J = 15.9 Hz, 1H), 2.38 (s, 3H), 1.20 (s, 3H).

[0838]

[0839] Preparation Example 65: Preparation of 3-(3-methyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-2-carbonyl)benzonitrile (Compound 65)

[0840]

[0841] 4 mg (yield 15%) of the title compound was obtained using 3-methyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), 3-cyanobenzoic acid (14 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[0842] 1 H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 7.97 (d, J = 8.3 Hz, 2H), 7.79 (s, 1H), 7.70 (s, 1H), 7.54 (s, 1H), 7.49 (s, 1H), 7.38 (s, 2H), 7.32 (s, 2H), 7.10 (s, 1H), 5.49 - 5.33 (m, 1H), 4.54 (s, 1H), 4.21 (s, 1H), 3.21 (s, 1H), 2.58 (s, 1H), 2.42 - 2.33 (m, 3H), 1.23 (s, 3H).

[0843]

[0844] Preparation Example 66: Preparation of (4-methoxyphenyl)(3-methyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 66)

[0845]

[0846] 11 mg (yield 42%) of the title compound was obtained using 3-methyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), 4-methoxybenzoic acid (15 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[0847] 1 H NMR (400 MHz, DMSO) δ 10.99 (s, 1H), 7.71 (s, 1H), 7.51 (s, 1H), 7.44 (d, J = 8.2 Hz, 3H), 7.36 (s, 2H), 7.31 (t, J = 7.7 Hz, 1H), 7.10 (d, J = 7.5 Hz, 1H), 7.03 (d, J = 8.1 Hz, 2H), 5.33 (s, 1H), 4.36 (d, J = 74.5 Hz, 2H), 3.83 (s, 3H), 3.17 (s, 1H), 2.62 (d, J = 16.5 Hz, 1H), 2.38 (s, 3H), 1.22 (s, 3H).

[0848]

[0849] Preparation Example 67: Preparation of 3-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 67)

[0850] Preparation Example 67-1: Preparation of tert-butyl 8-(3-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 67-2)

[0851]

[0852] 233 mg (yield 73%) of the title compound was obtained using tert-butyl 8-bromo-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.82 mmol), (3-cyanophenyl)boronic acid (361 mg, 2.46 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1MNa2CO3 (2.05 mL, 2.05 mmol) in the same manner as in Preparation Examples 1-3.

[0853] 1 H NMR (400 MHz, DMSO) δ 11.03 (s, 1H), 8.18 (d, J = 2.0 Hz, 1H), 8.06 (d, J = 7.9 Hz, 1H), 7.84 (s, 1H), 7.74 (d, J = 7.6 Hz, 1H), 7.64 (t, J=7.9 Hz, 1H), 7.42(q, J=8.4 Hz, 2H), 4.94(d, J=15.9 Hz, 1H), 4.77(s, 1H), 4.17(d, J=16.2 Hz, 1H), 3.12-3.02(m, 1H), 2.60(d, J=16.2 Hz, 1H), 1.46(s, 9H), 1.13(d, J=6.8 Hz, 3H).

[0854]

[0855] Preparation Example 67-2: Preparation of 3-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 67-3)

[0856]

[0857] 161 mg (yield 83%) of the title compound was obtained using tert-butyl 8-(3-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (233 mg, 0.6 mmol) and HCl solution (4 M in dioxane) (3.0 mL, 12.0 mmol) in the same manner as in Preparation Examples 1-4.

[0858] 1 H NMR (400 MHz, DMSO) δ 11.32 (s, 1H), 9.55 (d, J = 10.8 Hz, 1H), 9.31 (s, 1H), 8.17 (d, J = 1.9 Hz, 1H), 8.06 (d, J = 8.0 Hz, 1H), 7.95 (s, 1H), 7.76 (d, J = 7.6 Hz, 1H), 7.66 (t, J = 7.7 Hz, 1H), 7.51 (d, J = 8.6 Hz, 1H), 7.45 (d, J = 8.5 Hz, 1H), 4.44 (d, J = 14.6 Hz, 1H), 4.34 (d, J = 9.4 Hz, 1H), 3.72 (s, 1H), 3.14 (dd, J = 16.9, 4.7 Hz, 1H), 2.86 (dd, J = 16.9, 10.0 Hz, 1H), 1.47 (d, J = 6.4 Hz, 3H).

[0859]

[0860] Preparation Example 67-3: Preparation of 3-(2-benzoyl-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 67)

[0861]

[0862] 10 mg (yield 41%) of the title compound was obtained using 3-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), benzoic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0863] 1H NMR (400 MHz, DMSO) δ 11.11(s, 1H), 8.22(s, 1H), 8.08(s, 1H), 7.98 (s, 1H), 7.73(s, 2H), 7.64(s, 1H), 7.49(s, 5H), 7.41(d, J=7.8 Hz, 1H), 5.47 (s, 1H), 4.31(s, 2H), 3.19(d, J=15.8 Hz, 1H), 2.68(s, 1H), 1.22(s, 3H).

[0864]

[0865] Preparation Example 68: Preparation of 3-(2-(4-chlorobenzoyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 68)

[0866]

[0867] 22 mg (yield 83%) of the title compound was obtained using 3-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 4-chlorobenzoic acid (15 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0868] 1 H NMR (400 MHz, DMSO) δ 11.13-11.08(m, 1H), 8.21(s, 1H), 8.08(s, 2H), 7.73(s, 1H), 7.63(s, 1H), 7.54(t, J=9.9 Hz, 4H), 7.42(s, 2H), 5.46(s, 1H), 4.56(s, 1H), 4.26(s, 1H), 3.18(d, J=13.7 Hz, 1H), 2.58(s, 1H), 1.22(s, 3H).

[0869]

[0870] Preparation Example 69: Preparation of 3-(3-methyl-2-(3-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 69)

[0871]

[0872] 10 mg (yield 40%) of the title compound was obtained using 3-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 3-methylbenzoic acid (13 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[0873] 1 H NMR (400 MHz, DMSO) δ 11.10(s, 1H), 8.22(s, 1H), 7.98(s, 2H), 7.73(s, 1H), 7.64(s, 1H), 7.47-7.25(m, 6H), 5.47(s, 1H), 4.27(d, J=38.8 Hz, 2H), 3.18 (d, J=17.1 Hz, 1H), 2.63(s, 1H), 2.37(s, 3H), 1.21(s, 3H).

[0874]

[0875] Preparation Example 70: Preparation of 4-(2-benzoyl-7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 70)

[0876] Preparation Example 70-1: Preparation of a mixture of 8-bromo-7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole / 8-bromo-9-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compounds 70-3 / 70-4)

[0877]

[0878] (4-bromo-3-methylphenyl)hydrazine hydrochloride (1.063 g, 5.15 mmol) and tert-butyl 4-oxopiperidine-1-carboxylate (1.078 g, 5.41 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.64 mL, 8 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 3 hours. After the reaction was complete, the mixture was based with a 1-normal aqueous sodium hydroxide solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure to obtain 453 mg of a positional isomer mixture.

[0879]

[0880] Preparation Example 70-2: Preparation of a mixture of tert-butyl 8-bromo-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-bromo-9-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compounds 70-5 / 70-6)

[0881]

[0882] A mixture of 8-bromo-7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole / 8-bromo-9-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (compounds 70-3 / 70-4) (400 mg, 1.51 mmol) was dissolved in a THF solution, and then Boc2O (0.38 mL, 1.66 mmol) was added. The reaction mixture was stirred at room temperature for 15 hours. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate. The organic layer was dried with anhydrous magnesium sulfate and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with hexane to obtain 337.5 mg of a positional isomer mixture.

[0883]

[0884] Preparation Example 70-3: Preparation of a mixture of tert-butyl 8-(4-cyanophenyl)-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-(4-cyanophenyl)-9-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compounds 70-7 / 70-8)

[0885]

[0886] A mixture of tert-butyl 8-bromo-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compounds 70-5 / 70-6) (100 mg, 0.27 mmol), (4-cyanophenyl)boronic acid (120.7 mg, 0.82 mmol), and Pd(PPh3)4 (15.82 mg, 0.014 mmol) was dissolved in a toluene:EtOH (1:1) solution. 1 M Na2CO3 (0.68 mL, 0.68 mmol) was added. The reaction mixture was stirred at 100 °C for 15 hours using a sealed tube. After the reaction was complete, it was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and 93.2 mg of the positional isomer mixture was obtained from the concentrate by column chromatography.

[0887]

[0888] Preparation Example 70-4: Preparation of a mixture of 4-(7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride / 4-(9-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compounds 70-9 / 70-10).

[0889]

[0890] A mixture (183 mg, 0.47 mmol) of tert-butyl 8-(4-cyanophenyl)-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 8-(4-cyanophenyl)-9-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compounds 70-7 / 70-8) was dissolved in a 1,4-dioxane solution. An HCl solution (4 M in dioxane) (2.36 mL, 9.45 mmol) was added. The mixture was stirred at room temperature for 4 hours. After the reaction was complete, the solution was removed under reduced pressure. The resulting solid was filtered through ethyl acetate to obtain 11.2 mg of the positional isomer mixture.

[0891]

[0892] Preparation Example 70-5: Preparation of 4-(2-benzoyl-7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 70)

[0893]

[0894] A mixture of 4-(7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride / 4-(9-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (compounds 70-9 / 70-10) (112.2 mg, 0.35 mmol) was dissolved in dimethylformamide under nitrogen. Benzoic acid (50.78 mg, 0.42 mmol), EDCI (265.7 mg, 1.39 mmol), and DIPEA (0.24 mL, 1.39 mmol) were added. The reaction mixture was stirred at room temperature for 18 hours. Once the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, the concentrate was purified through column chromatography, the precipitate was filtered with acetone and then filtered again with diethyl ether to obtain 61.7 mg of the title compound (70) (yield 45%).

[0895] 1 H NMR (400 MHz, DMSO) δ 10.98 (s, 1H), 7.89 (s, 2H), 7.55 (d, J=47.9 Hz, 8H), 7.25(s, 1H), 4.79(s, 2H), 3.65(s, 2H), 2.88(s, 2H), 2.32(s, 3H).

[0896]

[0897] Preparation Example 71: Preparation of (7-methyl-8-phenyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 71)

[0898] Preparation Example 71-1: Preparation of a mixture of tert-butyl 7-methyl-8-phenyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 9-methyl-8-phenyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compounds 71-2 / 71-3)

[0899]

[0900] A mixture of tert-butyl 8-bromo-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compounds 70-5 / 70-6) (100 mg, 0.27 mmol), phenylboronic acid (200.31 mg, 1.64 mmol), and Pd(PPh3)4 (15.82 mg, 0.014 mmol) was dissolved in a toluene:EtOH (1:1) solution. 1 M Na2CO3 (0.68 mL, 0.68 mmol) was added. The reaction mixture was stirred at 100 °C for 15 hours using a sealed tube. After the reaction was completed, the mixture was extracted with distilled water and ethyl acetate, dried with anhydrous magnesium sulfate, and filtered. The filtrate was concentrated under reduced pressure, and 81.8 mg of the positional isomer mixture was obtained from the concentrate through column chromatography.

[0901]

[0902] Preparation Example 71-2: Preparation of a mixture of 7-methyl-8-phenyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 9-methyl-8-phenyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compounds 71-4 / 71-5)

[0903]

[0904] A mixture (144.8 mg, 0.4 mmol) of tert-butyl 7-methyl-8-phenyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate / tert-butyl 9-methyl-8-phenyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (compounds 71-2 / 71-3) was dissolved in a 1,4-dioxane solution. An HCl solution (4 M in dioxane) (2 mL, 7.99 mmol) was added. The mixture was stirred at room temperature for 2 hours. After the reaction was complete, the solution was removed under reduced pressure. The resulting solid was filtered through ethyl acetate to obtain 100 mg of a positional isomer mixture.

[0905]

[0906] Preparation Example 71-3: Preparation of (7-methyl-8-phenyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 71)

[0907]

[0908] A mixture (100 mg, 0.33 mmol) of 7-methyl-8-phenyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride / 9-methyl-8-phenyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (compounds 71-4 / 71-5) was dissolved in dimethylformamide under nitrogen. Benzoic acid (49.04 mg, 0.4 mmol), EDCI (256.65 mg, 1.34 mmol), and DIPEA (0.23 mL, 1.34 mmol) were added, and the reaction mixture was stirred at room temperature for 13 hours. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified through column chromatography and the precipitate was filtered with diethyl ether to obtain 30 mg of the title compound (71) (yield 24%).

[0909] 1 H NMR (400 MHz, DMSO) δ 10.88 (s, 1H), 7.51 - 7.21 (m, 12H), 4.78 (s, 1H), 4.57 (s, 1H), 4.02 (s, 1H), 3.66 (s, 1H), 2.87 (s, 2H), 2.30 (s, 3H).

[0910]

[0911] Preparation Example 72: Preparation of (7-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 72)

[0912] Preparation Example 72-1: Preparation of 8-Bromo-7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (Compound 70-3)

[0913]

[0914] (4-bromo-3-methylphenyl)hydrazine hydrochloride (2 g, 9.95 mmol) and tert-butyl 4-oxopiperidine-1-carboxylate (2.081 g, 10.44 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (1.24 mL, 8 M) was added to the reaction mixture while stirring at 0 °C. Using a sealed tube, the reaction mixture was stirred at 110 °C for 3 hours. After the reaction was complete, the mixture was based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure, and the precipitate was filtered with acetone to obtain 1.36 g (yield 51%) of the title compound (70-3).

[0915] 1 H NMR (400 MHz, DMSO) δ 10.76 (s, 1H), 7.51 (s, 1H), 7.24 (s, 1H), 3.80 (s, 2H), 3.00 (t, J = 5.8 Hz, 2H), 2.65 (s, 2H), 2.39 (s, 3H).

[0916]

[0917] Preparation Example 72-2: Preparation of tert-butyl 8-bromo-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 70-5)

[0918]

[0919] 8-bromo-7-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (200 mg, 0.75 mmol) was dissolved in a THF solution under nitrogen, and then Boc2O (0.19 mL, 0.83 mmol) was added. The reaction mixture was stirred at room temperature for 15 hours. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with hexane to obtain 237.1 mg (yield 86%) of the title compound.

[0920] 1 H NMR (400 MHz, DMSO) δ 10.97(s, 1H), 7.63(s, 1H), 7.28(s, 1H), 4.49 (s, 2H), 3.69 (t, J=5.7 Hz, 2H), 2.76(s, 2H), 2.41(s, 3H), 1.44(s, 9H).

[0921]

[0922] Preparation Example 72-3: Preparation of tert-butyl 7-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 72-1)

[0923]

[0924] Tert-butyl 8-bromo-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (100 mg, 0.27 mmol), pyridine-3-ylboronic acid (100.97 mg, 0.82 mmol), and Pd(PPh3)4 (51.82 mg, 0.014 mmol) were dissolved in a toluene:EtOH (1:1) solution. 1M Na2CO3 (0.68 mL, 0.68 mmol) was added, and the reaction mixture was stirred at 100°C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was analyzed by column chromatography to obtain 91.1 mg of the title compound (yield 91%).

