Muscarinic acetylcholine receptor subtype 4 antagonists for the treatment of anemia

Abstract

The present disclosure generally relates to treating anemia. More specifically, the present disclosure relates to the use of muscarinic acetylcholine receptor subtype 4 antagonists (such as small molecule compounds) for promoting self-renewal of burst-forming unit erythroid (BFU-E) cells and treating anemia.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 823,214, filed on March 25, 2019, the entire contents of which are incorporated herein by reference.

[0003] Statement Regarding Federally Funded Research

[0004] This invention was made with government support under Grant HL127522 from the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0005] The present disclosure generally relates to treating diseases and conditions caused by muscarinic acetylcholine receptor subtype 4 (M4) activity. More specifically, the present disclosure relates to the use of small molecule M4 antagonist compounds that promote self-renewal of burst forming unit erythroid (BFU-E) cells for treating anemia. Background Art

[0006] Many stem and progenitor cells of adult lineages undergo self-renewal, which is a key aspect of tissue homeostasis, maintenance, and regeneration (North TE et al., Nature, 447: 1007-1011 (2007); He S. et al., Annu Rev Cell Dev Biol, 25: 377-406 (2009); Simons BD et al., Cell, 145: 851-862 (2011); Seita J. et al., Wiley Interdiscip Rev Syst Biol Med, 2: 640-653 (2010); Xu Y. et al., Nature, 453: 338-344 (2008); Sun J. et al., Nature, 514: 322-347 (2014); Sharpless NE et al., Nat Rev Mol Cell Biol, 8: 703-713 (2007); Rossi DJ et al., Cell, 132:681-696 (2008). In the hematopoietic system, the burst-forming unit erythroid (BFU-E) is the first lineage-committed erythroid progenitor cell and has the great potential to self-renew to generate thousands of red blood cells. BFU-E undergoes differentiation, resulting in the formation of late erythroid progenitor cells, colony-forming unit erythroid (CFU-E), which form red blood cells after a limited 3-4 cell divisions (Zhang L. et al., Genes Dev, 25: 119-124 (2011). Although the survival and differentiation of CFU-E are mainly controlled by erythropoietin (EPO), the regulation of BFU-E self-renewal and differentiation is still unclear. EPO is mainly used to treat anemia caused by defective EPO production, such as seen in chronic kidney disease. However, many anemic patients do not have enough BFU-E and subsequently not enough CFU-E to respond to EPO treatment (Flygare J. et al., Blood, 117: 3435-3444 (2011); Zhang L. et al., Nature, 499: 92-96 (2013); Sankaran VG et al., Nat Med, 21: 221-230 (2015); Bauer et al., Genes Dev, 13:2996-3002 (1999); Komrokji RS et al., Curr Hematol Malig Rep, 6:145-153 (2011); Kotla V. et al., Hematol Onco., 2:36 (2009)). In order to treat these EPO-resistant anemias, a better understanding of the molecular mechanism of BFU-E self-renewal is needed.Previous reports have shown that compound PD102807 selectively inhibits CHRM4 relative to other members of the muscarinic acetylcholine receptor family (C. Croy et al., Characterization of PCS1055, a novel muscarinic M4 receptor antagonist, Eur. J. Pharmacol, 782, 70-76, 2016; TM. et al., "Synthesis and pharmacology of benzoxazines as highly selective antagonists of the M(4) muscarinic receptor," J Med. Chem, 45, 3094-3102, 2002). Summary of the invention

[0007] In one aspect, the present invention relates to compounds useful as muscarinic acetylcholine receptor subtype 4 (M4) antagonists. M4 antagonist compounds are preferably selective (i.e., specific) for M4 at least to some extent compared to other muscarinic acetylcholine receptor subtypes (e.g., M1, M2, M3, and / or M5). The efficacy of M4-specific antagonists is believed to be due to their ability to bind to the M4 orthosteric pocket. M4 antagonist compounds are also preferably reduced in terms of blood-brain barrier penetration compared to other M4 antagonist compounds in the art (such as PD102807).

[0008] In a first group of embodiments, the M4 antagonist compound has the following structure:

[0009]

[0010] Where: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 3 , R 4 and R 5 Independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH, SCH3 and the following structure (1-1):

[0011]

[0012] The premise is R 3 , R 4 and R 5 One or two of them are structures of formula (1-1); R 6 is H or CH3; R 7 , R 8 and R 9 Independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; and wherein the compound of formula (1) includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (1).

[0013] In a specific embodiment, the compound of formula (1) has the following structure:

[0014]

[0015] wherein the R groups in the formula shown above are as defined above or below, including any specific selections provided.

[0016] The compound of formula (1) may also be a methylated salt having the following structure:

[0017]

[0018] Where: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 3 , R 4 and R 5 Independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH, SCH3 and the following structures (1-2):

[0019]

[0020] The premise is R 3 , R 4 and R 5 One or two of them are structures of formula (1-2); R 6 is H or CH3; R 7 , R 8 and R 9 are independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; X - is a negative ion that balances the positive charge of the compound; and wherein the compound of formula (1c) includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (1c).

[0021] In a specific embodiment, the methylated salt compound of formula (1c) has any of the following structures:

[0022]

[0023] Wherein the R group and X - As defined above or below, including any specific options provided.

[0024] In a second group of embodiments, the M4 antagonist compound has the following structure:

[0025]

[0026] Where: R 2is a hydrocarbon group having 1 to 3 carbon atoms; R 4 , R 5 , R 7 , R 8 and R 9 Independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; and wherein the compound of formula (2) includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (2).

[0027] In a specific embodiment, the compound of formula (2) has the following structure:

[0028]

[0029] Where R 2 As defined above or below, including any specific options provided.

[0030] In a third group of embodiments, the M4 antagonist compound has the following structure:

[0031]

[0032] Where: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 4 , R 5 , R 7 , R 8 and R 9 Independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; and wherein the compound of formula (2b) includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (2b).

[0033] In a specific embodiment, the compound of formula (2b) has the following structure:

[0034]

[0035] Where R 1 , R 2 and X - As defined above or below, including any specific options provided.

[0036] On the other hand, the present invention relates to treating a disease or condition caused by muscarinic acetylcholine receptor subtype 4 (M4) activity in a subject, the method comprising administering to the subject a pharmaceutically effective amount of an M4-specific antagonist, wherein the M4-specific antagonist is any one of the above-mentioned M4-specific antagonist compounds. In a specific embodiment, the disease or condition treated is anemia. In some embodiments, the anemia is associated with hemolysis, myelodysplastic syndrome (MDS), aging, surgery, chemotherapy or radiation therapy. In some embodiments, the M4 antagonist is administered orally to the subject. Other aspects of the present invention relate to pharmaceutical compositions containing one or more of the above-mentioned M4-specific antagonists, and the use of any one or more of these M4-specific antagonists in the preparation of a medicament for treating a disease or condition (such as anemia) caused by M4 activity in a subject.

[0037] On the other hand, the present invention relates to a method for promoting self-renewal of burst erythroid colony forming unit (BFU-E) cells, wherein the method comprises contacting BFU-E cells with an M4-specific antagonist. For example, when contacted with an M4-specific antagonist, the BFU-E cells may be located in a living (e.g., human) subject, or the BFU-E cells may be taken from a subject and contacted with an M4-specific antagonist in vitro. The M4-specific antagonist may include any M4-specific antagonist described herein. In a specific embodiment, the increased self-renewal of BFU-E cells is used to treat anemia in a subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figures 1A-1E.Muscarinic acetylcholine receptor antagonists increase erythropoiesis by regulating BFU-E self-renewal. 1A, Schematic diagram showing the chemical structure of hydroxybenzenethidium bromide (OB). 1B, Mouse BFU-E were cultured with or without 100 μM hydroxybenzenethidium bromide, and the number of cells in the culture system was counted; the cell expansion fold in cultures treated with OB was significantly higher than that in cultures not treated with OB. The mean and standard deviation (STDEV) of three replicates are shown. 1C, Cells cultured on day 14 were stained with anti-Ter119 antibody and analyzed by flow cytometry. The mean and STDEV of the percentage of Ter119+ cells of three replicates are shown; there was no difference in the percentage of Ter119+ cells in cultures treated with or without OB. 1D, Cultured cells were plated on methylcellulose medium on day 6. The number of BFU-E colonies was counted 9 days after plating. The mean and STDEV of three replicates are shown; cultures treated with OB produced significantly more BFU-E colonies than cultures not treated with OB. 1E, Human CD34+ cells were cultured with or without hydroxybenzenethidium bromide (200 μM), and the number of cells in the culture system was counted. The mean and STDEV of three replicates are shown; the fold expansion in cultures treated with OB was significantly higher than that in cultures not treated with OB. "NS" represents no statistical difference; "*" represents p<0.05 by t-test; "**" represents p<0.01 by t-test.

[0039] Figures 2A-2D.CHRM4 negatively regulates BFU-E self-renewal. Figure 2A: Expression levels of muscarinic acetylcholine receptor family members (including Chrm1, Chrm2, Chrm3, Chrm4, and Chrm5) in BFU-E, CFU-E, and erythroblast stages were measured using RNA-Seq. RPKM values ​​are shown. Figure 2B: BFU-E were infected with control virus or virus encoding shRNA targeting Chrm4. The number of GFP+ cells in the culture system was counted from day 0 to day 9. The mean and standard deviation (STDEV) of 3 replicates are shown; the cell expansion fold in GFP+Chrm4 virus shRNA-infected cells was significantly higher than that in GFP+control virus shRNA-infected cells. Figure 2C: On day 3 of culture, the expression level of Chrm4 in BFU-E infected with control virus or virus encoding shRNA targeting Chrm4 was measured using Western blotting. The mean and standard deviation (STDEV) of 3 replicates are shown; the expression of Chrm4 was significantly reduced after treatment with shRNA targeting Chrm4. Figure 2D: BFU-E were infected with control virus or virus encoding shRNA targeting Chrm4. GFP+ cells were sorted for BFU-E colony formation assay. The average and STDEV of 4 replicates are shown; the BFU-E colony formation fold in GFP+Chrm4 virus shRNA infected cells was significantly higher than that in GFP+control virus shRNA infected cells. "*" represents p<0.05 of t-test; "**" represents p<0.01, and "***" represents p<0.001 of t-test.

[0040] Figures 3A-3D.The CHRM4 pathway regulates genes important for maintaining the progenitor state of BFU-E. Figure 3A: Mouse BFU-E were cultured in the absence or presence of 100 μM forskolin. The total number of cells in the culture system was counted on day 10. The mean and STDEV of cell expansion folds of 3 replicates are shown; the cell expansion folds in cultures treated with the cAMP activator forskolin were significantly higher than those in untreated cultures. Figure 3B: Mouse BFU-E were cultured with the indicated compounds (3 nM PD102807 and 5 μM KT5720). The total number of cells in the culture system was counted on day 9. The mean and STDEV of cell expansion folds of 3 replicates are shown; the cell expansion folds in cultures treated with the PKA inhibitor KT5720 were significantly reduced compared to untreated cultures. Figure 3C: The x-axis represents the ratio of each gene expression in CFU-E relative to BFU-E, calculated as a log2 ratio. The y-axis represents the cumulative score and is plotted as a function of relative expression (x-axis). "CREB target" represents the direct target gene of CREB in BFU-E identified by ChIP-Seq. "ZFP36L2 target" represents the direct target gene of ZFP36L2 in BFU-E identified by RIP-ChIP previously reported (Zhang L. et al., Nature, 499:92-96 (2013)). "All genes" represents all genes expressed in BFU-E previously reported (Zhang L. et al., supra). P values ​​were calculated using the Kolmogorov-Smirnov test. Figure 3D: Mouse BFU-E were cultured in the absence or presence of 100 μM hydroxybenzenethyl ammonium bromide, and RNA-Seq was performed on cells cultured on day 3. CREB-ChIP-Seq was performed on BFU-E after 45 minutes of culture with 100 μM hydroxybenzenethyl ammonium bromide. The RNA-Seq results and CREB-ChIP-Seq results were combined for BETA analysis (Wang S. et al., Nat Protoc, 8: 2502-2515 (2013)). "*" represents p<0.05 of t-test, and "**" represents p<0.01.

[0041] Figures 4A-4E.Compound PD102807 promotes BFU-E self-renewal and corrects anemia in vivo. Figure 4A: Chemical structure of PD102807. Figure 4B: Mouse BFU-E were cultured with or without 3nM PD102807, and the number of cells in the culture system was counted. The mean and standard deviation (STDEV) of 9 replicates are shown; the fold expansion of BFU-E in cultures treated with OB was significantly higher than that in cultures not treated with OB. "***" represents p<0.001. Figure 4C: Mice were treated once a day by oral delivery of DMSO or 100mg / kg PD102807. Mice were injected with PHZ to induce hemolytic anemia. CBC was performed on day 6. The mean and STDEV of HCT are shown; PHZ-induced anemia was significantly improved in mice treated with PD102807 compared with the DMSO control group. Figure 4D: Shows the mean and STDEV of RBC; PHZ-induced anemia was significantly improved in mice treated with PD102807 compared with the DMSO control group. "**" represents p < 0.01. Figure 4E: At a concentration of 1×10 -9 M, 1×10 -8 M, 1×10 -7 M, 1×10 -6 M and 1×10 -5 PD102807 for M was tested in a standard binding assay with radioligand and cell membranes with receptors. Compound binding was calculated as percent inhibition of specific binding of the radiolabeled ligand to each target, and Ki values ​​were determined. PD102807 had the indicated selectivity / specificity for M4 relative to M1, M2, M3 or M5 receptors.

[0042] Figure 5 . Structures of a series of M4 antagonist compounds designated as Compounds AK.

[0043] Figure 6 . Receptor binding assay results of PD102807 and compound AK on receptors CHRM1-5 (M1-M5).

[0044] Figure 7 and 8 Results of primary mouse BFU-E culture assay. Figure 7 Results for compounds A, B, C, H, and I are shown, while Figure 8 Results are shown for compounds D, E, F, G, J, and K. Results from the mouse primary cell BFU-E culture assay showed that compound AK was roughly as potent as PD in stimulating BFU-E expansion; all compounds were potent in the low nanomolar range, with compounds B and F being slightly less potent than the others.

[0045] Fig. 9 . Pharmacokinetic profiles (plasma) and brain penetration assays of PD102807 and compounds A and B. Concentrations are shown in the upper panels, while the concentration ratios (plasma / brain) are shown in the lower panels.

[0046] Fig.10 Results of compound efficacy assays in an in vivo anemia animal model for Compound A (upper panel) and Compound B (lower panel).

[0047] Fig.11 Results of compound efficacy assays in an in vivo anemia animal model for Compound B (upper panel) and Compound I (lower panel).

[0048] Fig.12 Pharmacokinetic profile (plasma) and brain penetration assay of Compound G. Concentration plots are shown in the upper panels, while concentration ratio (plasma / brain) plots are shown in the lower panels. DETAILED DESCRIPTION

[0049] According to the present invention, it has been found herein that the muscarinic acetylcholine receptor CHRM4 pathway is a key regulator of BFU-E self-renewal. It has been demonstrated herein that muscarinic acetylcholine receptor subtype 4 antagonists promote BFU-E self-renewal and expansion, and correct anemia in hemolysis, MDS, and aging mouse models. Therefore, the present invention provides the use of M4-specific antagonists in therapeutic methods for treating anemia.

[0050] Muscarinic acetylcholine receptor

[0051] Muscarinic acetylcholine receptors are members of the G protein-coupled receptor family, i.e., these receptors form G protein receptor complexes on the cell membrane after binding to a ligand (acetylcholine), thereby triggering downstream signal transduction. Five subtypes of muscarinic receptors have been identified, named M1 to M5 (see, e.g., Felder et al., FASEB J.: Off. Publ. Fed. Am. Soc. Exp. Biol. 9, 619–625 (1995)). M1, M3, and M5 receptors are mainly coupled to Gq / G11 type G proteins, and the formation of G protein-receptor complexes leads to the formation of diacylglycerol, which activates protein kinase C and increases the release of inositol triphosphate (IP3), leading to the release of free Ca2+ in the cell. M2 and M4 receptors are mainly coupled to Gi / Go type G proteins, and play an inhibitory role in cAMP generation (Felder et al. (1995), supra).

[0052] The muscarinic acetylcholine receptor includes seven transmembrane domains connected by alternating intracellular and extracellular loops. Although the M1-M5 receptor subtypes show a high degree of sequence identity to each other, studies have revealed structural differences in the shape of the orthosteric pocket (Bonner et al., Science, 237:527-532 (1987)); Caulfield et al., Pharmacol. Rev., 50:279-290 (1998); and Hulme et al., Annu. Rev. Pharmacol. Toxicol., 30:633-673 (1990)), as well as pharmacological differences in agonist or antagonist binding (Bohme et al., J. Med. Chem., 45:3094-3102 (2002); and Croy et al., Europ. J. Pharmacol, 782:70-76 (2016)). Consistent with these structural and pharmacological differences, subtype-specific antagonists have been developed and documented.

[0053] M4-specific antagonists

[0054] As used herein, the term "antagonist" of a muscarinic acetylcholine receptor refers to a compound that is able to bind to a muscarinic acetylcholine receptor but does not trigger downstream signal transduction (e.g., protein coupling and / or activation). Thus, an antagonist of a muscarinic acetylcholine receptor competes with the natural ligand acetylcholine when binding to the receptor, thereby interfering with, blocking, or otherwise preventing the binding of acetylcholine to the receptor, and inhibiting the biological activity of the muscarinic acetylcholine receptor. In some embodiments, inhibition of the biological activity of a muscarinic acetylcholine receptor is reflected by inhibition of G protein activation. G protein activation can be achieved by inhibiting the non-hydrolyzable GTP-γ-[ 35 S] as described by Croy et al., Europ. J. Pharmacol, 782:70-76 (2016).

[0055] The term "M4-specific" antagonist refers to an antagonist that exhibits a preference for binding to M4 relative to other muscarinic acetylcholine receptor subtypes (i.e., M1-M3 and M5). In some embodiments, the preference for binding to M4 is reflected by an affinity for M4 that is higher than an affinity for other receptor subtypes. In specific embodiments, the affinity of an M4-specific antagonist for M4 is at least 50%, 60%, 70%, 80%, 90%, or 100% greater than its affinity for one or more other receptor subtypes (e.g., M1, M2, M3, and / or M5), wherein "100% greater" is equivalent to 1 or 2 times greater than its affinity. In some embodiments, the affinity of an M4-specific antagonist for M4 is at least 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times greater than its affinity for one or more other receptor subtypes.

[0056] The term "selectivity" as used herein refers to an antagonist having an affinity for one receptor subtype greater than an affinity for another receptor subtype. Selectivity can be determined based on the ratio of the binding affinities of the compared receptors. For example, the selectivity of an antagonist between M4 and M2 is measured by the ratio of the binding affinity of M4 relative to the binding affinity of M2. As another example, the selectivity of an antagonist between M4 and M3 is measured by the ratio of the binding affinity of M4 relative to the binding affinity of M3. Since Ki is negatively correlated with binding affinity, selectivity can also be determined based on the ratio of the Ki of M2 or M3 to the Ki of M4, wherein a ratio greater than 1 indicates that M4 is superior to M2 or M3. In a specific embodiment, the selectivity of an M4-specific antagonist is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 times that of one or more other receptor subtypes.

[0057] Methods for measuring the binding affinity of compounds for muscarinic acetylcholine receptors have been documented in the art; for example, by using [3H]NMS binding from membranes of transfected CHO cells. See Bohme et al. (J. Med. Chem, 2002, 45: 3094-3192), Dorje et al. (J. Pharmacol. Exp. Ther., 1991, 256: 727-733) and Buckley et al. (Mol. Pharmacol., 1989, 35: 469-476). The Ki value (i.e., equilibrium dissociation constant) of the test compound is derived from the IC50 value by the Cheng-Prusoff equation, Ki = IC50 / (1+L / Kd). The lower the Ki value, the higher the affinity. In contrast, pKi is the negative logarithm of Ki, so the higher the pKi value, the higher the affinity.

[0058] In some embodiments, the M4-specific antagonist has a pKi value of 6.0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8.5, 8.75, 9.0 or more for binding to M4. In some embodiments, the M4-specific antagonist has a pKi value of 6.0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.75, 8.0, 8.25, 8.5, 8.75, 9.0 or more and is at least 30, 40, 50, 60, 70, 80, 90, 100-fold selective for M4 over one or more other receptor subtypes.

[0059] In one group of embodiments, the M4 antagonist compound has the following structure:

[0060]

[0061] In the above formula (1), the variable R 1 and R 6 are independently selected from hydrogen atoms (H) and methyl groups (CH3) (ie, each is H or CH3), the variable R 2 is a hydrocarbon group having 1 to 3 carbon atoms (eg, methyl, ethyl, n-propyl, isopropyl, cyclopropyl, vinyl or propen-2-yl); the variable R 3 , R 4 and R 5 Independently selected from hydrogen atoms, halogen atoms (i.e., F, Cl, Br or I), CH3, CF3, OH, OCH3, SH, SCH3 and the following structure (1-1):

[0062]

[0063] The premise is R 3 , R 4 and R 5 One or two of them are structures of formula (1-1). In some embodiments, R 3 , R 4 and one of R5 is a structure of formula (1-1). In other embodiments, R 3 , R 4 and R 5 Two of them (for example, R 3 and R 4 ; or R 3 and R 5 ; or R 4 and R 5 ) is the structure of formula (1-1). The variable R in formula (1-1) 7 , R 8 and R 9are independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3. 3 , R 4 and R 5 When two of them are structures of formula (1-1), R in formula (1-1) 7 , R 8 and R 9 The two instances of formula (1-1) may be the same or different (ie, independently selected). Formula (1) also includes pharmaceutically acceptable salts, solvates, enantiomers, and polymorphs of the compound of formula (1).

[0064] In the first group of embodiments of formula (1), R 1 H and R 2 is methyl, ethyl, n-propyl or isopropyl; or R 1 H and R 2 is methyl or ethyl; or R 1 H and R 2 In the second embodiment of formula (1), R 1 is methyl and R 2 is methyl, ethyl, n-propyl or isopropyl; or R 1 is methyl and R 2 is methyl or ethyl; or R 1 is methyl and R 2 In the third group of embodiments of formula (1), at least or only R 3 Formula (1-1) and R 4 and / or R 5 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 3 Formula (1-1) and R 4 and / or R 5 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 3 Formula (1-1) and R 4 and R 5 In the fourth embodiment of formula (1), at least or only R 4 Formula (1-1) and R 3 and / or R 5 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 4 Formula (1-1) and R 3 and / or R 5 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 4 Formula (1-1) and R 3 and R5 In the fifth group of embodiments of formula (1), at least or only R 5 Formula (1-1) and R 3 and / or R 4 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 5 Formula (1-1) and R 3 and / or R 4 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 5 Formula (1-1) and R 3 and R 4 In some embodiments, any of the first or second embodiments provided above are combined with any of the third, fourth, or fifth embodiments provided above. In any combination of the above embodiments, R 6 Can be selected as H or CH3. In any combination of the above embodiments, R in formula (1-1) 7 , R 8 and R 9 is independently selected from hydrogen atom, halogen atom, CH3, CF3, OH, OCH3, SH and SCH3; or R in formula (1-1) 7 , R 8 and R 9 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R in formula (1-1) 7 , R 8 and R 9 One, two or all of them are hydrogen atoms.