[0925] 1 H NMR (400 MHz, DMSO) δ 10.87 (s, 1H), 8.59 - 8.53 (m, 2H), 7.79 (d, J = 7.9 Hz, 1H), 7.47 - 7.43 (m, 1H), 7.25 (d, J = 6.5 Hz, 2H), 4.52 (s, 2H), 3.71 (s, 2H), 2.78 (s, 2H), 2.29 (s, 3H), 1.44 (s, 9H).

[0926]

[0927] Preparation Example 72-4: Preparation of 7-methyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 72-2)

[0928]

[0929] tert-butyl 7-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (90 mg, 0.25 mmol) was dissolved in a 1,4-dioxane solution. An HCl solution (4 M in dioxane) (1.24 mL, 4.95 mmol) was added. The mixture was stirred at room temperature for 3 hours. After the reaction was complete, the solution was removed under reduced pressure. The resulting solid was filtered through ethyl acetate to obtain 66.3 mg of the title compound (yield 89%).

[0930] 1 H NMR (400 MHz, DMSO) δ 11.26(s, 1H), 9.32(s, 1H), 8.85(s, 1H), 8.79(d, J=5.4 Hz, 1H), 8.36(d, J=8.1 Hz, 1H), 7.95-7.87(m, 1H), 7.46(s, 1H), 7.34(s, 1H), 4.29(d, J=5.2 Hz, 2H), 3.41(s, 2H), 3.06(d, J=6.2 Hz, 2H), 2.35 (s, 3H).

[0931]

[0932] Preparation Example 72-5: Preparation of (7-methyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 72)

[0933]

[0934] 7-methyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (66.3 mg, 0.22 mmol) was dissolved in dimethylformamide under nitrogen. Benzoic acid (32.4 mg, 0.27 mmol), EDCI (169.54 mg, 0.88 mmol), and DIPEA (0.15 mL, 0.88 mmol) were added. The reaction mixture was stirred at room temperature for 15 hours. Upon completion of the reaction, extraction was performed using distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 50.9 mg of the title compound (yield 62%).

[0935] 1 H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 8.57 (d, J = 23.6 Hz, 2H), 7.77 (d, J = 35.1 Hz, 1H), 7.37 (d, J = 91.6 Hz, 9H), 4.79 (s, 1H), 4.59 (s, 1H), 4.04 (d, J = 7.1 Hz, 1H), 3.66 (s, 1H), 2.88 (s, 2H), 2.31 (s, 3H).

[0936]

[0937] Preparation Example 73: Preparation of (7-methyl-8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 73)

[0938] Preparation Example 73-1: Preparation of tert-butyl 7-methyl-8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 73-2)

[0939]

[0940] Tert-butyl 8-bromo-7-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (100 mg, 0.27 mmol), pyridine-4-ylboronic acid (100.97 mg, 0.82 mmol), and Pd(PPh3)4 (51.82 mg, 0.014 mmol) were dissolved in a toluene:EtOH (1:1) solution. 1M Na2CO3 (0.68 mL, 0.68 mmol) was added. The reaction mixture was stirred at 100°C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was subjected to column chromatography to obtain 75.2 mg (yield 75%) of the title compound.

[0941] 1 H NMR (400 MHz, DMSO) δ 10.91 (s, 1H), 8.59 (d, J = 5.0 Hz, 2H), 7.40 (d, J = 5.2 Hz, 2H), 7.26 (d, J = 17.8 Hz, 2H), 4.52 (s, 2H), 3.71 (t, J = 5.7 Hz, 2H), 2.78 (d, J = 5.8 Hz, 2H), 2.33 (s, 3H), 1.43 (s, 9H).

[0942]

[0943] Preparation Example 73-2: Preparation of 7-methyl-8-(pyridine-4-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 73-3)

[0944]

[0945] tert-butyl 7-methyl-8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (75.2 mg, 0.21 mmol) was dissolved in a 1,4-dioxane solution. An HCl solution (4 M in dioxane) (1.035 mL, 4.14 mmol) was added. The mixture was stirred at room temperature for 3 hours. After the reaction was complete, the solution was removed under reduced pressure. The resulting solid was filtered through ethyl acetate to obtain 58 mg of the title compound (yield 93%).

[0946] 1 H NMR (400 MHz, DMSO) δ 11.36 (s, 1H), 9.37 (s, 1H), 8.88 (d, J = 5.9 Hz, 2H), 7.98 (d, J = 5.7 Hz, 2H), 7.58 (s, 1H), 7.37 (s, 1H), 4.31 (s, 2H), 3.41 (s, 2H), 3.06 (d, J = 6.4 Hz, 2H), 2.43 (s, 3H).

[0947]

[0948] Preparation Example 73-3: Preparation of (7-methyl-8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 73)

[0949]

[0950] 7-methyl-8-(pyridine-4-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (58 mg, 0.19 mmol) was dissolved in dimethylformamide under nitrogen. Benzoic acid (28.36 mg, 0.23 mmol), EDCI (148.38 mg, 0.77 mmol), and DIPEA (0.13 mL, 0.77 mmol) were added. The reaction mixture was stirred at room temperature for 17 hours. Upon completion of the reaction, extraction was performed using distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 13.3 mg of the title compound (yield 18%).

[0951] 1 H NMR (400 MHz, DMSO) δ 10.98 (s, 1H), 8.60 (s, 1H), 8.55 (s, 1H), 7.37 (d, J = 91.5 Hz, 9H), 4.79 (s, 1H), 4.59 (s, 1H), 4.02 (s, 1H), 3.66 (s, 1H), 2.88 (s, 2H), 2.34 (s, 3H).

[0952]

[0953] Preparation Example 74: Preparation of (8-(4-fluorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 74)

[0954] Preparation Example 74-1: Preparation of tert-butyl 8-(4-fluorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 74-1)

[0955]

[0956] 126 mg (yield 41%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.79 mmol), (4-fluorophenyl)boronic acid (330 mg, 2.37 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1M Na2CO3 (1.98 mL, 1.98 mmol) in the same manner as in Preparation Examples 1-3.

[0957] 1 H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 7.74 - 7.63 (m, 3H), 7.35 (q, J = 8.4 Hz, 2H), 7.25 (t, J = 8.6 Hz, 2H), 4.59 (s, 2H), 3.48 (s, 2H), 1.45 (s, 9H), 1.29 (s, 6H).

[0958]

[0959] Preparation Example 74-2: Preparation of 8-(4-fluorophenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 74-2)

[0960]

[0961] 88 mg (yield 83%) of the title compound was obtained using tert-butyl 8-(4-fluorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (126 mg, 0.32 mmol) and an HCl solution (4 M in dioxane) (1.6 mL, 6.4 mmol) in the same manner as in Preparation Examples 1-4.

[0962] 1H NMR (400 MHz, DMSO) δ 11.37 (s, 1H), 9.38 (s, 2H), 7.79 (s, 1H), 7.70 (dd, J = 8.3, 5.6 Hz, 2H), 7.41 (d, J = 2.8 Hz, 2H), 7.28 (t, J = 8.6 Hz, 2H), 4.33 (s, 2H), 3.31 (s, 2H), 1.44 (s, 6H).

[0963]

[0964] Preparation Example 74-3: Preparation of (8-(4-fluorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 74)

[0965]

[0966] 19 mg (yield 79%) of the title compound was obtained using 8-(4-fluorophenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), benzoic acid (11 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[0967] 1 H NMR (400 MHz, DMSO) δ 11.09 (d, J = 21.3 Hz, 1H), 7.68 (d, J = 46.1 Hz, 3H), 7.46 (dq, J = 9.8, 6.2, 4.7 Hz, 5H), 7.35 (d, J = 18.1 Hz, 2H), 7.21 (s, 2H), 4.89 (s, 1H), 4.60 (s, 1H), 3.82 (s, 1H), 3.48 (s, 1H), 1.38 (s, 3H), 1.19 (d, J = 4.6 Hz, 3H).

[0968]

[0969] Preparation Example 75: Preparation of (8-(4-fluorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(m-tolyl)methanone (Compound 75)

[0970]

[0971] 14 mg (yield 58%) of the title compound was obtained using 8-(4-fluorophenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 3-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[0972] 1 H NMR (400 MHz, DMSO) δ 11.08(d, J=20.1 Hz, 1H), 7.79-7.44(m, 3H), 7.36(d, J=10.4 Hz, 3H), 7.31-7.19(m, 5H), 4.87(s, 1H), 4.59(s, 1H), 3.80 (s, 1H), 3.47(s, 1H), 2.35(s, 3H), 1.37(s, 3H), 1.26-1.14(m, 3H).

[0973]

[0974] Preparation Example 76: Preparation of (4-chlorophenyl)(8-(4-fluorophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 76)

[0975]

[0976] 17 mg (yield 64%) of the title compound was obtained using 8-(4-fluorophenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 4-chlorobenzoic acid (14 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[0977] 1 H NMR (400 MHz, DMSO) δ 11.09 (d, J = 20.9 Hz, 1H), 7.69 (d, J = 38.4 Hz, 3H), 7.57 - 7.47 (m, 4H), 7.30 (d, J = 53.5 Hz, 4H), 4.88 (s, 1H), 4.60 (s, 1H), 3.81 (s, 1H), 3.46 (s, 1H), 1.43 - 1.33 (m, 3H), 1.20 (s, 3H).

[0978]

[0979] Preparation Example 77: Preparation of (8-(4-methoxyphenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 77)

[0980] Preparation Example 77-1: Preparation of tert-butyl 8-(4-methoxyphenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 77-1)

[0981]

[0982] 189 mg (yield 58%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.79 mmol), (4-methoxyphenyl)boronic acid (360 mg, 2.37 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1M Na2CO3 (1.98 mL, 1.98 mmol) in the same manner as in Preparation Examples 1-3.

[0983] 1 H NMR (400 MHz, DMSO) δ 10.96 (s, 1H), 7.60 (d, J = 7.8 Hz, 3H), 7.35 (d, J = 8.4 Hz, 1H), 7.31 (d, J = 8.4 Hz, 1H), 7.00 (d, J = 8.2 Hz, 2H), 4.59(s, 2H), 3.80(d, J=1.4 Hz, 3H), 3.48(s, 2H), 1.45(s, 9H), 1.28(s, 6H).

[0984]

[0985] Preparation Example 77-2: Preparation of 8-(4-methoxyphenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 77-2)

[0986]

[0987] 162 mg (yield 81%) of the title compound was obtained using tert-butyl 8-(4-methoxyphenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (189 mg, 0.46 mmol) and an HCl solution (4 M in dioxane) (2.3 mL, 9.2 mmol) in the same manner as in Preparation Examples 1-4.

[0988] 1H NMR (400 MHz, DMSO) δ 11.29 (s, 1H), 9.30 (s, 2H), 7.73 (s, 1H), 7.60 (d, J = 8.4 Hz, 2H), 7.43 - 7.34 (m, 2H), 7.01 (d, J = 8.3 Hz, 2H), 4.33 (s, 2H), 3.80 (s, 3H), 3.30 (s, 2H), 1.43 (s, 6H).

[0989]

[0990] Preparation Example 77-3: Preparation of (8-(4-methoxyphenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 77)

[0991]

[0992] 19 mg (yield 77%) of the title compound was obtained using 8-(4-methoxyphenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), benzoic acid (11 mg, 0.09 mmol), EDCI (44 mg, 0.23 mmol), and DIPEA (0.040 mL, 0.23 mmol) in the same manner as in Preparation Example 46.

[0993] 1 H NMR (400 MHz, DMSO) δ 11.03 (d, J = 22.5 Hz, 1H), 7.66 (d, J = 30.5 Hz, 2H), 7.46 (dd, J = 12.6, 3.2 Hz, 5H), 7.32 (d, J = 18.4 Hz, 3H), 6.98 (d, J = 17.9 Hz, 2H), 4.88 (s, 1H), 4.59 (s, 1H), 3.78 (s, 4H), 3.47 (s, 1H), 1.37 (s, 3H), 1.19 (d, J = 5.6 Hz, 3H).

[0994]

[0995] Preparation Example 78: Preparation of (8-(4-methoxyphenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(m-tolyl)methanone (Compound 78)

[0996]

[0997] 10 mg (yield 39%) of the title compound was obtained using 8-(4-methoxyphenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 3-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (44 mg, 0.23 mmol), and DIPEA (0.040 mL, 0.23 mmol) in the same manner as in Preparation Example 46.

[0998] 1 H NMR (400 MHz, DMSO) δ 11.04 (s, 1H), 7.70 (s, 1H), 7.62 (s, 1H), 7.53 (s, 1H), 7.35 (d, J = 7.2 Hz, 2H), 7.32 - 7.18 (m, 4H), 6.98 (s, 2H), 4.87 (s, 1H), 4.58 (s, 1H), 3.78 (s, 4H), 3.46 (s, 1H), 2.35 (s, 3H), 1.36 (s, 3H), 1.20 (s, 3H).

[0999]

[1000] Preparation Example 79: Preparation of (4-chlorophenyl)(8-(4-methoxyphenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 79)

[1001]

[1002] 18 mg (yield 66%) of the title compound was obtained using 8-(4-methoxyphenyl)-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 4-chlorobenzoic acid (14 mg, 0.09 mmol), EDCI (44 mg, 0.23 mmol), and DIPEA (0.040 mL, 0.23 mmol) in the same manner as in Preparation Example 46.

[1003] 1 H NMR (400 MHz, DMSO) δ 11.02 (d, J = 19.9 Hz, 1H), 7.77 - 7.41 (m, 7H), 7.34 (s, 2H), 6.98 (s, 2H), 4.88 (s, 1H), 4.60 (s, 1H), 3.79 (s, 4H), 3.42 (s, 1H), 1.44 - 1.28 (m, 3H), 1.20 (s, 3H).

[1004]

[1005] Preparation Example 80: Preparation of (4,4-dimethyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 80)

[1006] Preparation Example 80-1: Preparation of tert-butyl 4,4-dimethyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 80-1)

[1007]

[1008] 150 mg (yield 60%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (250 mg, 0.66 mmol), pyridine-3-ylboronic acid (243 mg, 1.98 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1M Na2CO3 (1.65 mL, 1.65 mmol) in the same manner as in Preparation Examples 1-3.

[1009] 1 H NMR (400 MHz, DMSO) δ 11.10 (s, 1H), 8.92 (d, J = 2.4 Hz, 1H), 8.50 (dd, J = 4.8, 1.6 Hz, 1H), 8.08 (dt, J = 8.2, 1.9 Hz, 1H), 7.77 (s, 1H), 7.48 - 7.40 (m, 3H), 4.61 (s, 2H), 3.49 (s, 2H), 1.46 (s, 9H), 1.29 (s, 6H).

[1010]

[1011] Preparation Example 80-2: Preparation of 4,4-dimethyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 80-2)

[1012]

[1013] 101 mg (yield 83%) of the title compound was obtained using tert-butyl 4,4-dimethyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (150 mg, 0.39 mmol) and an HCl solution (4 M in dioxane) (1.95 mL, 7.8 mmol) in the same manner as in Preparation Examples 1-4.

[1014] 1 H NMR (400 MHz, DMSO) δ 11.62(s, 1H), 9.49(s, 2H), 9.19(s, 1H), 8.75(t, J=6.8 Hz, 2H), 8.09(s, 1H), 8.03-7.95(m, 1H), 7.62 (d, J=8.5 Hz, 1H), 7.53(d, J=8.5 Hz, 1H), 4.33(d, J=4.8 Hz, 2H), 3.32(s, 2H), 1.45(s, 6H).

[1015]

[1016] Preparation Example 80-3: Preparation of (4,4-dimethyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 80)

[1017]

[1018] 10 mg (yield 43%) of the title compound was obtained using 4,4-dimethyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), benzoic acid (12 mg, 0.10 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.043 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1019] 1 H NMR (400 MHz, DMSO) δ 11.16 (d, J = 20.0 Hz, 1H), 8.89 (d, J = 41.1 Hz, 1H), 8.48 (s, 1H), 8.06 (d, J = 41.1 Hz, 1H), 7.74 (d, J = 115.9 Hz, 1H), 7.51 - 7.39 (m, 8H), 4.91 (s, 1H), 4.62 (s, 1H), 3.82 (s, 1H), 3.48 (s, 1H), 1.38 (s, 3H), 1.20 (s, 3H).

[1020]

[1021] Preparation Example 81: Preparation of (4,4-dimethyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(m-tolyl)methanone (Compound 81)

[1022]

[1023] 12 mg (yield 50%) of the title compound was obtained using 4,4-dimethyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 3-methylbenzoic acid (13 mg, 0.10 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1024] 1 H NMR (400 MHz, DMSO) δ 11.15 (d, J = 18.7 Hz, 1H), 8.89 (d, J = 39.1 Hz, 1H), 8.48 (s, 1H), 8.06 (d, J = 38.1 Hz, 1H), 7.74 (d, J = 112.7 Hz, 1H), 7.47 - 7.20 (m, 7H), 4.89 (s, 1H), 4.61 (s, 1H), 3.81 (s, 1H), 3.47 (s, 1H), 2.35 (s, 3H), 1.38 (s, 3H), 1.21 (s, 3H).

[1025]

[1026] Preparation Example 82: Preparation of (4-chlorophenyl)(4,4-dimethyl-8-(pyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 82)

[1027]

[1028] 15 mg (yield 60%) of the title compound was obtained using 4,4-dimethyl-8-(pyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 4-chlorobenzoic acid (15 mg, 0.10 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1029] 1H NMR (400 MHz, DMSO) δ 11.15 (d, J = 17.7 Hz, 1H), 8.90 (d, J = 32.8 Hz, 1H), 8.49 (s, 1H), 8.06 (d, J = 33.5 Hz, 1H), 7.77 (d, J = 89.4 Hz, 1H), 7.58 - 7.39 (m, 7H), 4.90 (s, 1H), 4.63 (s, 1H), 3.81 (s, 1H), 3.48 (s, 1H), 1.38 (s, 3H), 1.21 (s, 3H).

[1030]

[1031] Preparation Example 83: Preparation of (4,4-dimethyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 83)

[1032] Preparation Example 83-1: Preparation of tert-butyl 4,4-dimethyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 83-1)

[1033]

[1034] 155 mg (yield 75%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.53 mmol), m-tolylboronic acid (216 mg, 1.59 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1M Na2CO3 (1.33 mL, 1.33 mmol) in the same manner as in Preparation Examples 1-3.

[1035] 1H NMR (400 MHz, DMSO) δ 11.00 (s, 1H), 7.65 (s, 1H), 7.52 - 7.42 (m, 2H), 7.41 - 7.27 (m, 3H), 7.11 (d, J = 7.5 Hz, 1H), 4.59 (s, 2H), 3.48 (s, 2H), 2.39 (s, 3H), 1.45 (s, 9H), 1.29 (s, 6H).

[1036]

[1037] Preparation Example 83-2: Preparation of 4,4-dimethyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Compound 83-2)

[1038]

[1039] 107 mg (yield 82%) of the title compound was obtained using tert-butyl 4,4-dimethyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (155 mg, 0.40 mmol) and an HCl solution (4 M in dioxane) (2.0 mL, 8.0 mmol) in the same manner as in Preparation Examples 1-4.

[1040] 1 H NMR (400 MHz, DMSO) δ 11.34 (s, 1H), 9.25 (s, 2H), 7.79 (s, 1H), 7.51 - 7.42 (m, 4H), 7.33 (t, J = 7.6 Hz, 1H), 7.13 (d, J = 7.5 Hz, 1H), 4.34 (s, 2H), 3.33 (s, 2H), 2.39 (s, 3H), 1.44 (s, 6H).

[1041]

[1042] Preparation Example 83-3: Preparation of (4,4-dimethyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 83)

[1043]

[1044] 11 mg (yield 47%) of the title compound was obtained using 4,4-dimethyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), benzoic acid (11 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1045] 1 H NMR (400 MHz, DMSO) δ 11.06 (d, J = 21.3 Hz, 1H), 7.79 - 7.25 (m, 11H), 7.09 (s, 1H), 4.90 (s, 1H), 4.61 (s, 1H), 3.82 (s, 1H), 3.48 (s, 1H), 2.37 (d, J = 14.8 Hz, 3H), 1.38 (s, 3H), 1.20 (s, 3H).

[1046]

[1047] Preparation Example 84: Preparation of (4,4-dimethyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(m-tolyl)methanone (Compound 84)

[1048]

[1049] 13 mg (yield 54%) of the title compound was obtained using 4,4-dimethyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 3-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1050] 1H NMR (400 MHz, DMSO) δ 11.06 (d, J = 22.1 Hz, 1H), 7.81 - 7.05 (m, 11H), 4.88 (s, 1H), 4.60 (s, 1H), 3.81 (s, 1H), 3.47 (s, 1H), 2.36 (s, 6H), 1.38 (s, 3H), 1.21 (s, 3H).

[1051]

[1052] Preparation Example 85: Preparation of (4-chlorophenyl)(4,4-dimethyl-8-(m-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 85)

[1053]

[1054] 14 mg (yield 54%) of the title compound was obtained using 4,4-dimethyl-8-(m-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), 4-chlorobenzoic acid (14 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1055] 1 H NMR (400 MHz, DMSO) δ 11.07(d, J=21.9 Hz, 1H), 7.81-7.05(m, 11H), 4.89(s, 1H), 4.62(s, 1H), 3.81(s, 1H), 3.47(s, 1H), 2.37(s, 3H), 1.37(s, 3H), 1.20(s, 3H).

[1056]

[1057] Preparation Example 86: Preparation of 3-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 86)

[1058] Preparation Example 86-1: Preparation of tert-butyl 8-(3-cyanophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Compound 86-1)

[1059]

[1060] 171 mg (yield 65%) of the title compound was obtained using tert-butyl 8-bromo-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (250 mg, 0.66 mmol), (3-cyanophenyl)boronic acid (291 mg, 1.98 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1M Na2CO3 (1.65 mL, 1.65 mmol) in the same manner as in Preparation Examples 1-3.

[1061] 1 H NMR (400 MHz, DMSO) δ 11.10 (s, 1H), 8.18 (s, 1H), 8.05 (d, J = 7.9 Hz, 1H), 7.85 (s, 1H), 7.74 (d, J = 7.6 Hz, 1H), 7.68 - 7.60 (m, 1H), 7.49 - 7.37 (m, 2H), 4.61 (s, 2H), 3.49 (s, 2H), 1.46 (s, 9H), 1.29 (s, 6H).

[1062]

[1063] Preparation Example 86-2: Preparation of 3-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (Compound 86-2)

[1064]

[1065] 126 mg (yield 91%) of the title compound was obtained using tert-butyl 8-(3-cyanophenyl)-4,4-dimethyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (171 mg, 0.43 mmol) and an HCl solution (4 M in dioxane) (2.2 mL, 8.6 mmol) in the same manner as in Preparation Examples 1-4.

[1066] 1 H NMR (400 MHz, DMSO) δ 11.45(s, 1H), 9.24(s, 2H), 8.16(d, J=1.8 Hz, 1H), 8.05(dt, J=8.2, 1.4 Hz, 1H), 7.95(d, J=1.8 Hz, 1H), 7.76(dt, J=7.7, 1.3 Hz, 1H), 7.66(t, J=7.7 Hz, 1H), 7.53(dd, J=8.5, 1.8 Hz, 1H), 7.46(d, J=8.5 Hz, 1H), 4.38-4.31(m, 2H), 3.33(s, 2H), 1.44(s, 6H).

[1067]

[1068] Preparation Example 86-3: Preparation of 3-(2-benzoyl-4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 86)

[1069]

[1070] 11 mg (yield 44%) of the title compound was obtained using 3-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), benzoic acid (11 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1071] 1H NMR (400 MHz, DMSO) δ 11.19 (s, 1H), 8.25 - 7.95 (m, 3H), 7.69 (d, J = 31.8 Hz, 3H), 7.47 (d, J = 9.8 Hz, 6H), 4.91 (s, 1H), 4.63 (s, 1H), 3.83 (s, 1H), 3.48 (s, 1H), 1.38 (s, 3H), 1.20 (s, 3H).

[1072]

[1073] Preparation Example 87: Preparation of 3-(4,4-dimethyl-2-(3-methylbenzoyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 87)

[1074]

[1075] 10 mg (yield 41%) of the title compound was obtained using 3-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), 3-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1076] 1 H NMR (400 MHz, DMSO) δ 11.16(d, J=17.7 Hz, 1H), 8.09(s, 3H), 7.69(d, J=31.5 Hz, 3H), 7.48 - 7.20(m, 5H), 4.89(s, 1H), 4.61(s, 1H), 3.81 (s, 1H), 3.63 (s, 1H), 2.36 (s, 3H), 1.38(s, 3H), 1.23(d, J=17.0 Hz, 3H).

[1077]

[1078] Preparation Example 88: Preparation of 4-(3-methyl-2-(1-methyl-1H-imidazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 88)

[1079]

[1080] 20 mg (yield 82%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 1-methyl-1H-imidazole-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1081] 1 H NMR (400 MHz, DMSO) δ 11.16(s, 1H), 8.02-7.84(m, 5H), 7.80(s, 1H), 7.45(q, J=8.6 Hz, 2H), 7.39 (s, 1H), 5.30(s, 1H), 5.04(s, 1H), 4.39(s, 1H), 3.71(s, 3H), 3.27(s, 1H), 2.68(d, J=16.4 Hz, 1H), 1.27(d, J=6.8 Hz, 3H).

[1082]

[1083] Preparation Example 89: Preparation of 4-(3-methyl-2-(1-methyl-1H-pyrazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 89)

[1084]

[1085] 10 mg (yield 41%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 1-methyl-1H-pyrazole-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1086] 1H NMR (400 MHz, DMSO) δ 11.17 (s, 1H), 7.92 (d, J = 25.2 Hz, 5H), 7.53 (d, J = 1.9 Hz, 1H), 7.46 (d, J = 11.7 Hz, 2H), 6.60 (d, J = 2.0 Hz, 1H), 5.41 (d, J = 50.5 Hz, 1H), 4.57 (s, 1H), 4.27 (s, 1H), 3.86 (s, 3H), 3.24 (s, 1H), 2.68 (s, 1H), 1.27 (d, J = 6.8 Hz, 3H).

[1087]

[1088] Preparation Example 90: Preparation of phenyl(9-(p-tolyl)-3,4,5,6-tetrahydroazefino[4,3-b]indole-2(1H)-yl)methanone (Compound 90)

[1089] Preparation Example 90-1: Preparation of 3-(2-(4-bromophenyl)hydrazinyl)cyclohex-2-en-1-one (Compound 90-2)

[1090]

[1091] (4-Bromophenyl)hydrazine hydrochloride (10 g, 44.74 mmol) was dissolved in distilled water, and then cyclohexane-1,3-dione (5.017 g, 44.74 mmol) and sodium acetate (3.67 g, 44.74 mmol) were added. The reaction mixture was stirred at room temperature for 1.5 hours. After the reaction was completed, the mixture was filtered with distilled water to obtain 10.0775 g (yield 80%) of the title compound.

[1092] 1 H NMR (400 MHz, DMSO) δ 8.74 (s, 1H), 8.00 (s, 1H), 7.31 - 7.28 (m, 2H), 6.63 (d, J = 8.9 Hz, 2H), 4.95 (s, 1H), 2.37 (t, J = 6.1 Hz, 2H), 2.10 (t, J = 6.4 Hz, 2H), 1.84 (q, J = 6.2 Hz, 2H).

[1093]

[1094] Preparation Example 90-2: Preparation of 6-Bromo-1,2,3,9-Tetrahydro-4H-Carbazole-4-one (Compound 90-3)

[1095]

[1096] 3-(2-(4-bromophenyl)hydrazinyl)cyclohex-2-en-1-one (2.8 g, 9.96 mmol) was dissolved in TFA. The reaction mixture was stirred at 90 °C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was analyzed by column chromatography to obtain 266.4 mg of the title compound (yield 10%).

[1097] 1 H NMR (400 MHz, DMSO) δ 12.06 (s, 1H), 8.05 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 8.5 Hz, 1H), 7.31 (dd, J = 8.5, 2.0 Hz, 1H), 2.97 (t, J = 6.2 Hz, 2H), 2.44 (dd, J = 7.1, 5.6 Hz, 2H), 2.13 (p, J = 6.4 Hz, 2H).

[1098]

[1099] Preparation Example 90-3: Preparation of 6-Bromo-1,2,3,9-Tetrahydro-4H-Carbazole-4-Onoxime (Compound 90-4)

[1100]

[1101] 6-bromo-1,2,3,9-tetrahydro-4H-carbazole-4-one (685 mg, 2.59 mmol), sodium acetate (1.28 g, 15.56 mmol), and hydroxylamine hydrochloride (1.081 g, 15.56 mmol) were dissolved in a distilled water:ethanol (1:1) solution. The reaction mixture was stirred at 80 °C for 18 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was analyzed by column chromatography to obtain 312.4 mg (yield 43%) of the title compound.

[1102] 1 H NMR (400 MHz, DMSO) δ 11.43 (s, 1H), 10.34 (s, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.28 (d, J = 8.5 Hz, 1H), 7.18 (dd, J = 8.5, 2.1 Hz, 1H), 2.79 (t, J = 6.1 Hz, 2H), 2.69 - 2.62 (m, 2H), 1.90 (p, J = 6.2 Hz, 2H).

[1103]

[1104] Preparation Example 90-4: Preparation of 9-bromo-3,4,5,6-tetrahydroazefino[4,3-b]indole-1(2H)-one (Compound 90-5)

[1105]

[1106] 6-Bromo-1,2,3,9-tetrahydro-4H-carbazole-4-onoxime (250 mg, 0.9 mmol) was dissolved in PPA. The reaction mixture was stirred at 80 °C for 18 hours. After the reaction was completed, the mixture was filtered with distilled water to obtain 205 mg (yield 82%) of the title compound.

[1107] 1H NMR (400 MHz, DMSO) δ 11.66 (s, 1H), 8.36 (s, 1H), 7.50 (s, 1H), 7.27 (d, J = 8.4 Hz, 1H), 7.22 (d, J = 8.8 Hz, 1H), 3.22 (s, 2H), 3.12 (d, J = 6.9 Hz, 2H), 2.00 (s, 2H).