[0065] In a specific embodiment, the compound of formula (1) has the following structure, wherein at least R 3 The structure selected is formula (1-1):

[0066]

[0067] In the above formula (1a), any one of the first, second and third embodiments, and their combinations with each other, and R as described in the above formula (1) 6 , R 7 , R 8 and R 9 Any combination of the specific options is possible.

[0068] In a specific embodiment, the compound of formula (1a) has the following structure:

[0069]

[0070] In the above formula (1b), as described above for R of formula (1) 1 and R 2 Any one of the first and second embodiments is possible.

[0071] In some embodiments, the compound of formula (1) is a methylated salt having the following structure:

[0072]

[0073] Where: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 3 , R 4 and R 5 Independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH, SCH3 and the following structures (1-2):

[0074]

[0075] The premise is R 3 , R 4 and R 5 One or two of them are structures of formula (1-2); R 6 is H or CH3; R 7 , R 8 and R 9 are independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3. 3 , R 4 and R 5 When two of them are structures of formula (1-2), R in formula (1-2) 7 , R 8 and R 9 The variable X may be the same or different (ie, independently selected) between two instances of formula (1-1). - It is a negative ion that balances the positive charge of the compound. Formula (1c) also includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (1c).

[0076] In the first group of embodiments of formula (1c), R 1 H and R 2 is methyl, ethyl, n-propyl or isopropyl; or R 1 H and R 2 is methyl or ethyl; or R 1 H and R 2 In the second embodiment of formula (1c), R 1 is methyl and R 2is methyl, ethyl, n-propyl or isopropyl; or R 1 is methyl and R 2 is methyl or ethyl; or R 1 is methyl and R 2 In the third group of embodiments of formula (1c), at least or only R 3 Formula (1-2) and R 4 and / or R 5 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 3 Formula (1-2) and R 4 and / or R 5 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 3 Formula (1-2) and R 4 and R 5 In the fourth group of embodiments of formula (1c), at least or only R 4 Formula (1-2) and R 3 and / or R 5 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 4 Formula (1-2) and R 3 and / or R 5 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 4 Formula (1-2) and R 3 and R 5 In the fifth group of embodiments of formula (1c), at least or only R 5 Formula (1-2) and R 3 and / or R 4 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 5 Formula (1-2) and R 3 and / or R 4 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 5 Formula (1-2) and R 3 and R 4 In some embodiments, any of the first or second embodiments provided above are combined with any of the third, fourth, or fifth embodiments provided above. In any combination of the above embodiments, R 6 Can be selected as H or CH3. In any combination of the above embodiments, R in formula (1-2) 7 , R 8 and R 9is independently selected from hydrogen atom, halogen atom, CH3, CF3, OH, OCH3, SH and SCH3; or R in formula (1-2) 7 , R 8 and R 9 is independently selected from hydrogen atom, halogen atom, CH3 and CF3; or R in formula (1-2) 7 , R 8 and R 9 One, two or all of them are hydrogen atoms.

[0077] In a specific embodiment, the methylated salt compound of formula (1c) has the following structure:

[0078]

[0079] In the above formula (1d), any one of the first, second and third embodiments, and their combinations with each other, and R described in the above formula (1c) 6 , R 7 , R 8 and R 9 Any combination of the specific selections is possible.

[0080] In a specific embodiment, the compound of formula (1c) has the following structure:

[0081]

[0082] In the above formula (1e), as in the above formula (1c), R 1 and R 2 Any of the first and second embodiments described are possible.

[0083] In other embodiments, the compound of formula (1) has the following structure, wherein at least R 4 The structure selected is formula (1-1):

[0084]

[0085] In the above formula (1f), any one of the first, second and fourth embodiments, and their combination with each other, and R described in the above formula (1) 6 , R 7 , R 8 and R 9 Any combination of the specific selections is possible.

[0086] In a specific embodiment, the compound of formula (1f) has the following structure:

[0087]

[0088] In the above formula (1g), as described above in formula (1), R 1 and R 2 Either of the first and second embodiments described is possible.

[0089] In other embodiments, the compound of formula (1) has the following methylated salt structure, wherein at least R 4 The structure selected is formula (1-1):

[0090]

[0091] In the above formula (1h), any one of the first, second and fourth embodiments, and their combinations with each other, and R described in the above formula (1) 6 , R 7 , R 8 Any combination of specific choices of and R9 is possible.

[0092] In a specific embodiment, the compound of formula (1h) has the following structure:

[0093]

[0094] In the above formula (1i), as described above for R under formula (1c) 1 and R 2 Either of the first and second embodiments described is possible.

[0095] In other embodiments, the compound of formula (1) has the following structure, wherein at least R 5 The structure selected is formula (1-1):

[0096]

[0097] In the above formula (1j), any one of the first, second and fifth embodiments, and their combinations with each other, and R described in the above formula (1) 6 , R 7 , R 8 and R 9 Any combination of the specific selections is possible.

[0098] In a specific embodiment, the compound of formula (1j) has the following structure:

[0099]

[0100] In the above formula (1k), as above in formula (1) for R 1 and R 2 Any one of the first and second embodiments described is possible.

[0101] In other embodiments, the compound of formula (1) has the following methylated salt structure, wherein at least R 5 The structure selected is formula (1-1):

[0102]

[0103] In the above formula (1m), any one of the first, second and fifth embodiments, and their combinations with each other, and R described in the above formula (1) 6 , R 7 , R 8 and R 9 Any combination of the specific selections is possible.

[0104] In a specific embodiment, the compound of formula (1m) has the following structure:

[0105]

[0106] In the above formula (1n), as in the above formula (1c), R 1 and R 2 Either of the first and second embodiments described is possible.

[0107] In another group of embodiments, the M4 antagonist compound has the following structure:

[0108]

[0109] In the above formula (2), R 2 , R 4 , R 5 , R 7 , R 8 and R 9 The definition of is as described in the above formula (1). Formula (2) also includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (2). In the first group of embodiments of formula (2), R 2 is methyl, ethyl, n-propyl or isopropyl; or R 2 is methyl or ethyl; or R 2 In the second embodiment of formula (2), R 4 and R 5 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 4 and R 5 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 4 and R 5In some embodiments, any of the first or second embodiments provided above are combined. In any combination of the above embodiments, R 7 , R 8 and R 9 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 7 , R 8 and R 9 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 7 , R 8 and R 9 One, two or all of them are hydrogen atoms.

[0110] In a specific embodiment, the compound of formula (2) has the following structure:

[0111]

[0112] In a specific embodiment of the above formula (2a), R 2 is methyl, ethyl, n-propyl or isopropyl; or R 2 is methyl or ethyl; or R 2 It is ethyl.

[0113] In another group of embodiments, the M4 antagonist compound has the following structure:

[0114]

[0115] In the above formula (2b), R 1 , R 2 , R 4 , R 5 , R 7 , R 8 and R 9 The definition of is as described above in formula (1). Formula (2b) also includes pharmaceutically acceptable salts, solvates, enantiomers and polymorphs of the compound of formula (2b). In some embodiments, formula (2b) represents a racemic mixture; in other embodiments, formula (2b) represents a single enantiomer, which can be designated as R or S, or (+) or (-) optical form. Variable X - A negative ion that balances the positive charge of a compound.

[0116] In the first group of embodiments of formula (2b), R 1 H and R 2 is methyl, ethyl, n-propyl or isopropyl; or R 1 H and R 2 is methyl or ethyl; or R 1 H and R2 In the second embodiment of formula (2b), R 1 is methyl and R 2 is methyl, ethyl, n-propyl or isopropyl; or R 1 is methyl and R 2 is methyl or ethyl; or R 1 is methyl and R 2 In the third embodiment of formula (2b), R 4 and R 5 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 4 and R 5 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 4 and R 5 In some embodiments, any one of the first or second embodiments described above is combined with any one of the third group of embodiments. In any combination of the above embodiments, R 7 , R 8 and R 9 independently selected from hydrogen atoms, halogen atoms, CH3, CF3, OH, OCH3, SH and SCH3; or R 7 , R 8 and R 9 are independently selected from hydrogen atoms, halogen atoms, CH3 and CF3; or R 7 , R 8 and R 9 One, two or all of them are hydrogen atoms.

[0117] In a specific embodiment, the compound of formula (2b) has the following structure:

[0118]

[0119] In the above formula (2c), as described above for R under formula (2b) 1 and R 2 Either of the first and second embodiments described is possible.

[0120] In some embodiments, the M4-specific antagonist has at least 6.0×10 -6 pKi of M. In some embodiments, the M4-specific antagonist is at least 5-fold, 10-fold, 15-fold, 20-fold, or 25-fold selective for any one, two, three, or all of M1 / M4, M2 / M4, M3 / M4, and M5 / M4.

[0121] The compounds described herein can be formed and / or used as pharmaceutically acceptable salts. Pharmaceutically acceptable salts can be produced by reacting neutral compounds (i.e., ring nitrogens with indolyl and / or isoquinolinyl rings) with electrophilic organic species or pharmaceutically acceptable organic or inorganic acids. In this way, one or both of the indolyl and / or isoquinolinyl ring nitrogens are protonated or alkylated. Some examples of electrophilic organic species include alkyl halides, such as methyl bromide, ethyl bromide, n-propyl bromide and isopropyl bromide. Some examples of organic acids include acetic acid, propionic acid, butyric acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, malic acid, citric acid, succinic acid, maleic acid, tartaric acid, fumaric acid, trifluoroacetic acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, toluenesulfonic acid, 2-naphthalenesulfonic acid, 3-phenylpropionic acid, trimethylacetic acid, gluconic acid, glutamic acid, salicylic acid, hydroxynaphthoic acid, stearic acid, mucic acid, etc. Some examples of inorganic acids include hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, metaphosphoric acid, etc. Anions (X - ) can be any anion associated with the above-mentioned acid or electrophilic species, or the anion can be generated by exchanging it with any other pharmaceutically acceptable anion in the art.

[0122] In some embodiments, when R 6 When R is a hydrogen atom, a pharmaceutically acceptable salt may be 6 Deprotonation is usually carried out by reacting a neutral compound with a base of appropriate strength to deprotonate phenol (i.e. -OR 6 For example, the base may be a hydroxide of an alkali metal (such as lithium, sodium, potassium), a hydroxide of an alkaline earth metal (such as magnesium or calcium), or a hydroxide of aluminum.

[0123] Any of the above compounds may also be solvates. As known in the art, solvates are adducts of compounds and one or more solvent molecules. For the purposes of the present invention, solvent molecules should be pharmaceutically acceptable. Some examples of pharmaceutically acceptable solvent molecules include water, alcohols (e.g., ethanol) and glycols (e.g., ethylene glycol and propylene glycol). In the case where the solvent molecule is water, solvates are generally referred to as hydrates. The compound may also be in any polymorphic form, e.g., amorphous, monocrystalline or polycrystalline. The crystalline form may also be one of several possible crystalline forms controlled by, for example, crystal packing and crystal (symmetry) space groups. Drug solvates, hydrates, polymorphs and crystalline forms are described in, for example, AM Healy et al., Advanced Drug Delivery Reviews, 117, 25-46, 2017 and SL Morissette et al., Advanced Drug Delivery Reviews, 56, 275-300, 2004, the entire contents of which are incorporated herein by reference.

[0124] Pharmaceutical composition containing M4 specific antagonist

[0125] Typically, in order to make the M4 antagonist compound administrable to a subject, the compound is formulated with one or more pharmaceutically acceptable carriers (additives) and / or diluents, which are well known in the field of pharmaceutical compositions. The pharmaceutical compositions of the present invention can be specifically formulated for administration in solid or liquid form, including those suitable for the following situations: (1) oral administration, for example, liquid medicine (aqueous or non-aqueous solution or suspension), tablet (e.g., tablet for oral, sublingual and systemic absorption), pill, powder, granule, paste applied to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection, for example, as a sterile solution or suspension or sustained release preparation; (3) topical application, for example, cream, ointment or controlled release patch or spray applied to the skin; (4) sublingual administration; (5) ocular administration; (6) transdermal administration; or (7) nasal administration.

[0126] The phrase "pharmaceutically acceptable" used herein refers to compounds, materials, compositions and / or dosage forms suitable for entering living organisms or living biological tissues, preferably without significant toxicity, irritation or allergic reactions, within the scope of reasonable medical judgment. As used herein, the phrase "pharmaceutically acceptable carrier" generally refers to a pharmaceutically acceptable composition, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium stearate or zinc stearate or stereo acid) or solvent encapsulation material, for introducing an active agent into the body. Each carrier must be "acceptable", i.e. compatible with the other ingredients of the preparation and harmless to the patient. Examples of suitable aqueous and non-aqueous carriers that can be used for the pharmaceutical composition of the present invention include, for example, water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), vegetable oils (such as olive oil) and injectable organic esters (such as ethyl oleate), and suitable mixtures thereof. For example, a coating material (such as lecithin) can be used, by maintaining the desired particle size in the case of dispersion and by using a surfactant to maintain appropriate fluidity.

[0127] Other examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethylcellulose, ethyl cellulose and cellulose acetate; (4) tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients such as cocoa butter and suppository waxes; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) dimethicone; and (11) dapoxetine. Alcohols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffer solutions; (21) polyesters, polycarbonates and / or polyanhydrides; and (22) other non-toxic compatible substances used in pharmaceutical formulations.

[0128] Tablets can be made by compression or molding, optionally containing one or more auxiliary ingredients. Compressed tablets can be prepared using a binder (e.g., gelatin or hydroxypropyl methylcellulose), a lubricant, an inert diluent, a preservative, a disintegrant (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), a surfactant or a dispersant. Other solid dosage forms of tablets and active agents, such as capsules, pills and granules, can optionally be scored or prepared with coatings and shells (such as enteric coatings and other coatings well known in the field of pharmaceutical formulations). Dosage forms can also be formulated to provide a slow or controlled release of active ingredients therein, using, for example, different proportions of hydroxypropyl methylcellulose to provide a desired release profile, other polymer matrices, liposomes and / or microspheres. The dosage form can also be formulated to release quickly.

[0129] Uses of M4-specific antagonists

[0130] In one embodiment, an M4-specific antagonist is administered to a subject to treat a disease or condition caused by muscarinic acetylcholine receptor subtype 4 (M4) activity, such as anemia. As used herein, the terms "treating" or "treatment" include amelioration of a disease or condition, slowing progression, correction, prevention, or delaying recurrence. For example, anemia treatment can reduce the severity of anemia, including one or more symptoms associated with anemia (e.g., fatigue, shortness of breath), as reflected by restoring or maintaining hemoglobin, hematocrit, and / or red blood cell (RBC) count levels.

[0131] In some embodiments, the method of treating anemia or other diseases or conditions is achieved by administering a pharmaceutically effective amount of an M4 antagonist to a subject in need thereof. The M4 specific antagonist can be any of the above-mentioned M4 antagonist compounds, including any structure within the scope of formula (1) and (2) and subformulas therein.

[0132] Subjects in need of this treatment include any subject, in particular human subjects who suffer from or are likely to suffer from anemia or other diseases or conditions caused by M4 activity. In some embodiments, the subject suffers from Epo-resistant anemia, which is an anemia in which the administration of Epo does not result in a desired response or is not expected to result in a desired response. Whether the subject's anemia is resistant to EPO can be determined by assessing the subject's Hb or hematocrit after standard treatment with recombinant human Epo. For example, if the subject fails to reach a level of at least 12g / dLHb after receiving standard treatment with recombinant human erythropoietin (Epo), fails to achieve an increase in Hb levels of more than 2g / dL, or fails to maintain an Hb concentration of at least 10g / dL, the subject's anemia is considered to be Epo-resistant anemia. As another example, if the subject fails to increase the hematocrit by at least 30%, 32%, 34%, 36% or 38% after receiving standard treatment with recombinant human Epo, the subject's anemia is considered to be Epo-resistant anemia.

[0133] Anemia in a subject may be caused by different reasons. In some embodiments, anemia in a subject is associated with hemolysis (i.e., hemolytic anemia). In some embodiments, anemia in a subject is associated with myelodysplastic syndrome (MDS). In some embodiments, anemia in a subject is associated with aging. Therefore, in some embodiments, the present treatment is provided to a human subject at least 60, 65, 70, 75, 80, or 85 years old. In other embodiments, anemia is expected; for example, in a subject expected to receive surgery, chemotherapy, or radiation therapy. M4 antagonists can also be used to treat conditions or diseases that do not technically meet the anemia condition but are characterized by anemia-like symptoms. The hemolytic model can confirm the general anti-anemic activity of the compound in vivo.

[0134] A therapeutically effective amount (i.e., a therapeutically effective dose) of an M4-specific antagonist is administered to a subject in need of an M4-specific antagonist. As used herein, the term "therapeutically effective amount" or "therapeutically effective dose" corresponds to the amount of an active agent that is effective for providing any of the above-mentioned desired therapeutic effects, preferably without substantial toxic effects on the subject. In a specific embodiment, an effective amount is sufficient to achieve an increase in Hb, hematocrit, or RBC count to a desired level or an increase in Hb, hematocrit, or RBC count by a desired amount, or more specifically, to achieve an amount that alleviates one or more anemia symptoms. The exact effective dose may vary depending on the structure and pharmacological properties of the compound. It may be useful to evaluate an M4-specific antagonist, for example, by evaluating its effect on the self-renewal and amplification of BFU-E in culture, and its pharmacological characteristics (e.g., half-life in plasma), so as to determine the effective amount of such an antagonist. In some embodiments, an M4-specific antagonist is administered in a single dose. In some embodiments, an M4-specific antagonist is administered in multiple doses, for example, 2, 3 or more times per day, every other day, every week, every two weeks, or every month. In particular, for systemic administration, for example, the dosage may be in the range of about 0.01, 0.1, 0.5, 1, 5 or 10 mg per kg of body weight per day to about 20, 50, 100, 500 or 1000 mg per kg of body weight per day, or twice, three times, four times or more per day. In general, the effective amount of a small molecule compound may be in the range of 1 μg to 5000 mg, 10 μg to 1000 mg, 10 μg to 10 mg, 100 μg to 500 μg, once or more per day, per week or per month. In some embodiments, the dosage range may be about 1, 5, 10, 20, 50, 100 μg / kg / day, or 1, 5, 10, 15, 20, 50, 100, 150, 200 mg / kg / day, or any numerical range between the prescribed dosages.

[0135] The M4-specific antagonist can be administered to the subject by standard routes, including oral, nasal, transdermal, parenteral (eg, intravenous, intraperitoneal, intradermal, subcutaneous, or intramuscular) routes. In a specific embodiment, the M4-specific antagonist is administered to the subject via oral administration.

[0136] The M4-specific antagonist may be provided or mixed with a pharmaceutically acceptable carrier for appropriate administration. As described above, pharmaceutically acceptable carriers include any and all solvents, dispersion media, isotonic agents, and the like. The carrier may be a liquid, a semisolid, such as a paste, or a solid carrier. Examples of carriers include oils, water, saline solutions, alcohols, sugars, gels, lipids, liposomes, resins, porous matrices, adhesives, fillers, coatings, preservatives, and the like, or combinations thereof.

[0137] In other embodiments, an M4-specific antagonist is used to promote the self-renewal of a BFU-E cell by contacting the BFU-E cell with an M4-specific antagonist. For example, when contacted with an M4-specific antagonist, the BFU-E cell may be located in a living (e.g., human) subject, or the BFU-E cell may be taken from the subject and contacted with an M4-specific antagonist in vitro. The M4-specific antagonist may be any M4-specific antagonist, including any of the M4-specific antagonists described above. In a specific embodiment, the increased self-renewal of BFU-E cells is used to treat anemia in a subject. In some embodiments, the self-renewal of BFU-E cells is increased by at least 50%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more due to contact with an M4-specific antagonist.

[0138] In order to illustrate and describe some specific embodiments of the present invention, some embodiments are enumerated below. However, the scope of the present invention is not limited by the embodiments described herein in any way. The content of all references cited (including document references cited in this application, disclosed patents and disclosed patent applications) is clearly incorporated by reference at this time.

[0139] Example 1.

[0140] This example describes experiments performed to investigate the role of the muscarinic acetylcholine receptor CHRM4 pathway in BFU-E self-renewal and the effects of the small molecule muscarinic acetylcholine receptor inhibitor hydroxybenzenephthalium bromide on anemia in a mouse model.

[0141] result

[0142] To identify G protein-coupled receptors ("GPCRs") that regulate BFU-E self-renewal, genome-wide gene expression profiles were analyzed, focusing on GPCRs that are abundantly expressed in BFU-E. To further narrow the candidate list to the GPCRs that are most likely to be functionally important in regulating BFU-E self-renewal and differentiation, the inventors took advantage of the concept that differentiation and self-renewal are two opposite cell fates that may have contrasting gene expression profiles.

[0143] Of the 358 druggable GPCRs examined, three GPCRs, including P2ry2, Gpr124, and Calcrl, were found to be downregulated during BFU-E differentiation and upregulated during self-renewal; three GPCRs, including Chrm4, Fzd5, and Darc, were upregulated during BFU-E differentiation and downregulated during self-renewal. For GPCRs upregulated during BFU-E self-renewal, small compounds were tested as agonists of these GPCRs; for GPCRs downregulated during BFU-E self-renewal, antagonists were tested for their ability to promote BFU-E self-renewal and expansion. Of all the small compounds tested, two closely related muscarinic acetylcholine receptor antagonists, hydroxyphenethylammonium bromide and orphenadrine citrate, triggered the expansion of BFU-E (Figures 1A-1B).

[0144] It has been previously demonstrated that one BFU-E can produce approximately 500 erythrocytes. When cultured in the presence of 100 μM hydroxyethylammonium bromide, BFU-E underwent extended expansion, resulting in the production of approximately 10 times more erythrocytes (Figures 1A-1B). After 12 days of culture, most of the cultured cells underwent terminal differentiation, and there was no difference in the percentage of Ter119+ differentiated cells under culture conditions with or without hydroxyethylammonium bromide, indicating that all cells were Ter119+ differentiated erythrocytes under culture conditions with or without hydroxyethylammonium bromide (Figure 1C). As shown in Figure 1D, BFU-E cultured on day 6 were inoculated on methylcellulose culture medium, and the number of BFU-E colonies formed was counted after 9 days. The presence of hydroxyethylammonium bromide triggered approximately 2-fold BFU-E colony formation. In a human CD34+ hematopoietic stem cell and progenitor cell (HSPC) culture system, hydroxyethylammonium bromide also promoted approximately 2 to 4-fold expansion of erythrocytes (Figure 1E). Taken together, this suggests that the muscarinic acetylcholine receptor antagonist hydroxyphenethylammonium bromide increases erythropoiesis by promoting BFU-E self-renewal.