[1108]

[1109] Preparation Example 90-5: Preparation of 9-(p-tolyl)-3,4,5,6-tetrahydroazefino[4,3-b]indole-1(2H)-one (Compound 90-6)

[1110]

[1111] 9-bromo-3,4,5,6-tetrahydroazepino[4,3-b]indole-1(2H)-one (205 mg, 0.73 mmol), p-tolylboronic acid (599.094 mg, 4.41 mmol), and Pd(PPh3)4 (42.43 mg, 0.037 mmol) were dissolved in a toluene:EtOH (1:1) solution. 1 M Na2CO3 (1.84 mL, 1.84 mmol) was added. The reaction mixture was stirred at 100°C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and 115 mg of the title compound (yield 53%) was obtained from the concentrate via column chromatography.

[1112] 1H NMR (400 MHz, DMSO) δ 11.48 (s, 1H), 8.44 (d, J = 1.4 Hz, 1H), 7.54 - 7.47 (m, 2H), 7.41 (t, J = 5.2 Hz, 1H), 7.39 - 7.31 (m, 2H), 7.25 (d, J = 7.9 Hz, 2H), 3.22 (dt, J = 5.7, 3.0 Hz, 2H), 3.12 (t, J = 6.7 Hz, 2H), 2.33 (s, 3H), 2.01 (q, J = 7.3 Hz, 2H).

[1113]

[1114] Preparation Example 90-6: Preparation of 9-(p-tolyl)-1,2,3,4,5,6-hexahydroazefino[4,3-b]indole (Compound 90-7)

[1115]

[1116] 9-(p-tolyl)-3,4,5,6-tetrahydroazefino[4,3-b]indole-1(2H)-one (100 mg, 0.34 mmol) and a borane / THF mixture (1 M THF) (2.066 mL, 2.066 mmol) were dissolved in THF. The reaction mixture was stirred at 50 °C for 18 hours using a sealed tube. The reaction was terminated with methanol and Tris. By filtration with ether, 26.2 mg of the title compound (yield 27%) was obtained.

[1117] 1 H NMR (400 MHz, DMSO) δ 10.79 (s, 1H), 7.61-7.53(m, 3H), 7.46-7.35 (m, 2H), 7.27(d, J=6.0 Hz, 2H), 7.16 (d, J=8.2 Hz, 1H), 3.94(s, 2H), 3.07 (t, J=5.2 Hz, 2H), 2.89(t, J=5.8 Hz, 2H), 2.34(s, 3H), 1.80-1.74 (m, 2H).

[1118]

[1119] Preparation Example 90-7: Preparation of phenyl(9-(p-tolyl)-3,4,5,6-tetrahydroazefino[4,3-b]indole-2(1H)-yl)methanone (Compound 90)

[1120]

[1121] 9-(p-tolyl)-1,2,3,4,5,6-hexahydroazepino[4,3-b]indole (26.2 mg, 0.095 mmol) was dissolved in dimethylformamide under nitrogen. Benzoic acid (13.9 mg, 0.11 mmol), EDCI (72.69 mg, 0.38 mmol), and DIPEA (0.066 mL, 0.38 mmol) were added. The reaction mixture was stirred at room temperature for 15 hours. Upon completion of the reaction, extraction was performed using distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 5.3 mg (yield 14%) of the title compound.

[1122] 1 H NMR (400 MHz, DMSO) δ 11.03(d, J=27.1 Hz, 1H), 7.58(d, J=7.7 Hz, 1H), 7.47-7.22(m, 11H), 4.89(s, 1H), 4.59(s, 1H), 3.95(s, 1H), 3.68(s, 1H), 3.02(s, 1H), 2.95(s, 1H), 2.33(s, 3H), 2.00(s, 1H), 1.84(s, 1H).

[1123]

[1124] Preparation Example 91: Preparation of 4-(2-(isothiazol-5-carbonyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 91)

[1125]

[1126] 8 mg (yield 32%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), isothiazol-5-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1127] 1H NMR (400 MHz, DMSO) δ 11.19(s, 1H), 8.68(s, 1H), 8.02-7.74 (m, 6H), 7.45(t, J=10.1 Hz, 2H), 5.47(s, 1H), 4.83(d, J=76.1 Hz, 1H), 4.39(d, J = 77.4 Hz, 1H), 3.24(s, 1H), 2.68(d, J=0.3 Hz, 1H), 1.28(d, J=6.4 Hz, 3H).

[1128]

[1129] Preparation Example 92: Preparation of 4-(3-methyl-2-(1-methyl-1H-pyrazole-3-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 92)

[1130]

[1131] 13 mg (yield 53%) of the above-described compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 1-methyl-1H-pyrazole-3-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1132] 1H NMR (400 MHz, DMSO) δ 11.14(s, 1H), 7.98-7.77(m, 6H), 7.45(d, J=11.6 Hz, 2H), 6.58(s, 1H), 5.45(d, J=16.6 Hz, 2H), 4.20(d, J=16.9 Hz, 1H), 3.93(s, 3H), 3.16 (s, 1H), 2.67 (d, J=15.7 Hz, 1H), 1.24(d, J=6.0 Hz, 3H).

[1133]

[1134] Preparation Example 93: Preparation of 4-(3-methyl-2-(1H-pyrazole-4-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 93)

[1135]

[1136] 6 mg (yield 20%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.093 mmol), 1-(((9H-fluorene-9-yl)methoxy)carbonyl)-1H-pyrazole-4-carboxylic acid (26 mg, 0.078 mmol), EDCI (60 mg, 0.31 mmol), and DIPEA (0.032 mL, 0.19 mmol) in the same manner as in Preparation Example 46.

[1137] 1H NMR (400 MHz, DMSO) δ 13.23 (s, 1H), 11.12 (s, 1H), 8.18 (s, 1H), 7.97 - 7.83 (m, 6H), 7.48 - 7.40 (m, 2H), 5.02 (d, J = 185.6 Hz, 3H), 3.23 (s, 1H), 2.66 (d, J = 16.1 Hz, 1H), 1.22 (d, J = 6.8 Hz, 3H).

[1138]

[1139] Preparation Example 94: Preparation of 4-(3-methyl-2-(1-methyl-1H-pyrazole-4-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 94)

[1140]

[1141] 13 mg (yield 53%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 1-methyl-1H-pyrazole-4-carboxylic acid (12 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1142] 1H NMR (400 MHz, DMSO) δ 11.14(s, 1H), 8.16(s, 1H), 8.01-7.83(m, 5H), 7.78(s, 1H), 7.50-7.36 (m, 2H), 5.27(d, J = 18.0 Hz, 3H), 3.90(s, 3H), 3.20 (d, J = 33.2 Hz, 1H), 2.66(d, J = 16.1 Hz, 1H), 1.22(d, J = 6.7 Hz, 3H).

[1143]

[1144] Preparation Example 95: Preparation of 4-(3-methyl-2-(2-methylthiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 95)

[1145]

[1146] 14 mg (yield 55%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), 2-methylthiazole-5-carboxylic acid (13 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.044 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1147] 1H NMR (400 MHz, DMSO) δ 11.17 (s, 1H), 8.07 (s, 1H), 7.91 (dd, J = 24.3, 7.2 Hz, 4H), 7.53 - 7.38 (m, 2H), 5.28 (d, J = 14.8 Hz, 3H), 3.16 (s, 1H), 2.69 (d, J = 16.6 Hz, 4H), 1.27 (d, J = 6.4 Hz, 3H).

[1148]

[1149] Preparation Example 96: Preparation of 4-(3-methyl-2-(1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 96)

[1150] Preparation Example 96-1: Preparation of 4-nitrophenyl 8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 96-2)

[1151]

[1152] 23 mg (yield 55%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.093 mmol), 4-nitrophenyl carbonochloridate (28 mg, 0.14 mmol), and TEA (0.052 mL, 0.37 mmol) in the same manner as in Preparation Example 22.

[1153] 1H NMR (400 MHz, DMSO) δ 11.19(s, 1H), 8.31(d, J=9.1 Hz, 2H), 7.91 (dd, J=26.7, 8.5 Hz, 5H), 7.55-7.41(m, 4H), 5.16(d, J=69.8 Hz, 1H), 4.94 (d, J=47.9 Hz, 1H), 4.57(s, 1H), 3.21(s, 1H), 2.71(d, J=16.0 Hz, 1H), 1.28(d, J = 21.9 Hz, 3H).

[1154]

[1155] Preparation Example 96-2: Preparation of 4-(3-methyl-2-(1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 96)

[1156]

[1157] 4-nitrophenyl 8-(4-cyanophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (23 mg, 0.051 mmol) was dissolved in dimethylformamide. 1,2,3,4-tetrahydroisoquinoline (0.013 mL, 0.10 mmol) and TEA (0.028 mL, 0.20 mmol) were added. The reaction mixture was stirred at 70 °C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 3 mg (yield 13%) of the title compound.

[1158] 1H NMR (400 MHz, DMSO) δ 11.08 (s, 1H), 7.95-7.82 (m, 5H), 7.42 (d, J = 8.8 Hz, 2H), 7.17 (s, 4H), 4.60-4.35 (m, 5H), 3.63 (s, 1H), 3.50(s, 1H), 3.23(s, 1H), 2.99(s, 1H), 2.83(s, 1H), 2.60(s, 1H), 1.18(d, J = 6.7 Hz, 3H).

[1159]

[1160] Preparation Example 97: Preparation of 4-(2-(benzo[d]thiazole-2-carbonyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 97)

[1161]

[1162] 4 mg (yield 14%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), benzo[d]thiazole-2-carboxylic acid (17 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.032 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1163] 1H NMR (400 MHz, DMSO) δ 11.21 (s, 1H), 8.22 (d, J = 8.4 Hz, 2H), 8.00-7.80 (m, 5H), 7.63 (s, 2H), 7.48 (d, J = 13.1 Hz, 2H), 6.04-5.87(m, 1H), 5.55-5.38(m, 1H), 4.40(d, J=16.3 Hz, 1H), 3.23(s, 1H), 2.76(d, J=16.9 Hz, 1H), 1.35(s, 3H).

[1164]

[1165] Preparation Example 98: Preparation of 4-(2-(imidazo[1,2-a]pyridine-2-carbonyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 98)

[1166]

[1167] 10 mg (yield 37%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), imidazo[1,2-a]pyridine-2-carboxylic acid (15 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.032 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1168] 1H NMR (400 MHz, DMSO) δ 11.15(s, 1H), 8.58(s, 1H), 8.37(s, 1H), 8.01-7.79(m, 5H), 7.67(d, J=9.0 Hz, 1H), 7.50-7.33(m, 3H), 7.00(s, 1H), 5.84(s, 1H), 5.52-5.34(m, 1H), 4.25(d, J=17.4 Hz, 1H), 3.18(s, 1H), 2.69(d, J=16.5 Hz, 1H), 1.27(s, 3H).

[1169]

[1170] Preparation Example 99: Preparation of 4-(3-ethyl-2-(oxazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 99)

[1171]

[1172] 18 mg (yield 76%) of the title compound was obtained using 4-(3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), oxazole-5-carboxylic acid (10 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1173] 1H NMR (400 MHz, DMSO) δ 11.15(s, 1H), 8.60(s, 1H), 8.04-7.73(m, 6H), 7.45(q, J=8.4 Hz, 2H), 5.38-5.10(m, 1H), 4.72-4.47(m, 1H), 4.33-4.02(m, 1H), 3.10(s, 1H), 2.78(d, J=16.6 Hz, 1H), 1.63(d, J=45.6 Hz, 2H), 0.87(d, J=33.3 Hz, 3H).

[1174]

[1175] Preparation Example 100: Preparation of 4-(3-ethyl-2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 100)

[1176]

[1177] 15 mg (yield 61%) of the title compound was obtained using 4-(3-ethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.06 mmol), thiazole-5-carboxylic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1178] 1H NMR (400 MHz, DMSO) δ 11.16 (s, 1H), 9.29 (s, 1H), 8.37 (d, J = 59.1 Hz, 1H), 7.91 (d, J = 21.4 Hz, 5H), 7.45 (d, J = 11.0 Hz, 2H), 5.23(d, J = 109.9 Hz, 1H), 4.79 - 4.18(m, 2H), 3.13(s, 1H), 2.75(d, J = 16.1 Hz, 1H), 1.71(dt, J = 16.8, 7.3 Hz, 1H), 1.53(s, 1H), 0.88(d, J = 53.5 Hz, 3H).

[1179]

[1180] Preparation Example 101: Preparation of 4-(4,4-dimethyl-2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 101)

[1181]

[1182] 8 mg (yield 33%) of the title compound was obtained using 4-(4,4-dimethyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.059 mmol), thiazole-5-carboxylic acid (11 mg, 0.089 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1183] 1 H NMR (400 MHz, DMSO) δ 11.23(s, 1H), 9.29(s, 1H), 8.43(s, 1H), 7.97 - 7.84(m, 5H), 7.52 - 7.40(m, 2H), 4.95(s, 2H), 3.79(s, 2H), 1.33(s, 6H).

[1184]

[1185] Preparation Example 102: Preparation of (S)-4-(3-methyl-2-(oxazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 102)

[1186]

[1187] 10 mg (yield 42%) of the title compound was obtained using (S)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), oxazole-5-carboxylic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.032 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1188] 1H NMR (400 MHz, DMSO) δ 11.18(s, 1H), 8.61(s, 1H), 7.98-7.85 (m, 6H), 7.50-7.42 (m, 2H), 5.33(s, 1H), 4.80(s, 1H), 4.30(s, 1H), 3.23(d, J = 8.9 Hz, 1H), 2.71(d, J = 16.2 Hz, 1H), 1.27(d, J = 6.2 Hz, 3H).

[1189]

[1190] Preparation Example 103: Preparation of (R)-4-(3-methyl-2-(oxazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 103)

[1191]

[1192] 12 mg (yield 51%) of the title compound was obtained using (R)-4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.062 mmol), oxazole-5-carboxylic acid (11 mg, 0.093 mmol), EDCI (48 mg, 0.25 mmol), and DIPEA (0.032 mL, 0.25 mmol) in the same manner as in Preparation Example 46.

[1193] 1H NMR (400 MHz, DMSO) δ 11.18 (s, 1H), 8.61 (s, 1H), 7.99 - 7.87 (m, 6H), 7.50 - 7.40 (m, 2H), 5.28 (s, 1H), 4.83 (s, 1H), 4.25 (s, 1H), 3.17 (s, 1H), 2.72 (d, J = 16.9 Hz, 1H), 1.27 (s, 3H).

[1194]

[1195] Preparation Example 104: Preparation of 4-(3-methyl-2-(morpholine-4-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 104)

[1196]

[1197] 14 mg (yield 38%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.093 mmol), morpholine-4-carbonyl chloride (0.016 mL, 0.14 mmol), and TEA (0.052 mL, 0.37 mmol) in the same manner as in Preparation Example 22.