[0145] It is shown herein that Chrm4 is the most abundant member of the muscarinic acetylcholine receptor family expressed in BFU-E (Fig. 2A). Of all the cell types tested, erythroid progenitors were found to have the second most abundant expression of Chrm4, just after retinal cells where the functional role of Chrm4 is well established. Chrm4 was found to be upregulated during erythroid differentiation from the BFU-E to CFU-E stages and downregulated during self-renewal (Fig. 2A). As shown in Fig. 2B-2D, knocking out Chrm4 using two independent shRNAs targeting Chrm4 promoted BFU-E expansion. A BFU-E infected with a control shRNA encoded by a virus produced approximately 100 erythroid cells, while a BFU-E infected with a virus encoding a shRNA targeting Chrm4 produced approximately 3-5 times as many erythroid cells. This summarizes the positive effect of hydroxybenzyl bromide on BFU-E expansion (Fig. 1B). Consistently, knockout of Chrm4 also upregulated the expression of self-renewal markers, such as Zfp36l2.

[0146] It has been reported that muscarinic acetylcholine antagonists inhibit the CHRM4 pathway by increasing cyclic adenosine monophosphate (cAMP) levels and regulating the CREB transcriptional program (Kruse et al., Nat Rev Drug Discov, 13, 549-560 (2014); Wess et al., Nat Rev Drug Discov, 6, 721-733 (2007); Shaywitz, Annu Rev Biochem, 68, 821-861 (1999)). Consistently, it was shown herein that culturing BFU-E with the adenylate cyclase activator forskolin promoted BFU-E expansion (Figure 3A). In addition, phosphorylated CREB showed an increase in nuclear localization after treatment with hydroxybenzenethidium bromide (Figure 3B). These results suggest that CREB may serve as a factor in regenerating and correcting the exhaustion of stem and progenitor cells in the elderly.

[0147] To identify direct target genes of CREB, ChIP-Seq was performed on BFU-E. It is reported that the RNA binding protein ZFP36L2 preferentially binds to the mRNA of genes induced during erythroid differentiation and triggers their degradation, thereby contributing to self-renewal. In contrast to ZFP36L2, CREB was found to preferentially bind to genomic sites near genes highly expressed in BFU-E (Figure 3C) and trigger the upregulation of these genes (Figure 3D), through which CREB is thought to contribute to the maintenance of the BFU-E progenitor state. These genes include the transcription factor Gata2 (Tsai et al., Blood, 89, 3636-3643 (1997)) sufficient to induce erythroid progenitor expansion and the RNA binding protein Zfp36l2 (Zhang et al., Nature, 499, 92-96 (2013)) indispensable for maintaining the BFU-E progenitor state. Together, these results suggest that the CHRM4-CREB pathway promotes BFU-E self-renewal by upregulating the expression of genes important for maintaining the BFU-E progenitor state.

[0148] In summary, the above experiments show that the muscarinic acetylcholine receptor CHRM4 pathway is a key regulator of BFU-E self-renewal; the muscarinic acetylcholine receptor antagonist hydroxybenzenethyl bromide triggers BFU-E self-renewal and expansion. The experiments also showed that muscarinic acetylcholine receptor antagonists can correct anemia in vivo in hemolytic, MDS and aging mouse models. In addition, the experiments showed that the downstream transcription factor CREB mediates the role of muscarinic acetylcholine receptors in promoting BFU-E self-renewal.

[0149] Materials and methods

[0150] Primary mouse BFU-E were isolated from mouse embryonic day 14.5 (E14.5) fetal liver and cultured in StemSpan serum-free expansion medium, and the number of cells formed was counted during culture. BFU-E were infected with a virus encoding a control shRNA or a virus encoding a shRNA targeting Chrm4, and the number of GFP+ cells formed during culture was counted. DMSO or 25 mg / kg hydroxybenzenethamide was injected intraperitoneally into the hemolytic mouse model, Mx1-cre Srsf2 P95H / WT MDS mouse model, and the aging mouse model. A complete blood cell count (CBC) was performed after compound injection. CREB ChIP-Seq was performed on BFU-E after 45 minutes of culture with 100 μM hydroxybenzenethamide. RNA-Seq was performed on BFU-E after 3 days of culture with DMSO or hydroxybenzenethamide.

[0151] BFU-E Isolation and Culture System

[0152] BFU-E were isolated from mouse embryonic day 14.5 fetal liver using a previously described fluorescence activated cell sorting (FACS) method (Flygare et al., Blood, 117, 3435-3444 (2011)). BFU-E were cultured in StemSpan SFEMII medium containing rmSCF (100 ng / ml), EPO (2 U / ml), rmIGF-1 (40 ng / ml), dexamethasone (1 nmol / ml or 10 nmol / ml), hydroxybenzyl bromide (100 μmol / ml) and o-phenhydramine citrate (1 μmol / ml).

[0153] BFU-E colony formation, Ter119 antibody staining and retroviral infection assays

[0154] After 3 days of culture, the cultured cells were inoculated in methylcellulose medium Methocult SF M3436, and BFU-E colonies were counted 9 days later. On the 14th day of culture, the cultured cells were stained with Ter119 APC antibody, and the percentage of Ter119+ cells was determined by flow cytometry. For retroviral infection, BFU-E were infected with viruses encoding control shRNA or shRNA targeting Chrm4.

[0155] Human CD34+ cell culture, counting and colony formation assay

[0156] In StemSpan TM Human CD34+ hematopoietic stem and progenitor cells (HSPCs) were cultured in SFEM medium containing rhSCF (20 ng / ml), rhIL-3 (5 ng / ml) and EPO (1 U / ml) as well as different concentrations of dexamethasone and orfenamide. The total number of cells was counted by flow cytometry. For colony formation assays, cells cultured on day 8 were plated in methylcellulose medium MethoCult TM In H4034 Optimum, BFU-E colonies were counted after 13 days.

[0157] PHZ-induced hemolytic anemia mouse model

[0158] 4-6 week old C57bl / 6 mice were injected intraperitoneally with control DMSO or compound daily for 3 days. On day 4, mice were injected intraperitoneally with 60 mg / kg PHZ. Mice were then injected intraperitoneally with compound or control DMSO daily for 3 days. Peripheral blood samples were collected retrogradely in blood collection tubes containing K2-EDTA using heparinized capillaries. CBC was performed using 950 in progress.

[0159] BFU-E colony formation and flow cytometric analysis of spleen cells

[0160] 4-6 week old C57bl / 6 mice were injected intraperitoneally with compound or control DMSO every day for 3 days. On the 4th day, mice were injected intraperitoneally with 60mg / kg PHZ. Then mice were injected intraperitoneally with compound or control DMSO every day for 2 days. Mouse spleens were isolated and homogenized to obtain single cell suspensions. The cell suspension was incubated with ammonium chloride solution on ice for 5 minutes to lyse red blood cells. Splenocytes were then placed in methylcellulose medium Methocult SF M3436, and BFU-E colonies were counted after 9 days, or stained with Ter119 APC antibody, followed by flow cytometry analysis.

[0161] Conditional knock-in Cre-Mx1 Srsf2 P95H / WT MDS mouse model and aging mouse model

[0162] For the MDS mouse model, bone marrow cells were obtained from freshly dissected femurs and tibiae of Mx1-cre Srsf2 fl / WT and Mx1-Cre Srsf2 P95H / WT mice as described previously (Kim et al., Cancer Cell, 27, 617-630 (2015)). 1×10 cells from Mx1-cre Srsf2 fl / WT or Mx1-Cre Srsf2 P95H / WT mice were injected into the tail vein. 6 Bone marrow cells were transplanted into lethally irradiated (450 cGy twice) CD45.1 recipient mice. Three weeks after transplantation, polyI:polyC (pIpC) was injected to induce Mx1-cre expression. After confirming the MDS disease phenotype, mice were intraperitoneally injected with compounds or control DMSO every day for 45 days. Peripheral blood samples were collected retrogradely for CBC using Hemavet 950.

[0163] For the aging mouse model, CBC was performed on 6-8 weeks or 18-21 months old C57bl / 6 mice. Mice aged 18-21 months were injected intraperitoneally with compound or control DMSO daily. Blood samples were collected on day 7 for CBC.

[0164] RNA sequencing

[0165] For RNA isolation, BFU-E were cultured in SCF (100 ng ml -1 )、EPO(2Uml -1 )、IGF-1(40ng ml -1 ) and dexamethasone (1 nM) in SFEMII at 37°C. The cells were collected on day 3 and used RNA was isolated using the mini kit (Qiagen). Sequencing libraries were generated using the RNA-Seq Sample Preparation Kit v2 (Illumina) and 2500 platform (Illumina) sequencing. STAR mapper was used to map the sequence reads back to the mouse genome (GRCm38, mm10). The read data were demultiplexed according to their adapters and used for different post-mapping analyses.

[0166] Chromatin immunoprecipitation sequencing (ChIP-Seq)

[0167] ChIP-Seq was performed using the ChIP-IT High Sensitivity Kit (Active Motif). 5 × 10 6 BFU-E. BFU-E was added to the solution containing SCF (100 ng ml -1 )、EPO(2Uml -1 ) and IGF-1 (40 ng ml -1 ) in StemSpan SFEMII medium at 37°C. Cells were treated with orphenam (100 μM) for 45 minutes. After treatment, cells were cross-linked with 1% formaldehyde solution for 15 minutes at room temperature with gentle shaking. Cross-linking was quenched with freshly prepared 2.5 M glycine solution at room temperature for 5 minutes. Cells were lysed with nuclear lysis buffer and 2000 (Diagenode) sonication for 30 minutes, 3×10 minute cycles, 30 seconds on, 30 seconds off. Take a small sample (30 μl) and reverse crosslink using proteinase K and ribonuclease A, run on a 2% agarose gel to check the size of the sonicated fragments. The sonicated DNA was then placed on a test tube rotator at 4°C overnight with IgG control (10 μg, EMD Millipore 17-600) or CREB antibody (10 μg, EMD Millipore 17-600). The DNA solution was incubated with agarose G beads at 4°C for 4 hours, and the immunoprecipitated DNA was eluted and purified using a DNA elution and purification column (Active Motif).

[0168] use Sequencing libraries were generated using the ChIP-Seq Sample Preparation Kit (Illumina). Briefly, after repairing the ends, adapters were ligated and DNA samples with adapters were purified by collecting DNA fragments between 250 and 300 bp using a size-selective 2% agarose gel electrophoresis system (Invitrogen). The purified DNA library was amplified for 18 cycles using a PCR amplification kit (Illumina) and purified using AMPure XP magnetic beads (Beckman Coulter). The DNA was analyzed using the Bioanalyzer TMThe size of the sequencing library was verified by a high-sensitivity DNA chip in 2100 (Agilent). Sequence reads were aligned to the mouse genome (GRCm38, mm10) using Bowtie2 and demultiplexed according to their adapter sequences. The MACS platform was used for peak calling. Binding and expression target analysis (BETA) was performed as previously described (Wang et al., NatProtoc, 8, 2502-2515 (2013)).

[0169] RT-PCR

[0170] For RT-PCR, reverse transcription was performed using Superscript Reverse Transcriptase III (Invitrogen). Green PCR Master Mix (Life Technologies) and 7900HT TM Real-time PCR system (Applied Biosystems) was used. Primer sequences were as follows: Gapdh, forward primer, CATGGCCTTCCGTGTTCCTA (SEQ ID NO: 1), reverse primer, GCGGCACGTCAGATCCA (SEQ ID NO: 2); Chrm4, forward primer, ATGGCGAACTTCACACCTGTC (SEQ ID NO: 3), reverse primer, CTGTCGCAATGAACACCATCT (SEQ ID NO: 4); C-Kit, forward primer, GGCCTCACGAGTTCTATTTACG (SEQ ID NO: 5), reverse primer, GGGGAGAGATTTCCCATCACAC (SEQ ID NO: 6); Zfp36l2, forward primer, AGCGGCTCCCAGATCAACT (SEQ ID NO: 7), reverse primer, CGAAAGCGAAGGCGTTGTTA (SEQ ID NO: 8).

[0171] Immunofluorescence

[0172] Freshly isolated BFU-E were serum starved for 1 hour and treated with DMSO or 100 μM orfenanil for 45 to 60 minutes. 10 μL of BFU-E were collected on poly-L-lysine coated slides using a cytospin. 4Cells were fixed with 2% paraformaldehyde for 15 minutes, then permeabilized with 0.1% Triton X-100 for 15 minutes and blocked with 2% BSA solution for 30 minutes. Cells were incubated with phosphorylated CREB antibody (phospho-S133, Abcam, ab32096, 1:250) in 2% BSA for 1 hour, and then incubated with FITC-conjugated goat anti-mouse secondary antibody (Abcam, ab97022, 1:500) and FITC-conjugated goat anti-rabbit secondary antibody (Abcam, ab97050, 1:500) in 2% BSA solution for 30 minutes. Cells were then incubated with DAPI for 5 minutes and then fixed with fixative.

[0173] Plasmids

[0174] The following oligonucleotides were annealed and cloned into the MSCV-IRES-GFP vector digested with BbsI: Chrm4shRNA1, aaaaTCTGATGAAGCCGACATTAAgtcgacTTAATGCTCGGCTTCATCAGA (SEQ ID NO: 9); Chrm4shRNA2, aaaaTCTGATGAAGCCGACATTAAgtcgacTTAATGCTCGGCTTCATCAGA (SEQ ID NO: 10).

[0175] Example-2

[0176] This example describes experiments performed to investigate whether other small molecule M4 antagonists, such as PCS1055 and PD102807, promote BFU-E self-renewal and correct anemia in vivo.

[0177] result

[0178] FIG4A shows the chemical structure of PD102807. PD102807 was found to increase the proliferation of BFU-E cells in cell culture ( FIG4B ). In addition, PD102807 was found to increase the levels of HCT and RBC when administered to mice (PD102807 was injected intravenously or orally) ( FIG4C and 4D , respectively). FIG4E shows that in a standard binding assay using a radioligand and a cell membrane with a receptor, at 1×10 -9 M, 1×10 -8 M, 1×10 -7 M, 1×10 -6 M and 1×10 -5 Results of testing PD102807 at M concentration.

[0179] Materials and methods

[0180] Mouse BFU-E Culture System

[0181] BFU-E were isolated from mouse embryonic day 14.5 fetal liver using fluorescence activated cell sorting (FACS). BFU-E were cultured in StemSpan SFEMII medium containing rmSCF (100 ng / ml), EPO (2 U / ml), rmIGF-1 (40 ng / ml), dexamethasone (1 nM) and DMSO, PCS1055 (5 nM) or PD102807 (3 nM). The number of cells formed was counted during in vitro culture.

[0182] Anemia mouse model

[0183] Animal experiments were performed at the Cold Spring Harbor Laboratory Animal Shared Resource according to procedures approved by the Institutional Animal Care and Use Committee. C57bl / 6 mice aged 4-6 weeks purchased from Jackson Laboratory were randomly assigned to compound-treated and control-treated groups and were delivered orally with PCS1055 (50 mg / kg or 100 mg / kg) twice a day or PD102807 (50 mg / kg or 100 mg / kg) once a day for 3 consecutive days. On day 3, mice were injected intraperitoneally with 60 mg / kg PHZ. Mice were then delivered orally with PD102807 (50 mg / kg or 100 mg / kg) once a day for 2 days. On day 6, peripheral blood samples were collected retrogradely in blood collection tubes containing K2-EDTA using heparinized capillaries. CBC was performed using Hemavet 950.

[0184] Synthesis and analysis of M4 antagonist compounds

[0185] A series of M4 antagonist compounds named Compound AK were synthesized and analyzed. The structures of these compounds are shown in Figure 5 shown.

[0186] Synthesis of Compound AK

[0187] Unless otherwise noted, all starting materials were used directly from commercial suppliers without further purification. All reactions were performed in oven-dried glassware using syringe and septum techniques, and NMR spectra were collected on a 500 or 600 MHz machine. Chemical shifts were recorded relative to the deuterated solvent peak or the internal standard tetramethylsilane (TMS) peak at (δ 0.00) and are reported in parts per million (ppm). 1H COSY determines the distribution of selected nuclei. The purity of the final compound is determined by HPLC analysis. Thin layer chromatography (TLC) is performed on 0.25 mm thick coated silica gel aluminum plates. TLC plates are observed under short-wave and long-wave UV light, or after iodine staining, or visualized by heating plates when exposed to tetrahydrated ammonium molybdate (VI) and tetrahydrated cerium sulfate (IV) solutions. Flash column chromatography (FCC) is performed using silica gel 60 (230-400 mesh) and a stepwise solvent polarity gradient is used, which is related to TLC flowability.

[0188] 5-Hydroxy-2-methylindole-3-carboxylic acid ethyl ester (Indole 1)

[0189]

[0190] The reaction temperature was controlled below 45°C by using an ice-water bath, and ethyl 3-aminocrotonate (16.2 g, 0.125 mole) was added in portions to a 450 mL glacial acetic acid solution of 1,4-benzoquinone (27 g, 0.25 mole). The reaction mixture was stirred at room temperature for 5 hours. The precipitated solid was washed with acetic acid and water to obtain 17 g (62%) of a gray crystalline solid, which was further washed with acetic acid to obtain a white solid with a yield of 55%. 1 HNMR(600MHz,DMSOd6)δ11.51(s,1H),8.82(s,1H),7.31(d,J=2.4Hz,1H),7.13(d,J=8.52Hz, 1H), 6.60 (dd, J=2.4, 8.6Hz, 1H), 4.24 (q, J=7.08Hz, 2H), 2.59 (s, 3H), 1.33 (t, J=7.08Hz, 3H); 13 C NMR (150MHz, DMSOd6) δ165.2,152.2,144.4,128.9,127.9,111.4,111.2,105.2,102.1,58.4,14.5,13.8.

[0191] 5-Hydroxy-1,2-dimethyl-1H-indole-3-carboxylic acid ethyl ester (Indole 2)

[0192]

[0193] Imidazole (2.0 g, 28.9 mmol) and TBDPS (3.7 mL, 14.45 mmol) were added to anhydrous DCM (100 mL) solution of indole 1 (3.0 g, 13.76 mmol). The reaction mixture was stirred at room temperature for 16 hours. After the disappearance of the starting material based on TLC, the reaction mixture was treated with 5% hydrochloric acid solution. The organic phase was washed with brine, dried over Na2SO4, filtered, and evaporated under vacuum to obtain a gray solid, which was directly used in the next step without further purification.

[0194] To the above-mentioned silylation derivative (3.2g, 7.0mmol) in anhydrous DMF (10mL) solution, NaH (60% dispersion in oil) (440mg, 10.5mmol) and MeI (0.7mL, 10.5mmol) were added. The reaction mixture was stirred at 0°C and gradually warmed to room temperature (RT) for 1 hour to completely consume the starting material based on TLC. The reaction mixture was then treated with ice water and extracted with EtOAc (25mL x 4), the combined organic layers were washed with brine, dried over Na2SO4, filtered, and evaporated in vacuo to obtain a crude material that was not purified and entered the next step.

[0195] In anhydrous THF (20mL) solution of the methylated derivative (3.0g, 6.4mmol) of the above-mentioned preparation, add 1M TBAF (9.5mL, 9.55mmol) solution.Reaction mixture was at room temperature stirred for 2 hours or until starting material disappeared.Reaction mixture was mixed with 5% HCl solution, and with EtOAc (25mL x 3) aqueous layer extracted, the organic layer washed with salt water merged, through Na SO Drying, filtered and vacuum evaporated.Use flash chromatography purification thick material, obtain white solid through 3 steps, productive rate is 55%. 1 HNMR(600MHz, Acetoned6)δ7.87(s,1H),7.56(d,J=2.28Hz,1H),7.24(d,J=8.7Hz,1H),6.76(dd ,J=2.46,8.7Hz,1H),4.30(q,J=7.14Hz,1H),3.71(s,3H),2.72(s,3H),1.38(t,J=7.14Hz,3H); 13 C NMR (150MHz, Acetond6) δ166.3,153.8,146.2,132.4,128.7,112.2,112.1,110.8,107.0,106.9,103.7,59.5,15.1,12.0.

[0196] 5-Methoxy-2-methyl-1H-indole-3-carboxylic acid ethyl ester (Indole 3)

[0197]

[0198] In anhydrous DCM (100mL) solution of indole 1 (3.0g, 13.76mmol), imidazole (2.0g, 28.9mmol) and TBDPS (3.7mL, 14.45mmol) were added. After the disappearance of the starting material based on TLC, the reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was then treated with 5% hydrochloric acid solution. The organic phase was washed with salt water, dried over Na2SO4, filtered, and evaporated under vacuum to obtain a gray solid, which was directly used in the next step without further purification.

[0199] In anhydrous THF (60mL) solution of above-mentioned silylation indole (3.1g, 6.8mmol), add di-tert-butyl dicarbonate (3.0g, 13.6mmol) and DMAP (85mg, 0.68mmol), reaction mixture is heated to 50 ℃ and continues to stir 1 hour.Then reaction mixture is mixed with water, and extracted with EtOAc (25mL x 3).The organic layer merged is washed with salt water, through Na SO Drying, filter, and evaporate under vacuum.After using EtOAc / hexane to carry out flash chromatography, collect the indole of N-Boc protection as white solid (3.22g, 85%).

[0200] In anhydrous THF (15mL) solution of indole (3.0g, 5.4mmol) of the N-boc protection of above-mentioned preparation, add 1M TBAF (8.1mL, 8.1mmol) solution.Reaction mixture was stirred at room temperature for 2 hours or until starting material disappeared.Reaction mixture was mixed with 5% HCl solution, and extracted with EtOAc (25mL x 3) aqueous layer, the organic layer washed with salt water, through Na SO Drying, filter, and evaporate under vacuum.Use flash chromatography crude product, obtain 1.45g white solid, productive rate is 84.2%.

[0201] In anhydrous DMF (10mL) solution of above-mentioned 5-hydroxy indole derivative (1.0g, 3.1mmol), add NaH (60% is dispersed in oil) (190mg, 4.7mmol) and MeI (0.3mL, 4.7mmol).Reaction mixture is stirred at 0 ℃, and is gradually warmed to room temperature in 1 hour, to consume the starting material based on TLC completely.Then use ice water treatment reaction mixture, and extract with EtOAc (25mL x 4), the organic layer washed with salt water merged, through Na SO Drying, filter, and evaporate under vacuum, obtain thick material, then use EtOAc / hexane to pass through flash chromatography purification, obtain (922mg, 89% yield).

[0202] The 5-methoxyindole derivative prepared above (900 mg, 2.8 mmol) was treated with 4M hydrochloric acid in dioxane (8 mL) and heated to 100° C. for 2 hours. After evaporation of the volatiles under vacuum, the crude material was purified by flash chromatography using EtOAc / hexanes to give a white solid (340 mg, 52%) or 30% yield in five steps. 1 HNMR (600MHz, Acetoned6) δ10.61(bs,1H),7.60(d,J=2.6Hz,1H),7.25(d,J=8.4,1H),6.77(dd ,J=2.5,8.7Hz,1H),4.33(q,J=7.14Hz,2H),3.81(s,3H),2.69(s,3H),1.40(t,J=7.08Hz,3H); 13 CNMR (150MHz, Acetond6) δ166.3,156.4,145.4,131.0,129.3,112.4,112.3,104.7,104.2,59.6,55.8,15.0,14.3.