[1198] 1H NMR (400 MHz, Chloroform) δ 7.96 (s, 1H), 7.78 - 7.68 (m, 4H), 7.65 (s, 1H), 7.41 (s, 2H), 4.63 (d, J = 15.8 Hz, 1H), 4.57 - 4.49 (m, 1H), 4.42 (d, J = 15.3 Hz, 1H), 3.73 (dtq, J = 14.4, 6.4, 3.1 Hz, 4H), 3.41 - 3.23 (m, 5H), 2.56 (d, J = 16.0 Hz, 1H), 1.27 (d, J = 7.0 Hz, 3H).

[1199]

[1200] Preparation Example 105: Preparation of (3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(thiazole-5-yl)methanone (Compound 105)

[1201]

[1202] 13 mg (yield 52%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), thiazole-5-carboxylic acid (12 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1203] 1H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 9.28 (s, 1H), 8.36 (s, 1H), 7.75 (s, 1H), 7.59 (d, J = 7.5 Hz, 2H), 7.36 (s, 2H), 7.24 (d, J = 7.6 Hz, 2H), 5.05 (d, J = 225.2 Hz, 3H), 3.23 (s, 1H), 2.68 (d, J = 16.5 Hz, 1H), 2.34 (s, 3H), 1.28 (d, J = 6.6 Hz, 3H).

[1204]

[1205] Preparation Example 106: Preparation of (3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(oxazole-5-yl)methanone (Compound 106)

[1206]

[1207] 6 mg (yield 25%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), oxazole-5-carboxylic acid (11 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1208] 1H NMR (400 MHz, DMSO) δ 11.02(s, 1H), 8.61(s, 1H), 7.77(s, 2H), 7.59 (d, J=6.6 Hz, 2H), 7.36(s, 2H), 7.25(d, J=7.4 Hz, 2H), 5.08(d, J=170.2 Hz, 3H), 3.22(s, 1H), 2.70(d, J = 16.7 Hz, 1H), 2.34(s, 3H), 1.27(s, 3H).

[1209]

[1210] Preparation Example 107: Preparation of (8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(thiazole-5-yl)methanone (Compound 107)

[1211]

[1212] 13 mg (yield 53%) of the title compound was obtained using 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), thiazole-5-carboxylic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1213] 1H NMR (400 MHz, DMSO) δ 11.10 (s, 1H), 9.28 (s, 1H), 8.36 (s, 1H), 7.77 (d, J = 36.2 Hz, 3H), 7.47 (d, J = 7.4 Hz, 2H), 7.38 (s, 2H), 4.75 (s, 3H), 3.21 (s, 1H), 2.68 (d, J = 16.4 Hz, 1H), 1.27 (d, J = 5.8 Hz, 3H).

[1214]

[1215] Preparation Example 108: Preparation of (8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(oxazole-5-yl)methanone (Compound 108)

[1216]

[1217] 12 mg (yield 51%) of the title compound was obtained using 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), oxazole-5-carboxylic acid (10 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1218] 1H NMR (400 MHz, DMSO) δ 11.09 (s, 1H), 8.61 (s, 1H), 7.83 (s, 2H), 7.73 (d, J = 6.9 Hz, 2H), 7.48 (d, J = 8.4 Hz, 2H), 7.39 (s, 2H), 5.02 (d, J = 238.0 Hz, 3H), 3.18 (s, 1H), 2.70 (d, J = 16.0 Hz, 1H), 1.28 (s, 3H).

[1219]

[1220] Preparation Example 109: Preparation of (S)-(3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(thiazole-5-yl)methanone (Compound 109)

[1221]

[1222] 11 mg (yield 44%) of the title compound was obtained using (S)-3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), thiazole-5-carboxylic acid (12 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1223] 1H NMR (400 MHz, DMSO) δ 11.03(s, 1H), 9.28(s, 1H), 8.35(s, 1H), 7.75 (s, 1H), 7.59(d, J=7.0 Hz, 2H), 7.36(s, 2H), 7.24(d, J=7.2) Hz, 2H), 4.77(s, 3H), 3.21(s, 1H), 2.68(d, J=17.1 Hz, 1H), 2.34(s, 3H), 1.27(d, J=6.7 Hz, 3H).

[1224]

[1225] Preparation Example 110: Preparation of (S)-(3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(oxazole-5-yl)methanone (Compound 110)

[1226]

[1227] 23 mg (yield 97%) of the title compound was obtained using (S)-3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.064 mmol), oxazole-5-carboxylic acid (11 mg, 0.096 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1228] 1H NMR (400 MHz, DMSO) δ 11.03(s, 1H), 8.61(s, 1H), 7.83(s, 1H), 7.76(s, 1H), 7.59(d, J = 7.8 Hz, 2H), 7.36(s, 2H), 7.24(d, J = 8.0 Hz, 2H), 5.22 (d, J = 65.8 Hz, 1H), 4.90 - 4.65 (m, 1H), 4.28 (s, 1H), 3.16 (d, J = 6.7 Hz, 1H), 2.70 (d, J = 16.5 Hz, 1H), 2.34(s, 3H), 1.27(d, J = 5.8 Hz, 3H).

[1229]

[1230] Preparation Example 111: Preparation of (S)-(8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(thiazole-5-yl)methanone (Compound 111)

[1231]

[1232] 20 mg (yield 82%) of the title compound was obtained using (S)-8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), thiazole-5-carboxylic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1233] 1H NMR (400 MHz, DMSO) δ 11.09 (s, 1H), 9.28 (s, 1H), 8.36 (s, 1H), 7.77 (d, J = 36.0 Hz, 3H), 7.48 (d, J = 7.5 Hz, 2H), 7.39 (s, 2H), 5.34 (d, J = 6.0 Hz, 1H), 4.75 (s, 1H), 4.30 (s, 1H), 3.20 (s, 1H), 2.68 (d, J = 15.9 Hz, 1H), 1.27 (d, J = 6.0 Hz, 3H).

[1234]

[1235] Preparation Example 112: Preparation of (S)-(8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(oxazole-5-yl)methanone (Compound 112)

[1236]

[1237] 11 mg (yield 47%) of the title compound was obtained using (S)-8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.06 mmol), oxazole-5-carboxylic acid (10 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1238] 1H NMR (400 MHz, DMSO) δ 11.10(s, 1H), 8.61(s, 1H), 7.83(s, 2H), 7.73 (d, J=7.9 Hz, 2H), 7.48(d, J=8.4 Hz, 2H), 7.39(s, 2H), 5.30(s, 1H), 4.73(s, 1H), 4.29(s, 1H), 3.17(s, 1H), 2.70(d, J=16.7 Hz, 1H), 1.26(s, 3H).

[1239]

[1240] Preparation Example 113: Preparation of (3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(4-methylthiazole-5-yl)methanone (Compound 113)

[1241]

[1242] 15 mg (yield 39%) of the title compound was obtained using 3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), 4-methylthiazole-5-carboxylic acid (20 mg, 0.14 mmol), EDCI (73 mg, 0.38 mmol), and DIPEA (0.066 mL, 0.38 mmol) in the same manner as in Preparation Example 46.

[1243] 1H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 9.14 (s, 1H), 7.70 (s, 1H), 7.56 (s, 2H), 7.35 (s, 2H), 7.23 (d, J = 7.3 Hz, 2H), 4.37 (s, 3H), 3.12 (s, 1H), 2.66 (d, J = 16.4 Hz, 1H), 2.40 (s, 3H), 2.33 (s, 3H), 1.24 (s, 3H).

[1244]

[1245] Preparation Example 114: Preparation of (8-(4-chlorophenyl)-3-methyl-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(4-methylthiazole-5-yl)methanone (Compound 114)

[1246]

[1247] 14 mg (yield 37%) of the title compound was obtained using 8-(4-chlorophenyl)-3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.09 mmol), 4-methylthiazole-5-carboxylic acid (20 mg, 0.14 mmol), EDCI (69 mg, 0.36 mmol), and DIPEA (0.063 mL, 0.36 mmol) in the same manner as in Preparation Example 46.

[1248] 1H NMR (400 MHz, DMSO) δ 11.09 (s, 1H), 9.14 (s, 1H), 7.48 (s, 2H), 7.38 (s, 2H), 4.35 (s, 3H), 3.16 (s, 1H), 2.67 (d, J = 15.0 Hz, 1H), 2.40 (s, 3H), 1.24 (s, 3H).

[1249]

[1250] Preparation Example 115: Preparation of 4-(3-methyl-2-(4-methylthiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 115)

[1251]

[1252] 27 mg (yield 70%) of the title compound was obtained using 4-(3-methyl-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (30 mg, 0.093 mmol), 4-methylthiazole-5-carboxylic acid (20 mg, 0.14 mmol), EDCI (71 mg, 0.37 mmol), and DIPEA (0.064 mL, 0.37 mmol) in the same manner as in Preparation Example 46.

[1253] 1H NMR (400 MHz, DMSO) δ 11.18 (s, 1H), 9.14 (s, 1H), 7.90 (d, J = 13.9 Hz, 5H), 7.53 - 7.35 (m, 2H), 4.86 (d, J = 397.6 Hz, 3H), 3.15 (d, J = 14.3 Hz, 1H), 2.68 (d, J = 17.1 Hz, 1H), 2.40 (s, 3H), 1.24 (s, 3H).

[1254]

[1255] Preparation Example 116: Preparation of (R)-(3-methyl-8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(thiazole-5-yl)methanone (Compound 116)

[1256]

[1257] 7 mg (yield 19%) of the title compound was obtained using (R)-3-methyl-8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.096 mmol), thiazole-5-carboxylic acid (18 mg, 0.14 mmol), EDCI (73 mg, 0.38 mmol), and DIPEA (0.066 mL, 0.38 mmol) in the same manner as in Preparation Example 46.

[1258] 1H NMR (400 MHz, DMSO) δ 11.02 (s, 1H), 9.28 (s, 1H), 8.35 (s, 1H), 7.75 (s, 1H), 7.58 (d, J = 7.5 Hz, 2H), 7.36 (s, 2H), 7.24 (d, J = 7.7 Hz, 2H), 5.29 (s, 1H), 4.50 (d, J = 174.6 Hz, 2H), 3.21 (s, 1H), 2.67 (d, J = 16.1 Hz, 1H), 2.34 (s, 3H), 1.27 (d, J = 6.8 Hz, 3H).

[1259]

[1260] Preparation Example 117: Preparation of 4-(2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 117)

[1261] Preparation Example 117-1: Preparation of 8-Bromo-2,3,4,5-Tetrahydro-1H-Pyrido[4,3-b]indole (Intermediate 117-2)

[1262]

[1263] (4-bromophenyl)hydrazine hydrochloride (1.0 g, 4.48 mmol) and tert-butyl 4-oxopiperidine-1-carboxylate (936 mg, 4.70 mmol) were dissolved in a 1,4-dioxane solution. H2SO4 (0.56 ml, 8 M) was added while stirring the reaction mixture at 0°C. Using a sealed tube, the reaction mixture was stirred at 110°C for 3 hours. After the reaction was complete, the precipitate was filtered with 1,4-dioxane. The precipitate was dissolved in distilled water and based with a 1 normal sodium hydroxide aqueous solution. Extraction was performed using distilled water and dichloromethane, and the organic layer was dried with anhydrous magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure to obtain 390 mg of the title compound (yield 34%).

[1264] 1 H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 7.49 (d,J= 1.9 Hz, 1H), 7.23 (d,J= 8.5 Hz, 1H), 7.09 (dd,J= 8.5, 2.0 Hz, 1H), 3.81 (d,J= 1.7 Hz, 2H), 3.00 (t,J= 5.7 Hz, 2H), 2.70 - 2.63 (m, 2H).

[1265]

[1266] Preparation Example 117-2: Preparation of tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 117-3)

[1267]

[1268] 8-bromo-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole (390 mg, 1.55 mmol) was dissolved in a THF solution under nitrogen, and then Boc2O (0.393 ml, 1.71 mmol) was added. The reaction mixture was stirred at room temperature for 15 hours. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was analyzed by column chromatography to obtain 448 mg (yield 82%) of the title compound.

[1269] 1 H NMR (400 MHz, DMSO) δ 11.15 (s, 1H), 7.60 (d,J= 1.9 Hz, 1H), 7.26 (d,J= 8.5 Hz, 1H), 7.14 (dd,J= 8.6, 2.0 Hz, 1H), 4.51 (s, 2H), 3.70 (t,J= 5.7 Hz, 2H), 2.78 (t,J= 5.7 Hz, 2H), 1.44 (s, 9H).

[1270]

[1271] Preparation Example 117-3: Preparation of tert-butyl 8-(4-cyanophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 117-4)

[1272]

[1273] 153 mg (yield 50%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (250 mg, 0.71 mmol), (4-cyanophenyl)boronic acid (313 mg, 2.13 mmol), Pd(PPh3)4 (46 mg, 0.04 mmol), and 1M Na2CO3 (1.78 mL, 1.78 mmol) in the same manner as in Preparation Examples 1-3.

[1274] 1H NMR (400 MHz, DMSO) δ 11.11(s, 1H), 7.95-7.84(m, 5H), 7.47(d,J=8.5 Hz, 1H), 7.42(d,J=8.4 Hz, 1H), 4.61(s, 2H), 3.73(t,J=5.4) Hz, 2H), 2.80 (s, 2H), 1.46(s, 9H).

[1275]

[1276] Preparation Example 117-4: Preparation of 4-(2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (intermediate 117-5)

[1277]

[1278] 98 mg (yield 87%) of the title compound was obtained using tert-butyl 8-(4-cyanophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (153 mg, 0.36 mmol) and an HCl solution (4 M in dioxane) (1.8 mL, 7.20 mmol) in the same manner as in Preparation Examples 1-4.

[1279] 1 H NMR (400 MHz, DMSO) δ 11.35(s, 1H), 9.13(s, 2H), 7.93(d,J=12.4 Hz, 5H), 7.53(d,J=7.8 Hz, 1H), 7.47(d,J=8.9 Hz, 1H), 4.39(s, 2H), 3.51(s, 2H), 3.06(s, 2H).

[1280]

[1281] Preparation Example 117-5: Preparation of 4-(2-(thiazole-5-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 117)

[1282]

[1283] 22 mg (yield 88%) of the title compound was obtained using 4-(2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.065 mmol), thiazole-5-carboxylic acid (13 mg, 0.098 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1284] 1 H NMR (400 MHz, DMSO) δ 11.21(s, 1H), 9.29(s, 1H), 8.37(s, 1H), 8.03-7.77(m, 5H), 7.51-7.37(m, 2H), 4.89(s, 2H), 3.99(s, 2H), 2.99(s, 2H).

[1285]

[1286] Preparation Example 118: Preparation of 4-(2-(2-phenylacetyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 118)

[1287]

[1288] 21 mg (yield 82%) of the title compound was obtained using 4-(2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.065 mmol), 2-phenylacetic acid (13 mg, 0.098 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1289] 1 H NMR (400 MHz, DMSO) δ 11.09(d,J=27.8 Hz, 1H), 7.96-7.84(m, 5H), 7.53-7.11(m, 7H), 4.84(s, 1H), 4.74(s, 1H), 3.89(dd,J=16.4, 6.4 Hz, 4H), 2.74(d,J=46.0 Hz, 2H).

[1290]

[1291] Preparation Example 119: Preparation of 4-(2-(1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 119)

[1292] Preparation Example 119-1: Preparation of 4-nitrophenyl 8-(4-cyanophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 119-1)

[1293]

[1294] 50 mg (yield 71%) of the title compound was obtained using 4-(2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (50 mg, 0.16 mmol), 4-nitrophenyl carbonochloridate (48 mg, 0.24 mmol), and TEA (0.089 mL, 0.64 mmol) in the same manner as in Preparation Example 22.

[1295] 1 H NMR (400 MHz, DMSO) δ 11.21(s, 1H), 8.31(d,J=8.8 Hz, 2H), 7.95(d,J=7.6 Hz, 3H), 7.88(d,J=8.2 Hz, 2H), 7.50(d,J=8.3 Hz, 3H), 7.44 (d,J=8.5 Hz, 1H), 4.95(s, 1H), 4.77(s, 1H), 4.02(s, 1H), 3.90(s, 1H), 2.97 (d,J=22.9 Hz, 2H).

[1296]

[1297] Preparation Example 119-2: Preparation of 4-(2-(1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 119)

[1298]

[1299] 4-nitrophenyl 8-(4-cyanophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (38 mg, 0.087 mmol) was dissolved in dimethylformamide. 1,2,3,4-tetrahydroisoquinoline (0.016 mL, 0.13 mmol) and TEA (0.049 mL, 0.35 mmol) were added. The reaction mixture was stirred at 70°C for 15 hours using a sealed tube. After the reaction was complete, the mixture was extracted with distilled water and ethyl acetate, the organic layer was dried with anhydrous magnesium sulfate, and then filtered. The filtrate was concentrated under reduced pressure, and the concentrate was purified by column chromatography. The precipitate was then filtered with diethyl ether to obtain 19 mg (yield 50%) of the title compound.

[1300] 1 H NMR (400 MHz, DMSO) δ 11.12(s, 1H), 7.97 - 7.83(m, 5H), 7.49-7.37 (m, 2H), 7.17(s, 4H), 4.53(s, 2H), 4.45(s, 2H), 3.59(t,J=5.1 Hz, 2H), 3.50 (t,J=5.5 Hz, 2H), 2.91(s, 4H).

[1301]

[1302] Preparation Example 120: Preparation of 4-(2-(imidazo[1,2-a]pyridine-2-carbonyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile (Compound 120)

[1303]

[1304] 17 mg (yield 62%) of the title compound was obtained using 4-(2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole-8-yl)benzonitrile hydrochloride (20 mg, 0.065 mmol), imidazo[1,2-a]pyridine-2-carboxylic acid (16 mg, 0.10 mmol), EDCI (50 mg, 0.26 mmol), and DIPEA (0.045 mL, 0.26 mmol) in the same manner as in Preparation Example 46.

[1305] 1 H NMR (400 MHz, DMSO) δ 11.17(s, 1H), 8.59(s, 1H), 8.37(d,J=23.4 Hz, 1H), 7.96(s, 2H), 7.89(d,J=8.0 Hz, 3H), 7.67(d,J=9.1 Hz, 1H), 7.49-7.34(m, 3H), 7.00(s, 1H), 5.34(s, 1H), 4.91(s, 1H), 4.48(s, 1H), 4.05(s, 1H), 2.97(d,J=22.6 Hz, 2H).

[1306]

[1307] Preparation Example 121: Preparation of thiazole-5-yl(8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 121)

[1308] Preparation Example 121-1: Preparation of tert-butyl 8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 121-1)

[1309]

[1310] 125 mg (yield 59%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (200 mg, 0.57 mmol), p-tolylboronic acid (251 mg, 1.71 mmol), Pd(PPh3)4 (35 mg, 0.03 mmol), and 1M Na2CO3 (1.43 mL, 1.43 mmol) in the same manner as in Preparation Examples 1-3.

[1311] 1H NMR (400 MHz, DMSO) δ 10.96(s, 1H), 7.64(s, 1H), 7.57 (d, J=8.1 Hz, 2H), 7.34(t, J=1.5 Hz, 2H), 7.24(d, J=7.9 Hz, 2H), 4.58(s, 2H), 3.72 (t, J=5.7 Hz, 2H), 2.79(s, 2H), 2.34(s, 3H), 1.45(s, 9H).

[1312]

[1313] Preparation Example 121-2: Preparation of 8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Intermediate 121-2)

[1314]

[1315] 98 mg (yield 94%) of the title compound was obtained using tert-butyl 8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (125 mg, 0.34 mmol) and HCl solution (4 M in dioxane) (1.7 mL, 6.8 mmol) in the same manner as in Preparation Examples 1-4.

[1316] 1 H NMR (400 MHz, DMSO) δ 11.22(s, 1H), 9.21(s, 2H), 7.75(s, 1H), 7.61-7.54(m, 2H), 7.40(d, J=1.2 Hz, 2H), 7.26(d, J=7.9 Hz, 2H), 4.36(s, 2H), 3.50(s, 2H), 3.04(t, J=6.0 Hz, 2H), 2.34(s, 3H).

[1317]

[1318] Preparation Example 121-3: Preparation of thiazole-5-yl(8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 121)

[1319]

[1320] 11 mg (yield 44%) of the title compound was obtained using 8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.067 mmol), thiazole-5-carboxylic acid (13 mg, 0.10 mmol), EDCI (52 mg, 0.27 mmol), and DIPEA (0.047 mL, 0.27 mmol) in the same manner as in Preparation Example 46.

[1321] 1 H NMR (400 MHz, DMSO) δ 11.05 (s, 1H), 9.28 (s, 1H), 8.36 (s, 1H), 7.73 (s, 1H), 7.58 (s, 2H), 7.36 (s, 2H), 7.23 (d, J= 7.7 Hz, 2H), 4.86 (s, 2H), 3.98 (s, 2H), 2.97 (s, 2H), 2.34 (s, 3H).

[1322]

[1323] Preparation Example 122: Preparation of oxazole-5-yl(8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 122)

[1324]

[1325] 5 mg (yield 20%) of the title compound was obtained using 8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (20 mg, 0.067 mmol), oxazole-5-carboxylic acid (11 mg, 0.10 mmol), EDCI (52 mg, 0.27 mmol), and DIPEA (0.047 mL, 0.27 mmol) in the same manner as in Preparation Example 46.

[1326] 1H NMR (400 MHz, DMSO) δ 11.04 (s, 1H), 8.60 (s, 1H), 7.84 (s, 1H), 7.75 (s, 1H), 7.60 (s, 2H), 7.36 (s, 2H), 7.24 (d, J= 7.7 Hz, 2H), 4.91 (d,J= 51.3 Hz, 2H), 4.02 (s, 2H), 2.96 (d,J= 34.7 Hz, 2H), 2.34 (s, 3H).

[1327]

[1328] Preparation Example 123: Preparation of phenyl(8-(pyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 123)

[1329] Preparation Example 123-1: Preparation of tert-butyl 8-(pyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 123-2)

[1330]

[1331] 158 mg (yield 45%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (250 mg, 1.00 mmol), 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrimidine (618 mg, 3.0 mmol), Pd(PPh3)4 (58 mg, 0.05 mmol), and 1M Na2CO3 (2.5 mL, 2.50 mmol) in the same manner as in Preparation Examples 1-3.

[1332] 1 H NMR (400 MHz, DMSO) δ 11.13(s, 1H), 9.16(s, 2H), 9.11(s, 1H), 7.91 (s, 1H), 7.46(q,J=8.4 Hz, 2H), 4.61(s, 2H), 3.73(s, 2H), 2.81(s, 2H), 1.46 (s, 9H).

[1333]

[1334] Preparation Example 123-2: Preparation of 8-(pyrimidine-5-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Intermediate 123-3)

[1335]

[1336] 157 mg (yield 99%) of the title compound was obtained using tert-butyl 8-(pyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (193 mg, 0.55 mmol) and HCl solution (4 M in dioxane) (2.75 mL, 11.0 mmol) in the same manner as in Preparation Examples 1-4.

[1337] 1 H NMR (400 MHz, DMSO) δ 11.42(s, 1H), 9.41(s, 2H), 9.16(d,J=13.5 Hz, 3H), 8.00(s, 1H), 7.58-7.49(m, 2H), 4.36(s, 2H), 3.50(s, 2H), 3.07(s, 2H).

[1338]

[1339] Preparation Example 123-3: Preparation of phenyl(8-(pyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 123)

[1340]

[1341] 19 mg (yield 62%) of the title compound was obtained using 8-(pyrimidine-5-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (25 mg, 0.087 mmol), benzoic acid (16 mg, 0.13 mmol), EDCI (67 mg, 0.35 mmol), and DIPEA (0.061 mL, 0.35 mmol) in the same manner as in Preparation Example 46.

[1342] 1H NMR (400 MHz, DMSO) δ 11.20 (s, 1H), 9.15 (d, J = 32.3 Hz, 3H), 7.88 (d, J = 108.9 Hz, 1H), 7.50 (s, 7H), 4.77 (d, J = 81.4 Hz, 2H), 3.86(d,J=140.5 Hz, 2H), 2.91(s, 2H).

[1343]

[1344] Preparation Example 124: Preparation of (8-(pyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 124)

[1345]

[1346] 15 mg (yield 46%) of the title compound was obtained using 8-(pyrimidine-5-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (25 mg, 0.087 mmol), 4-methylbenzoic acid (18 mg, 0.13 mmol), EDCI (67 mg, 0.35 mmol), and DIPEA (0.061 mL, 0.35 mmol) in the same manner as in Preparation Example 46.

[1347] 1 H NMR (400 MHz, DMSO) δ 11.18(s, 1H), 9.14(d,J=32.1 Hz, 3H), 7.88(d,J=97.4 Hz, 1H), 7.46(s, 2H), 7.39(d,J=7.3 Hz, 2H), 7.29(d,J=7.0 Hz, 2H), 4.77(d,J=56.5 Hz, 2H), 3.86(d,J=128.9 Hz, 2H), 2.90(s, 2H), 2.37(s, 3H).

[1348]

[1349] Preparation Example 125: Preparation of phenyl(8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 125)

[1350] Preparation Example 125-1: Preparation of tert-butyl 8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 125-1)

[1351]

[1352] 26 mg (yield 37%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (50 mg, 0.20 mmol), pyridine-4-ylboronic acid (74 mg, 0.60 mmol), Pd(PPh3)4 (12 mg, 0.01 mmol), and 1 M Na2CO3 (0.5 mL, 0.50 mmol) in the same manner as in Preparation Examples 1-3.

[1353] 1 H NMR (400 MHz, DMSO) δ 11.13 (s, 1H), 8.57 (d,J= 3.8 Hz, 2H), 7.92 (s, 1H), 7.75 (d,J= 5.6 Hz, 2H), 7.52 (d,J= 7.2 Hz, 1H), 7.42 (d,J= 8.4 Hz, 1H), 4.61 (s, 2H), 3.73 (s, 2H), 2.80 (s, 2H), 1.46 (s, 9H).

[1354]

[1355] Preparation Example 125-2: Preparation of 8-(pyridine-4-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (intermediate 125-2)

[1356]

[1357] 21 mg (yield 99%) of the title compound was obtained using tert-butyl 8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (26 mg, 0.074 mmol) and HCl solution (4 M in dioxane) (0.37 mL, 1.48 mmol) in the same manner as in Preparation Examples 1-4.

[1358] 1 H NMR (400 MHz, DMSO) δ 11.63 (s, 1H), 9.43 (s, 2H), 8.85 (d,J= 6.8 Hz, 2H), 8.34 (d,J= 6.4 Hz, 3H), 7.80 (dd,J= 8.6, 1.8 Hz, 1H), 7.56 (d,J= 8.6 Hz, 1H), 4.39 (s, 2H), 3.51 (s, 2H), 3.09 (d,J= 5.8 Hz, 2H).

[1359]

[1360] Preparation Example 125-3: Preparation of phenyl(8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 125)

[1361]

[1362] 10 mg (yield 61%) of the title compound was obtained using 8-(pyridine-4-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (16 mg, 0.046 mmol), benzoic acid (8 mg, 0.069 mmol), EDCI (35 mg, 0.18 mmol), and DIPEA (0.023 mL, 0.18 mmol) in the same manner as in Preparation Example 46.

[1363] 1 H NMR (400 MHz, DMSO) δ 11.22 (s, 1H), 8.59 (s, 2H), 8.06 (s, 1H), 7.76 (d,J= 43.2 Hz, 2H), 7.50 (s, 7H), 4.88 (s, 1H), 4.68 (s, 1H), 4.05 (s, 1H), 3.68 (s, 1H), 2.91 (s, 2H).

[1364]

[1365] Preparation Example 126: Preparation of (8-(pyridine-4-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 126)

[1366]

[1367] 10 mg (yield 45%) of the title compound was obtained using 8-(pyridine-4-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (21 mg, 0.060 mmol), 4-methylbenzoic acid (12 mg, 0.09 mmol), EDCI (46 mg, 0.24 mmol), and DIPEA (0.042 mL, 0.24 mmol) in the same manner as in Preparation Example 46.

[1368] 1 H NMR (400 MHz, DMSO) δ 11.19 (s, 1H), 8.57 (s, 2H), 8.06 - 7.42 (m, 5H), 7.40 (d,J= 7.5 Hz, 2H), 7.29 (d,J= 7.4 Hz, 2H), 4.85 (s, 2H), 3.86 (d,J= 129.0 Hz, 2H), 2.90 (s, 2H), 2.37 (s, 3H).

[1369]

[1370] Preparation Example 127: Preparation of (8-(6-methylpyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 127)

[1371] Preparation Example 127-1: Preparation of tert-butyl 8-(6-methylpyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 127-2)

[1372]

[1373] 101 mg (yield 33%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.85 mmol), 2-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (561 mg, 2.56 mmol), Pd(PPh3)4 (49 mg, 0.05 mmol), and 1M Na2CO3 (2.14 mL, 2.14 mmol) in the same manner as in Preparation Examples 1-3.

[1374] 1 H NMR (400 MHz, DMSO) δ 11.03 (s, 1H), 8.77 (s, 1H), 7.98 (d, J = 7.8 Hz, 1H), 7.73 (s, 1H), 7.39 (s, 2H), 7.31 (d, J = 8.1 Hz, 1H), 4.59 (s, 2H), 3.73 (s, 2H), 2.80 (s, 2H), 2.68 (s, 3H), 1.45 (s, 9H).

[1375]

[1376] Preparation Example 127-2: Preparation of 8-(6-methylpyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Intermediate 127-3)

[1377]

[1378] 83 mg (yield 100%) of the title compound was obtained using tert-butyl 8-(6-methylpyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (101 mg, 0.28 mmol) and an HCl solution (4 M in dioxane) (1.39 mL, 5.56 mmol) in the same manner as in Preparation Examples 1-4.

[1379] 1H NMR (400 MHz, DMSO) δ 11.46 (s, 1H), 9.43 (s, 2H), 9.06 (d, J = 2.3 Hz, 1H), 8.73 (d, J = 8.4 Hz, 1H), 8.06 (d, J = 1.8 Hz, 1H), 7.91 (d, J) = 8.4 Hz, 1H), 7.60 (dd, J = 8.5, 1.9 Hz, 1H), 7.51 (d, J = 8.5 Hz, 1H), 4.36 (s, 2H), 3.52 - 3.49 (m, 2H), 3.07 (t, J = 6.1 Hz, 2H), 2.74 (s, 3H).