[0203] Ethyl 5-methoxy-1,2-dimethyl-1H-indole-3-carboxylate (Indole 4).

[0204]

[0205] In anhydrous DMF (10mL) solution of indole 1 (440mg, 2.0mmol), NaH (60% dispersion in oil) (160mg, 4.0mmol) and MeI (570 μ L, 10mmol) were added. The reaction mixture was stirred at 0°C, and was gradually warmed to room temperature for 30 minutes, at which temperature, the complete consumption of starting material was observed based on TLC. The reaction mixture was then treated with ice water, and extracted with EtOAc (25mL × 4), the organic layer washed with salt water, dried over Na SO, filtered, and evaporated under vacuum to obtain a thick material, which was purified by FCC and EtOAc / hexane to obtain 380mg, 77% of the methylated indole 4. 1 HNMR (600MHz, Acetoned6) δ7.62(d,J=2.6Hz,1H),7.30(d,J=8.8,1H),6.82(dd,J=2.6,8.9H z,1H),4.32(q,J=7.1Hz,2H),3.82(s,3H),3.72(s,3H),2.72(s,3H),1.41(t,J=7.14Hz,3H); 13C NMR (150MHz, Acetond6) δ166.3,156.6,146.3,132.7,128.5,112.0,111.0,104.5,104.1,59.6,55.8,15.0,12.1.

[0206] Ethyl 5-hydroxy-4-((6-methoxy-3,4-dihydroisoquinolin-2(1H)-yl)methyl)-2-methyl-1H-indole-3-carboxylate (Indole derivative 5).

[0207]

[0208] To a solution of indole 1 (30 mg, 0.135 mmol) in glacial acetic acid / water solution 5:1 (250 μL) was added 6-methoxy-tetrahydroisoquinoline (20 mg, 0.12 mmol) and formalin 37% solution (12 μL, 0.12 mmol). The reaction mixture was stirred at 90°C for 30 minutes, at which temperature, complete consumption of the starting material was observed based on TLC, and then the reaction mixture was evaporated under vacuum to remove acetic acid. The resulting crude material was dissolved in EtOAc (5 mL) and the organic layer was washed with saturated NaHCO3 and brine. The organic layer was dried over Na2SO4, filtered and evaporated, and the crude product was subjected to FCC using 80% EtOAc / hexane to give (27 mg, 58%) of the title compound. 1 HNMR (600MHz, CDCl3) δ8.27(bs,1H),7.09(d,J=8.6Hz,1H),6.90(d,J=8.5,1H),6.76(d,J=8.6Hz,1H),6.68(dd,J=2.6,8.4Hz, 1H),6.62(d,J=2.6Hz,1H),4.45(s,2H),4.33(q,J=4.3Hz,2H),3.75(m,5H),2.91(bs,3H),2.59(s,3H),1.38(t,J=7.14Hz,3H); 13 C NMR (150MHz, CDCl3) δ166.6,158.4,154.7,143.0,135.1,129.5,127.8,126.2,126.1,113.7,1 13.4,112.5,111.8,110.7,105.7,60.1,58.2,55.5,54.9,50.1,29.9,29.5,15.4,14.8,14.3.

[0209] 9-Methoxy-2-methyl-3,6a,11,14-tetrahydro-12H-indol[4',5':5,6][1,3]oxazino[2,3-a]isoquinoline-1-carboxylic acid ethyl ester (derivative 6)

[0210]

[0211] To indole derivative 5 (2.2g, 5.6mmol) in anhydrous ethanol (12.0mL) solution, add potassium acetate (602mg, 6.14mmol) and the iodine (1.42g, 5.6mmol) dissolved in 2.0mL ethanol. Under reflux temperature, drip iodine solution. After adding, the reaction mixture was stirred for 30 minutes at the same temperature, and the reaction was stopped by saturated sodium thiosulfate solution treatment until the iodine color disappeared. Then use 5% MeOH / EtOAc (25mL x 4) extraction reaction mixture. Use saturated NaHCO3 salt water washing organic layer, through Na2SO4 drying, filter and evaporate, the gained crude product uses 5% MEOH / EtOAc to carry out FCC, obtains 1.45g (6%) title compound. 1 HNMR(600MHz,DMSOd6)δ11.63(s,1H),7.30(d,J=8.5Hz,1H),7.10(d,J=8.6Hz,1H),6.8 2(dd,J=2.6,8.5,1H),6.76(d,J=2.5Hz,1H),6.55(d,J=8.6Hz,1H),5.64(s,1H),4.70(d J=17.6Hz,1H),4.24(m,3H),3.76(s,3H),3.32(m,5H),3.08-2.93(m,2H),2.80-2.72(m,2H),2.55(s,3H),1.33(t,J=7.14Hz,3H); 13 C NMR(150MHz,DMSOd6)δ165.0,159.1,148.4,143.4,136.3,129.6,129.3,126.3,123.9 ,112.7,112.1,112.0,110.4,110.1,104.1,85.0,58.9,55.0,53.5,43.6,28.7,14.4.

[0212] Compounds A and B: 1-(ethoxycarbonyl)-9-methoxy-2,13-dimethyl-3,6a,11,12,13,14-hexahydroindole[4',5':5,6][1,3]oxazino[2,3-a]isoquinolin-13-ium iodide.

[0213]

[0214] To a solution of indoloxazine and isoquinoline derivative 6 (580 mg, 1.48 mmol) in technical grade acetone (10 mL) was added MeI (420 μL, 7.4 mmol), and the reaction mixture was stirred at room temperature for 16 hours. The organic solvent was then completely evaporated under vacuum, and the raw material was subjected to FCC using 15% DMF and 85% CHCl3 to obtain two diastereomers (A and B) in a ratio of 2:1 (260 mg for low polar material and 409 mg for high polar material, with a total yield of 85%). The following are listed for the low polar derivative (Compound A): 1 HNMR(600MHz,DMSOd6)δ12.16(s,1H),7.64(d,J=8.7Hz,1H),7.47(d,J=8.8Hz,1H),7.13(d,J=8.7 Hz,1H),7.07(dd,J=2.5,8.7Hz,1H),6.99(d,J=2.3Hz,1H),6.51(s,1H),5.28(q,J=16.3Hz,1H),4. 29-4.27 (m, 2H), 4.19 (dd, J = 6.0, 12.5 Hz, 1H), 4.04 (dt, J = 5.2, 12.8 Hz, 1H), 3.83 (s, 1H), 3.40-3.37 (m, 1H), 3.21 (dd, J = 5.3, 19.0 Hz, 1H), 2.87 (s, 3H), 2.64 (s, 3H), 1.39 (t, J = 7.14 Hz, 3H); listed for low polarity 13 C NMR (150MHz, DMSOd6) δ164.7,160.1,145.5,145.2,133.0,131.5,127.7,123.2,118.9,114. 1,113.2,112.9,112.3,105.7,104.2,89.4,62.9,59.6,57.4,55.4,37.9,23.0,14.7,14.3.

[0215] Listed for polar derivative compound B 1 HNMR (600MHz, DMSOd6) δ12.10 (s, 1H), 7.43 (d, J = 8.8 Hz, 1H), 7.38 (d, J = 8.8 Hz, 1H), 6.99-6.94 (m, 3H), 6.42 (s, 1H), 5.24 (q, J = 16.9 Hz, 1H), 4.30 (m, 2H), 3.90 (m, 2H), 3.79 (s, 3H), 3.32 (m, 2H), 3.23 (s, 3H), 2.61 (s, 3H), 1.36 (t, J = 7.14 Hz, 3H); listed for polar derivatives 13C NMR (150MHz, DMSOd6) δ164.7,160.8,145.3,143.1,133.0,131.3,129.6,122.7,119.4,113. 8,113.5,112.9,112.2,104.9,104.1,87.7,59.6,55.4,51.8,47.6,45.7,23.0,14.6,14.3.

[0216] Compound G: 2-((3-(ethoxycarbonyl)-5-methoxy-1,2-dimethyl-1H-indol-4-yl)methyl)-6-methoxy-2-methyl-1,2,3,4-tetrahydroisoquinolin-2-ium iodide

[0217]

[0218] In anhydrous DMF (5.0mL) solution of indole derivative 5 (394mg, 1.0mmol), NaH (60% dispersion in oil) (120mg, 3.0mmol) and MeI (200 μL, 3.0mmol) were added. The reaction mixture was stirred at 0°C and gradually warmed to room temperature for 30 minutes, at which temperature, the complete consumption of starting material was observed based on TLC. The reaction mixture was then treated with ice water and extracted with EtOAc (25mL x 4), the organic layer washed with salt water, dried over Na2SO4, filtered, and evaporated under vacuum to obtain a crude material, which was purified by FCC and 20%MeOH / 1%Et3N / DCM solution to obtain 336.5mg, 60% methylated indole 8. 1 HNMR(600MHz, Acetoned6)δ7.79(d,J=9.0Hz,1H),7.24(d,J=9.0Hz,1H),7.15(d,J=9.3Hz,1H),6.91(m,2H),4.65(ABq,J=14.9Hz,δ=0.1 7, 2H), 4.13 (m, 2H), 3.94 (m, 4H), 3.87 (s, 3H), 3.81 (s, 3H), 3.34 (m, 2H), 3.04 (s, 3H), 2.81 (s, 2H), 2.78 (s, 3H), 1.41 (t, J = 7.14Hz, 1H); 13 C NMR (150MHz, Acetoned6) δ167.6,160.7,156.9,149.1,134.0,132.1,129.6,129.5,120.5,11 4.9,114.7,114.0,108.6,107.6,105.5,62.3,61.3,59.1,57.2,55.8,30.9,25.1,14.8,14.0.

[0219] Compound D: 5-hydroxy-4-((6-methoxy-3,4-dihydroisoquinolin-2(1H)-yl)methyl)-1,2-dimethyl-1H-indole-3-carboxylic acid ethyl ester

[0220]

[0221] To a solution of indole derivative 2 (2.1 g, 9.0 mmol) in glacial acetic acid / water solution 5:1 (11 mL) was added 6-methoxy-tetrahydroisoquinoline (1.83 g, 9.23 mmol) and formalin 37% solution (766 μL, 9.45 mmol). The reaction mixture was stirred at 90° C. for 30 minutes, at which temperature, complete consumption of the starting material was observed based on TLC. The reaction mixture was then evaporated under vacuum to remove acetic acid. The resulting crude material was dissolved in EtOAc (5 mL), and the organic layer was rinsed with saturated NaHCO3 and brine. The organic layer was dried over Na2SO4, filtered and evaporated, and the resulting crude product was subjected to FCC using 80% EtOAc / hexane to obtain 2.2 g (63%) of the title compound. 1 HNMR(600MHz, Acetoned6)δ11.34(bs,1H),7.21(d,J=8.7Hz,1H),6.95(d,J=8.9Hz,1H),6.71-6.68(m,3H),4.34 (s,2H),4.30(q,J=7.1Hz,2H),3.75(s,3H),5.70(m,5H),2.90-2.84(m,5H),2.60(s,3H),1.36(t,J=7.14Hz,3H); 13 C NMR (150MHz, Acetoned6) δ167.0,159.3,155.2,144.1,135.8,132.4,128.4,127.0,126 .1,113.9,113.4,113.2,112.0,110.1,105.6,60.2,58.8,55.5,55.4,50.8,15.0,12.3.