[1380]

[1381] Preparation Example 127-3: Preparation of (8-(6-methylpyridine-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 127)

[1382]

[1383] 12.4 mg (yield 34%) of the title compound was obtained using 8-(6-methylpyridine-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (30 mg, 0.1 mmol), benzoic acid (18 mg, 0.15 mmol), EDCI (77 mg, 0.4 mmol), and DIPEA (0.070 mL, 0.4 mmol) in the same manner as in Preparation Example 46.

[1384] 1 H NMR (400 MHz, CD3CN) δ 9.24(s, 1H), 8.81(s, 1H), 7.85(s, 2H), 7.50 (s, 8H), 4.80(d, J=96.1 Hz, 2H), 3.93(d, J=148.9 Hz, 2H), 2.91(s, 2H), 2.56 (s, 3H).

[1385]

[1386] Preparation Example 128: Preparation of (8-(2-methylpyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 128)

[1387] Preparation Example 128-1: Preparation of tert-butyl 8-(2-methylpyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 128-2)

[1388]

[1389] 152 mg (yield 49%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.85 mmol), 2-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrimidine (564 mg, 2.56 mmol), Pd(PPh3)4 (49 mg, 0.05 mmol), and 1M Na2CO3 (2.14 mL, 2.14 mmol) in the same manner as in Preparation Examples 1-3.

[1390] 1 H NMR (400 MHz, DMSO) δ 11.09 (s, 1H), 9.03 (s, 2H), 7.85 (s, 1H), 7.43 (d, J = 1.8 Hz, 2H), 4.60 (s, 2H), 3.73 (t, J = 5.7 Hz, 2H), 2.81 (d, J = 5.8 Hz, 2H), 2.66 (s, 3H), 1.46 (s, 9H).

[1391]

[1392] Preparation Example 128-2: Preparation of 8-(2-methylpyrimidine-5-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (intermediate 128-3)

[1393]

[1394] 126 mg (yield 100%) of the title compound was obtained using tert-butyl 8-(2-methylpyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (152 mg, 0.42 mmol) and HCl solution (4 M in dioxane) (2.1 mL, 8.34 mmol) in the same manner as in Preparation Examples 1-4.

[1395] 1 H NMR (400 MHz, DMSO) δ 11.38(s, 1H), 9.41(s, 2H), 9.07(s, 2H), 7.95 (d, J=1.6 Hz, 1H), 7.52(dd, J=8.5, 1.7 Hz, 1H), 7.48(d, J=8.4 Hz, 1H), 4.35 (d, J=4.6 Hz, 2H), 3.50(d, J=6.7 Hz, 2H), 3.07(t, J=6.1 Hz, 2H), 2.68(s, 3H).

[1396]

[1397] Preparation Example 128-3: Preparation of (8-(2-methylpyrimidine-5-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 128)

[1398]

[1399] 29 mg (yield 57%) of the title compound was obtained using 8-(2-methylpyrimidine-5-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (40 mg, 0.13 mmol), 4-methylbenzoic acid (27 mg, 0.20 mmol), EDCI (102 mg, 0.53 mmol), and DIPEA (0.093 mL, 0.53 mmol) in the same manner as in Preparation Example 46.

[1400] 1H NMR (400 MHz, DMSO) δ11.15(s, 1H), 9.04(s, 2H), 7.83(d, J=98.6Hz, 1H), 7.44(s, 2H), 7.39(d, J=7.7Hz, 2H), 7.29(d, J=7.6Hz, 2H), 4.77(d, J=56.5 Hz, 2H), 4.01(s, 1H), 3.70(s, 1H), 2.90(s, 2H), 2.65(s, 3H), 2.37(s, 3H).

[1401]

[1402] Preparation Example 129: Preparation of (8-(1-methyl-1H-pyrazole-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 129)

[1403] Preparation Example 129-1: Preparation of tert-butyl 8-(1-methyl-1H-pyrazole-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 129-2)

[1404]

[1405] 220 mg (yield 73%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.85 mmol), 1-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (533 mg, 2.56 mmol), Pd(PPh3)4 (49 mg, 0.043 mmol), and 1M Na2CO3 (2.14 mL, 2.14 mmol) in the same manner as in Preparation Examples 1-3.

[1406] 1H NMR (400 MHz, DMSO) δ 10.93(s, 1H), 7.78(s, 1H), 7.68(d, J=2.2 Hz, 1H), 7.52(d, J=8.4 Hz, 1H), 7.28(d, J = 8.5 Hz, 1H), 6.64(d, J=2.2 Hz, 1H), 4.57(s, 2H), 3.87(s, 3H), 3.72(s, 2H), 2.78(s, 2H), 1.46(s, 9H).

[1407]

[1408] Preparation Example 129-2: Preparation of 8-(1-methyl-1H-pyrazole-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (intermediate 129-3)

[1409]

[1410] 180 mg (yield 100%) of the title compound was obtained using tert-butyl 8-(1-methyl-1H-pyrazole-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (220 mg, 0.63 mmol) and HCl solution (4 M in dioxane) (3.1 mL, 12.5 mmol) in the same manner as in Preparation Examples 1-4.

[1411] 1 H NMR (400 MHz, DMSO) δ 11.21(s, 1H), 9.39(s, 2H), 7.88(s, 1H), 7.71 (d, J=2.2 Hz, 1H), 7.57(dd, J=8.5, 1.7 Hz, 1H), 7.34(d, J=8.5) Hz, 1H), 6.63 (d, J=2.3 Hz, 1H), 4.35(s, 2H), 3.88(s, 3H), 3.51-3.44(m, 2H), 3.04(s, 2H).

[1412]

[1413] Preparation Example 129-3: Preparation of (8-(1-methyl-1H-pyrazole-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(phenyl)methanone (Compound 129)

[1414]

[1415] 4 mg (yield 5%) of the title compound was obtained using 8-(1-methyl-1H-pyrazole-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (60 mg, 0.21 mmol), benzoic acid (38 mg, 0.31 mmol), EDCI (159 mg, 0.83 mmol), and DIPEA (0.145 mL, 0.83 mmol) in the same manner as in Preparation Example 46.

[1416] 1 H NMR (400 MHz, DMSO) δ 11.01 (s, 1H), 7.93 - 7.42 (m, 8H), 7.30 (s, 1H), 6.63 (d, J = 39.5 Hz, 1H), 4.73 (d, J = 85.2 Hz, 2H), 4.04 (s, 1H), 3.86 (d, J = 17.2 Hz, 3H), 3.68 (s, 1H), 2.88 (s, 2H).

[1417]

[1418] Preparation Example 130: Preparation of (8-(1-methyl-1H-pyrazole-3-yl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(p-tolyl)methanone (Compound 130)

[1419]

[1420] 4 mg (yield 5%) of the title compound was obtained using 8-(1-methyl-1H-pyrazole-3-yl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (60 mg, 0.21 mmol), 4-methylbenzoic acid (42 mg, 0.31 mmol), EDCI (159 mg, 0.83 mmol), and DIPEA (0.145 mL, 0.83 mmol) in the same manner as in Preparation Example 46.

[1421] 1H NMR (400 MHz, DMSO) δ 10.97 (s, 1H), 7.59 (d, J = 66.4 Hz, 3H), 7.39 (d, J = 7.8 Hz, 2H), 7.29 (d, J = 7.9 Hz, 3H), 6.63 (s, 1H), 4.80 (s, 1H), 4.65 (s, 1H), 4.01 (s, 1H), 3.88 (d, J = 11.6 Hz, 3H), 3.68 (s, 1H), 2.87 (s, 2H), 2.38 (s, 3H).

[1422]

[1423] Preparation Example 131: Preparation of (8-(4-chlorophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(4-methylthiazole-5-yl)methanone (Compound 131)

[1424] Preparation Example 131-1: Preparation of tert-butyl 8-(4-chlorophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 131-1)

[1425]

[1426] 119 mg (yield 36%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (300 mg, 0.85 mmol), (4-chlorophenyl)boronic acid (401 mg, 2.56 mmol), Pd(PPh3)4 (49 mg, 0.043 mmol), and 1M Na2CO3 (2.14 mL, 2.14 mmol) in the same manner as in Preparation Examples 1-3.

[1427] 1 H NMR (400 MHz, DMSO) δ 11.01(s, 1H), 7.75-7.67(m, 3H), 7.50-7.44 (m, 2H), 7.37(t, J=1.5 Hz, 2H), 4.59(s, 2H), 3.72(t, J=5.7 Hz, 2H), 2.80(d, J=6.0 Hz, 2H), 1.45(s, 9H).

[1428]

[1429] Preparation Example 131-2: Preparation of 8-(4-chlorophenyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Intermediate 131-2)

[1430]

[1431] In the same manner as in Preparation Examples 1-4, 96 mg (yield 97%) of the title compound was obtained using tert-butyl 8-(4-chlorophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (119 mg, 0.31 mmol) and HCl solution (4 M in dioxane) (1.5 mL, 6.19 mmol).

[1432] 1 H NMR (400 MHz, DMSO) δ 11.27 (s, 1H), 9.16 (s, 2H), 7.81 (s, 1H), 7.74 - 7.69 (m, 2H), 7.53 - 7.48 (m, 2H), 7.43 (d, J = 1.2 Hz, 2H), 4.37 (s, 2H), 3.51 (d, J = 6.4 Hz, 2H), 3.05 (t, J = 6.1 Hz, 2H).

[1433]

[1434] Preparation Example 131-3: Preparation of (8-(4-chlorophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(4-methylthiazole-5-yl)methanone (Compound 131)

[1435]

[1436] 3 mg (yield 5%) of the title compound was obtained using 8-(4-chlorophenyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (48 mg, 0.15 mmol), 4-methylthiazole-5-carboxylic acid (32 mg, 0.23 mmol), EDCI (115 mg, 0.60 mmol), and DIPEA (0.105 mL, 0.6 mmol) in the same manner as in Preparation Example 46.

[1437] 1 H NMR (400 MHz, DMSO) δ 11.10(s, 1H), 9.14(s, 1H), 7.72(d, J=8.6 Hz, 3H), 7.46(d, J=8.1 Hz, 2H), 7.38(s, 2H), 4.78(s, 2H), 3.80(s, 2H), 2.89(s, 2H), 2.41(s, 3H).

[1438]

[1439] Preparation Example 132: Preparation of (8-(4-chlorophenyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)(2-methylthiazole-5-yl)methanone (Compound 132)

[1440]

[1441] 3 mg (yield 5%) of the title compound was obtained using 8-(4-chlorophenyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (48 mg, 0.15 mmol), 2-methylthiazole-5-carboxylic acid (32 mg, 0.23 mmol), EDCI (115 mg, 0.60 mmol), and DIPEA (0.105 mL, 0.6 mmol) in the same manner as in Preparation Example 46.

[1442] 1 H NMR (400 MHz, DMSO) δ 11.10 (s, 1H), 8.10 (s, 1H), 7.80 (s, 1H), 7.73 (d, J = 8.3 Hz, 2H), 7.47 (d, J = 8.5 Hz, 2H), 7.38 (s, 2H), 4.90 (s, 2H), 3.99 (d, J = 6.1 Hz, 2H), 2.95 (s, 2H), 2.71 (s, 3H).

[1443]

[1444] Preparation Example 133: Preparation of (4-methylthiazole-5-yl)(8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 133)

[1445] Preparation Example 133-1: Preparation of tert-butyl 8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (Intermediate 133-1)

[1446]

[1447] 115 mg (yield 45%) of the title compound was obtained using tert-butyl 8-bromo-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (246 mg, 0.70 mmol), p-tolylboronic acid (286 mg, 2.11 mmol), Pd(PPh3)4 (41 mg, 0.035 mmol), and 1 M Na2CO3 (1.75 mL, 1.75 mmol) in the same manner as in Preparation Examples 1-3.

[1448] 1 H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 7.64 (s, 1H), 7.57 (d, J = 8.1 Hz, 2H), 7.37 - 7.31 (m, 2H), 7.24 (d, J = 7.9 Hz, 2H), 4.58 (s, 2H), 3.72 (t, J = 5.6 Hz, 2H), 2.80 (d, J = 5.8 Hz, 2H), 2.34 (s, 3H), 1.45 (s, 9H).

[1449]

[1450] Preparation Example 133-2: Preparation of 8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (Intermediate 133-2)

[1451]

[1452] 84 mg (yield 89%) of the title compound was obtained using tert-butyl 8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-carboxylate (115 mg, 0.32 mmol) and HCl solution (4 M in dioxane) (1.6 mL, 6.37 mmol) in the same manner as in Preparation Examples 1-4.

[1453] 1 H NMR (400 MHz, DMSO) δ 11.21 (s, 1H), 9.22 (s, 2H), 7.75 (s, 1H), 7.60 - 7.55 (m, 2H), 7.40 (d, J = 1.3 Hz, 2H), 7.26 (d, J = 8.0 Hz, 2H), 4.36 (s, 2H), 3.50 (s, 2H), 3.05 (t, J = 6.0 Hz, 2H), 2.34 (s, 3H).

[1454]

[1455] Preparation Example 133-3: Preparation of (4-methylthiazole-5-yl)(8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 133)

[1456]

[1457] 15 mg (yield 30%) of the title compound was obtained using 8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (40 mg, 0.13 mmol), 4-methylthiazole-5-carboxylic acid (29 mg, 0.20 mmol), EDCI (103 mg, 0.54 mmol), and DIPEA (0.093 mL, 0.54 mmol) in the same manner as in Preparation Example 46.

[1458] 1 H NMR (400 MHz, DMSO) δ 11.03 (s, 1H), 9.14 (s, 1H), 7.70 (s, 1H), 7.57 (d, J = 7.7 Hz, 2H), 7.36 (s, 2H), 7.23 (d, J = 7.8 Hz, 2H), 4.77 (s, 2H), 3.82 (s, 2H), 2.89 (s, 2H), 2.41 (s, 3H), 2.33 (s, 3H).

[1459]

[1460] Preparation Example 134: Preparation of (2-methylthiazole-5-yl)(8-(p-tolyl)-1,3,4,5-tetrahydro-2H-pyrido[4,3-b]indole-2-yl)methanone (Compound 134)

[1461]

[1462] 24 mg (yield 46%) of the title compound was obtained using 8-(p-tolyl)-2,3,4,5-tetrahydro-1H-pyrido[4,3-b]indole hydrochloride (40 mg, 0.13 mmol), 2-methylthiazole-5-carboxylic acid (29 mg, 0.20 mmol), EDCI (103 mg, 0.54 mmol), and DIPEA (0.093 mL, 0.54 mmol) in the same manner as in Preparation Example 46.

[1463] 1 H NMR (400 MHz, DMSO) δ 11.03(s, 1H), 8.10(s, 1H), 7.73(s, 1H), 7.58(d, J=7.7 Hz, 2H), 7.36(d, J=1.7 Hz, 2H), 7.24(d, J=7.8 Hz, 2H), 4.89 (s, 2H), 3.99(t, J=5.7 Hz, 2H), 2.95(s, 2H), 2.70(s, 3H), 2.34(s, 3H).

[1464]

[1465] Experimental results

[1466] Tau-Synaptogyrin-3 Interaction Cell-Based Assay

[1467] Since Synaptogyrin 3 is a 4-membrane-transmembrane neuronal vesicle protein, developing in vitro assay methods for detecting Tau-Synaptogyrin 3 interactions presents difficulties due to the need for recombinant protein expression and purification. Therefore, to avoid interference between intrinsic Synaptogyrin 3 and Tau expression and to facilitate the handling of large-scale samples, a cell-based assay using HEK293T cells was designed. EGFP-fused Tau (pTK231:P CMV-Tau-EGFP) and Synaptogyrin 3(pTK233:P CMV The expression of both proteins in HEK293T was confirmed by transfecting with Tau-EGFP-Synaptogyrin 3. As a result, both proteins were well expressed in HEK293T cells, and while Tau-EGFP was located in the cytoplasm, EGFP-Synaptogyrin 3 was mostly distributed in granules (Fig. 1), confirming that Tau-Synaptogyrin 3 interactions can be captured within HEK293T cells.

[1468] Protein Complementary Assay (PCA) is widely used to detect protein-protein interactions, and bimolecular fluorescence complementation and split luciferase methods are actively used in the development of assay methods to monitor protein-protein interactions in Tau [2, 3]. Split luciferase systems called NanoBits include sBits (small bit) and Lbits (large bits), and are used for the analysis of functionality and utility in living cells because they are small in size and do not undergo oligomerization. All combinations of sBit / Lbit and Synatogyrin 3 / Tau fusion proteins (Table 1: pTK225: Tau-sBit, pTK226: Tau-Lbit, pTK227: sBit-Tau, pTK228: Lbit-Tau, pTK245: Synaptogyrin 3-sBit, pTK246: Synaptogyrin 3-Lbit, pTK247: sBit-Synaptogyrin 3 and pTK248: Lbit-Synaptogyrin 3) were cloned under a CMV promoter to be expressed in animal cells. Through co-transfection of all possible combinations in HEK293T cells, it was confirmed that the cellular Lbit-Synaptogyrin 3 and sBit-Tau combinations showed the highest signal increase (Fig. 2). Therefore, a combination of Lbit-Synaptogyrin 3 and sBit-Tau was selected.

[1469]

[1470] Production and verification of stable cell lines

[1471] To improve the efficiency of producing stable cell lines, a dual-promoter and multi-cystronic structure was applied in which all essential components were loaded into a single plasmid. The configuration for the Tau-Synaptogyrin 3 interaction assay, including the fluorescent protein and the puromycin resistance gene, was cloned into a single plasmid (Table 1: pTK252: P EF1alpha -sBit- Tau-IRES-EGFP / P PGK -Lbit-Synaptogyrin 3-IRES-copGFP-T2A-puroR). Two GFPs (EGFP and copGFP) were inserted into each expression unit of the vector, and pTK252-transfected HEK293T cells were selected using puromycin, and then eight GFP-positive clones (1E2, 1D6, 2B5, 2C9, 2C10, 3B5, 4D7, and 4F2) were selected.

[1472] The reliability of the Tau-Synaptogyrin 3 interaction assay in the HEK293T-TK252 clone was indirectly confirmed by competitive expression of native Tau using floretin-regulated gene expression (Figs. 3 and 4). Native Tau binds to Synaptogyrin 3 competitively with sBit-Tau, and it was predicted that luciferase activity would be lower with higher co-expression of native Tau (Fig. 4a). Native Tau expression was dose-dependently regulated using a floretin-regulated gene expression system. The floretin-regulated gene expression system involved TtgA, a synthetic transcriptional activator derived from the flavonoid-regulated TtgRoperon of the Pseudomonas putidaDOT-T1E strain, and P, a synthetic promoter. TtgR It includes (Fig. 3a)[5]. TtgR is an operator site on DNA (O TtgRIt binds to ), and floretin detaches from DNA simultaneously with binding to TtgR. The synthetic transcription factor is a fusion protein of TtgR and VP16, a herpes-simplex-derived transactivation domain, and the synthetic promoter is O 5' upstream of the CMV minimal promoter. TtgR It consists of. In the absence of floretin, TtgA is P TtgR It binds to and activates transcription; in the presence of floretin, TtgA detaches from DNA, and transcription is not activated. EGFP expression plasmid regulated by floretin (pTK269:P CAG -TtgA and pTK274: P TtgR Upon co-expression of -EGFP), a dose-dependent EGFP signal (0–50 μM floretin) appeared, showing a fourfold difference between 0 and 50 μM treatments (Fig. 3b). The floretin-regulated Tau expression plasmid (pTK269:P CAG -TtgA and pTK285:P TtgR HEK293T-TK252 clones were co-transfected with -Tau and treated with floretin at different concentrations (0, 10, and 50 μM). Expected competitive binding was observed in clones 1E2, 2C9, and 2C10; among these, 1E2 was selected as the clone to be used for screening because, although it had the lowest maximum signal, it showed the highest dose dependence with a twofold difference in effect between 0 and 50 μM treatments (Fig. 4b). The other clones either did not respond to floretin (1D6, 4F2, and 4D7) or responded in the opposite manner (3B5 and 2B5). It was confirmed that floretin treatment did not significantly alter the EGFP signal and had no effect on cell survival or protein expression.

[1473]

[1474] IC of the novel derivative 50 measurement

[1475] HEK293T-TK252-1E2 cells were treated with 199 novel derivatives at concentrations of 0, 0.5, 1, 2.5, 5, 10, and 20 μM, respectively, and cultured for 48 hours. Since phenol red significantly affects assay results, phenol red-free medium was used throughout the entire process from cell culture to measurement. Prior to measurement, dead cells were removed, and a single wash was performed using FBS-free culture medium to eliminate FBS, which could affect the luciferase assay. Luciferase activity and fluorescence intensity were measured at a single time point. Since fluorescence intensity is expected to be proportional to the number of cells at the time point of measurement, luciferase activity was normalized using fluorescence intensity. The L / F value (luciferase activity / fluorescence intensity), which is luciferase activity normalized with respect to fluorescence intensity, was calculated for all measurements and compared with the L / F value of 0 μM to evaluate the inhibitory effect of each novel derivative at different concentrations.

[1476] L / F values ​​at concentrations of 0, 0.5, 1, 2.5, 5, 10, and 20 μM were measured for 199 compounds through independent double-dose experiments to determine IC 50 The value was calculated. ICs of 25μM or less 50 IC of 133 derivatives (indicated by chemical formula numbers) having values 50 The values ​​are shown in Table 4 below.

[1477] Chemical formula activation Chemical formula activation Chemical formula activation Chemical formula activation Chemical formula activation 2+++32+++62+92+++122++3+++33++63++93+++123+4+++34++64++94++124+5+++35+++65++95++125+6+++36+++66++96++126++7++37+++67++97++127++8+++38 +++68+98+++128+9++39+++69++99+++129+10++40++70++100+++130+11+++41+++71+++101+++131++12++42+++72+102+++132++13+++43++73+103++133++14+++44+++74+++104++134++15+4 5++75+++105+++16+++46+++76+++106+++17+++47+++77+++107+++18+++48++78++108+++19++49+++79++109+++20+++50+++80++110+++21++51+++81++111+++22++52+++82++112+++23+53+ ++83+++113+++24+54+++84++114+++25+++55+++85++115++26+++56++86+++116+++27+++57++87++117++28+++58++88+++118++29++59++89++119+30++60++90+120+++31+++61+91+++121+++

[1478] +++, IC 50 < 3μM

[1479] ++, 3μM ≤IC 50 ≤ 12μM

[1480] +, 12μM < IC 50 ≤ 25μM

[1481]

[1482] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Compound represented by the following chemical formula 1: Chemical formula 1 In the above chemical formula, R1 is an aryl of a 6-membered ring or a heteroaryl of a 5- to 6-membered ring that is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, halogen, and -CN; R2 and R3 are each independently hydrogen or C1-C3 alkyl, or R2 and R3 are combined with each other to form a C3-C5 cycloalkyl; R4 and R5 are each independently hydrogen or C1-C3 alkyl, or R4 and R5 are combined with each other to form a heterobicycle C7-C9 alkyl; R6 is a hexagonal heterocycloalkyl; a C6-C that is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, halogen, and -CN. 10 It is an aryl or a heteroaryl of a 5 to 9-membered ring; a phenyl C1-C3 alkyl; or a tetrahydroisoquinoline; R7 is hydrogen or C1-C3 alkyl; L1 is -C(O)-, -C(O)NH-, -C(S)NH- or -S(O2)-; n is an integer from 0 to 2. A compound according to claim 1, wherein R1 is unsubstituted or substituted with one or more substituents selected from the group consisting of C1-C2 alkyl, C1-C2 alkoxy, halogen, and -CN, and is phenyl, pyridine, pyrimidine, or pyrazole. A compound according to claim 1, wherein R2 and R3 are simultaneously hydrogen or simultaneously C1-C2 alkyl, or R2 and R3 are combined with each other to form a C3-C4 cycloalkyl. A compound according to claim 1, wherein R4 and R5 are each independently hydrogen or C1-C2 alkyl but not simultaneously C1-C2 alkyl, or R4 and R5 are combined with each other to form a heterobicyclooctane. A compound according to claim 1, wherein R6 is morpholine; phenyl, pyridine, pyridazine, oxazole, imidazole, pyrazine, pyrimidine, pyrazole, thiazole, isothiaazole, benzothiaazole, or imidazopyridine substituted with one or more substituents selected from the group consisting of C1-C2 alkyl, C1-C2 alkoxy, halogen, and -CN; phenyl methyl; or tetrahydroisoquinoline. A compound according to claim 1, wherein n is 0 or 1, and when n is 1, R2 to R5 are hydrogen. A compound according to claim 1, characterized in that the compound represented by Chemical Formula 1 is selected from the group consisting of compounds represented by Chemical Formulas 2 to 134 below: Chemical formula 2 Chemical formula 3 Chemical formula 4 Chemical formula 5 Chemical formula 6 Chemical formula 7 Chemical formula 8 Chemical formula 9 Chemical formula 10 Chemical formula 11 Chemical formula 12 Chemical formula 13 Chemical formula 14 Chemical formula 15 Chemical formula 16 Chemical formula 17 Chemical formula 18 Chemical formula 19 Chemical formula 20 Chemical formula 21 Chemical formula 22 Chemical formula 23 Chemical formula 24 Chemical formula 25 Chemical formula 26 Chemical formula 27 Chemical formula 28 Chemical formula 29 Chemical formula 30 Chemical formula 31 Chemical formula 32 Chemical formula 33 Chemical formula 34 Chemical formula 35 Chemical formula 36 Chemical formula 37 Chemical formula 38 Chemical formula 39 Chemical formula 40 Chemical formula 41 Chemical formula 42 Chemical formula 43 Chemical formula 44 Chemical formula 45 Chemical formula 46 Chemical formula 47 Chemical formula 48 Chemical formula 49 Chemical formula 50 Chemical formula 51 Chemical formula 52 Chemical formula 53 Chemical formula 54 Chemical formula 55 Chemical formula 56 Chemical formula 57 Chemical formula 58 Chemical formula 59 Chemical formula 60 Chemical formula 61 Chemical formula 62 Chemical formula 63 Chemical formula 64 Chemical formula 65 Chemical formula 66 Chemical formula 67 Chemical formula 68 Chemical formula 69 Chemical formula 70 Chemical formula 71 Chemical formula 72 Chemical formula 73 Chemical formula 74 Chemical formula 75 Chemical formula 76 Chemical formula 77 Chemical formula 78 Chemical formula 79 Chemical formula 80 Chemical formula 81 Chemical formula 82 Chemical formula 83 Chemical formula 84 Chemical formula 85 Chemical formula 86 Chemical formula 87 Chemical formula 88 Chemical formula 89 Chemical formula 90 Chemical formula 91 Chemical formula 92 Chemical formula 93 Chemical formula 94 Chemical formula 95 Chemical formula 96 Chemical formula 97 Chemical formula 98 Chemical formula 99 Chemical formula 100 Chemical formula 101 Chemical formula 102 Chemical formula 103 Chemical formula 104 Chemical formula 105 Chemical formula 106 Chemical formula 107 Chemical formula 108 Chemical formula 109 Chemical formula 110 Chemical formula 111 Chemical formula 112 Chemical formula 113 Chemical formula 114 Chemical formula 115 Chemical formula 116 Chemical formula 117 Chemical formula 118 Chemical formula 119 Chemical formula 120 Chemical formula 121 Chemical formula 122 Chemical formula 123 Chemical formula 124 Chemical formula 125 Chemical formula 126 Chemical formula 127 Chemical formula 128 Chemical formula 129 Chemical formula 130 Chemical formula 131 Chemical formula 132 Chemical formula 133 Chemical formula 134 . A composition for the prevention or treatment of degenerative brain diseases comprising, as an active ingredient, a compound of any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof. In claim 8, the degenerative brain disease is Alzheimer's disease, argyrophilic grain disease (AGD), Lewy body dementia, frontotemporal dementia, progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinson's syndrome (PSP-P), Richardson's syndrome, Pick's disease, Niemann-Pick disease, Rasmussen's syndrome, Parkinson's disease, atypical parkinsonism in Guadeloupe, FTDP-17 (frontotemporal dementia with parkinsonism associated with chromosome 17), progressive subcortical gliosis, primary progressive aphasia, globular glial tauopathy, Lytico-Bodig disease, neurodegeneration with brain iron accumulation, pantothenate kinase-associated neurodegeneration (PKAN), postencephalitic parkinsonism, chronic traumatic encephalopathy;CTE), Familial British dementia, Familial Danish dementia, Huntington's disease, Down's syndrome, Gerstmann-Straussler-Scheinker disease, Myotonic dystrophy, Leukocyte tauopathy, Amyotrophic Lateral Sclerosis (ALS), cerebral amyloid angiopathy, Senile dementia of the neurofibrillary tangle type, Motor neuron disease with neurofibrillary tangles, Diffuse neurofibrillary tangles with calcification, corticobasal degeneration, primary age-related tauopathy A composition characterized by being selected from the group consisting of tauopathy and traumatic brain injury.; In claim 8, the composition is characterized by inhibiting the interaction between Tau and synaptogyrin 3. A functional food composition for the improvement or prevention of degenerative brain diseases comprising, as an active ingredient, a compound of any one of claims 1 to 7 or a food-grade salt thereof. A functional food composition for inhibiting the interaction between Tau and synaptogyrin 3, comprising as an active ingredient a compound of any one of claims 1 to 7 or a food-grade salt thereof.

Citation Information

Patent Citations

  • Substituted azepino[4,3-b]indoles, pharmacological composition and a method for the production and use thereof

    US20120040965A1

  • Compositions and methods for treating malignant astrocytomas

    WO2013106460A2

  • Modified carbazoles as therapeutic agents

    WO2019241451A1

  • Inhibitors of cgas for treating autoinflammatory diseases and cancer metastasis

    WO2020186027A1

  • Composition including novel pyridoindole derivative compound as active ingredient for prevention or treatment of neurodegenerative diseases

    WO2024191255A1