[0222] Compound C: 9-methoxy-2,3-dimethyl-3,6a,11,14-tetrahydro-12H-indol[4',5':5,6][1,3]oxazino[2,3-a]isoquinoline-1-carboxylic acid ethyl ester

[0223]

[0224] In the absolute ethanol solution of compound D, add potassium acetate and the iodine dissolved in 2.0mL ethanol.Under reflux temperature, drip iodine solution.After adding, the reaction mixture was stirred for 30 minutes again at the same temperature, and the reaction was stopped by processing with saturated sodium thiosulfate solution, until the iodine color disappeared, and then used 5% MeOH / EtOAc (5mL x 4) extraction reaction mixture.Use saturated NaHCO3 washing organic layer, then through Na2SO4 drying, filter and evaporate.Use 5% MEOH / EtOAc that gained crude product is carried out FCC, obtain title compound. 1 HNMR(600MHz,DMSOd6)δ7.31(d,J=8.5Hz,1H),7.27(d,J=8.8Hz,1H),6.82(dd,J =2.6,8.4,1H),6.75(d,J=2.5Hz,1H),6.62(d,J=8.6Hz,1H),5.68(s,1H),4.40( ABq,J=17.5Hz,δ=0.52,2H),4.27(q,J=7.1Hz,2H),3.76(s,3H),3.66(s,3H),3. 03(m,1H),2.95(m,1H),2.79-2.70(m,2H),2.60(s,3H),1.33(t,J=7.14Hz,3H); 13 CNMR(150MHz,DMSOd6)δ165.2,159.1,148.7,143.8,136.3,131.2,129.4,126.2,123.1, 112.8,112.0,109.9,109.3,104.1,85.1,59.3,55.1,53.4,43.5,29.8,28.7,14.4,12.1.

[0225] Compound H & I: 1-(Ethoxycarbonyl)-9-methoxy-2,3,13-trimethyl-3,6a,11,12,13,14-hexahydroindole[4',5':5,6][1,3]oxazino[2,3-a]isoquinolin-13-ium iodide.

[0226]

[0227] MeI was added to a technical grade acetone solution of compound C, and the reaction mixture was stirred at room temperature for 16 hours. The organic solvent was then completely evaporated under vacuum, and the raw material was subjected to FCC using 15% DMF and 85% CHCl3 to obtain two diastereomers in a ratio of 2:1. The low polarity derivative (compound H) is listed as 1HNMR(600MHz,DMSOd6)δ7.68(d,J=8.9Hz,1H),7.64(d,J=6.7Hz,1H),7.20(d,J=8.9Hz,1H),7.07(dd ,J=2.5,8.6Hz,1H),6.98(d,J=2.4Hz,1H),6.53(s,1H),5.23(ABq,J=16.1Hz,Δδ=0.13,2H),4.39-4.2 7 (m, 2H), 4.16 (dd, J = 5.9, 12.5 Hz, 1H), 4.03 (dt, J = 5.0, 12.7 Hz, 1H), 3.82 (s, 3H), 3.78 (s, 3H), 3.41-3.32 (m, 1H), 3.20 (dd, J = 5.2, 18.4 Hz, 1H), 2.89 (s, 3H), 2.69 (s, 3H), 1.39 (t, J = 7.14 Hz, 3H); listed for low polarity 13 C NMR(150MHz,DMSOd6)δ164.7,160.2,146.0,145.5,133.1,133.0,127.8,122.4,118.9,114.2, 113.2,112.2,111.9,105.6,104.1,89.4,62.8,59.9,57.5,55.5,37.9,30.3,23.0,14.4,12.4.

[0228] Listed for polar derivatives (Compound I) 1 HNMR (600MHz, DMSOd6) δ7.60 (d, J = 8.9 Hz, 1H), 7.44 (d, J = 8.6 Hz, 1H), 7.01 (d, J = 8.9 Hz, 1H), 6.98 (d, J = 2.3 Hz, 1H), 6.95 (dd, J = 2.6, 8.5 Hz, 1H), 6.44 (s, 1H), 5.19 (q, J = 16.8 Hz, 1H), 4.36-4.27 (m, 2H), 3.86 (t, J = 6.9 Hz, 2H), 3.79 (s, 3H), 3.74 (s, 3H), 3.33 (m, 2H), 3.22 (s, 3H), 2.66 (s, 3H), 1.36 (t, J = 7.14 Hz, 3H); listed for polar derivatives 13 C NMR(150MHz,DMSOd6)δ164.7,160.8,145.8,143.3,133.0,132.8,129.7,121.9,119.4,1 13.9,113.6,112.2,111.9,104.8,104.0,87.7,59.8,55.4,47.6,30.2,23.1,14.3,12.3.

[0229] Compound E: 5-methoxy-4-((6-methoxy-3,4-dihydroisoquinolin-2(1H)-yl)methyl)-2-methyl-1H-indole-3-carboxylic acid ethyl ester (20180705-A688Y)

[0230]

[0231] Imidazole (2.0 g, 28.9 mmol) and TBDPS (3.7 mL, 14.45 mmol) were added to anhydrous DCM (100 mL) solution of indole 1 (3.0 g, 13.76 mmol). The reaction mixture was stirred at room temperature for 16 hours. After the disappearance of the starting material based on TLC, the reaction mixture was treated with 5% hydrochloric acid solution. The organic phase was washed with brine, dried over Na2SO4, filtered, and evaporated under vacuum to obtain a gray solid, which was directly used in the next step without further purification.

[0232] In anhydrous THF (60mL) solution of above-mentioned silylation indole (3.1g, 6.8mmol), add di-tert-butyl dicarbonate (3.0g, 13.6mmol) and DMAP (85mg, 0.68mmol).Reaction mixture is heated to 50 ℃ and continues to stir 1 hour.Then reaction mixture is mixed with water, and extracted with EtOAc (25mL x 3).The organic layer merged is washed with salt water, through Na SO Drying, filter, and evaporate under vacuum.After using EtOAc / hexane to carry out flash chromatography, collect the indole of N-Boc protection as white solid (3.22g, 85%).

[0233] In anhydrous THF (15mL) solution of indole (3.0g, 5.4mmol) of the N-boc protection of above-mentioned preparation, add 1M TBAF (8.1mL, 8.1mmol) solution.Reaction mixture was at room temperature stirred 2 hours or until starting material disappeared.Reaction mixture was mixed with 5% HCl solution, and with EtOAc (25mL x 3) aqueous layer extracted, the organic layer washed with salt water merged, through Na SO Drying, filter, and evaporate under vacuum.Use flash chromatography purification of thick material, obtain white solid (1.45g, 84.2% productive rate).

[0234] To a solution of the indole derivative (319.0 mg, 1.0 mmol) in glacial acetic acid / water solution 5:1 (1.33 mL) from the previous step was added 6-methoxy-tetrahydroisoquinoline HCl salt (198 g, 1.0 mmol) and formalin 37% solution (81 μL, 1.0 mmol). The reaction mixture was stirred at 90° C. for 30 minutes, at which temperature, complete consumption of the starting material was observed based on TLC. The reaction mixture was then evaporated under vacuum to remove acetic acid. The resulting crude material was dissolved in EtOAc (5 mL), and the organic layer was rinsed with saturated NaHCO3 and brine. The organic layer was dried over Na2SO4, filtered and evaporated. FCC of the resulting crude product was performed using 80% glycolic acid / hexane to give 316 mg (64%).

[0235] To the above obtained 5-hydroxy indole derivative (135mg, 0.27mmol) in anhydrous DMF (2.0mL) solution, NaH (60% dispersion in oil; 11.0mg, 0.27mmol) and MeI (17.5μL, 0.27mmol) were added. The reaction mixture was stirred at 0°C and gradually warmed to room temperature within 1 hour, at which temperature, complete consumption of the starting material was observed based on TLC. The reaction mixture was then treated with ice water and extracted with EtOAc (5mL x 4), the combined organic layers were washed with brine, dried over Na2SO4, filtered, and evaporated under vacuum to give a crude material, which was purified by flash chromatography using EtOAc / hexane to give (98mg, 71% yield).

[0236] To the above prepared 5-methoxyindole derivative solution (80 mg, 0.16 mmol) was added 4M hydrochloric acid in dioxane (4.0 mL), and the solution was heated to 100° C. for 2 hours. After evaporation of the volatiles under vacuum, the crude material was purified by flash chromatography using EtOAc / hexanes to give a white solid (45 mg, 69.0%). 1 HNMR (600MHz, Acetoned6) δ7.23 (d, J = 8.8 Hz, 1H), 6.93 (d, J = 8.8 Hz, 1H), 6.82 (d, J = 8.4 Hz, 1H), 6.61 (dd, J = 2.6, 8.8 Hz, 1H), 6.57 (d, J = 2.5 Hz, 1H), 4.16 (s, 2H), 4.09 (q, J = 7.1 Hz, 2H), 3.83 (s, 3H), 3.70 (s, 3H), 3.39 (s, 2H), 2.82 (s, 2H), 2.63 (t, J = 5.8 Hz, 2H), 2.50 (m, 5H), 1.16 (t, J = 7.1 Hz, 3H); listed for polar derivatives 13C NMR(150MHz,DMSOd6)δ 166.5,158.8,154.3,137.0,132.4,129.0,128.0,127.6,113.8,112.5,1 11.0,109.8,109.1,60.1,58.2,55.7,55.4,52.4,50.5,30.7,14.8,13.8.

[0237] Compounds F and J:

[0238]

[0239] To the above obtained 5-hydroxyindole derivative (40.0 mg, 0.1 mmol) in anhydrous DMF (1.0 mL) solution was added NaH (60% dispersion in oil; 4.0 mg, 0.1 mmol) and MeI (14.0 μL, 0.1 mmol). The reaction mixture was stirred at 0 ° C and gradually warmed to room temperature within 1 hour, at which temperature, complete consumption of the starting material was observed based on TLC. The reaction mixture was then treated with ice water and extracted with EtOAc (2.0 mL × 4), the combined organic layers were washed with brine, dried over Na2SO4, filtered, and evaporated under vacuum to give a crude material, which was purified by flash chromatography using EtOAc / hexane to give 19.0 mg (37% yield).

[0240] Compound K:

[0241]

[0242] The synthesis of the compound is as follows: NaH (60% dispersion in oil; 11.0 mg, 0.27 mmol) and MeI (17.5 μL, 0.27 mmol) were added to a solution of compound J. The reaction mixture was stirred at 0°C and gradually warmed to room temperature over 1 hour, at which temperature, complete consumption of the starting material was observed based on TLC. The reaction mixture was then treated with ice water and extracted with EtOAc, the combined organic layers were washed with brine, dried over Na2SO4, filtered, and evaporated under vacuum to give a crude material, which was purified by flash chromatography using EtOAc / hexane.

[0243] Combined analysis results

[0244] Figure 6 Results of receptor binding analysis of PD102807 and compound AK on receptors CHRM1-5 (M1-M5) are shown. 1×10 -9 M, 1×10 -8 M, 1×10 -7M, 1×10 -6 M and 1×10 -5 M of PD102807 and compound AK. Compound binding was calculated as the percentage of inhibition of specific binding of the radiolabeled ligand to each target, and the Ki value was determined. Ki values ​​are shown in Table 1 below. For CHRM1, [ 3 H]pirenzepine (2 nM) was used as the radioligand for binding assays with CHO cell membranes bearing human recombinant CHRM1 receptors. The incubation time was 60 min at room temperature. For CHRM2, [ 3 H]AF-DX 384 (2 nM) was used as the radioligand for binding assays with CHO cell membranes bearing human recombinant CHRM2 receptors. The incubation time was also 60 min at room temperature. For CHRM3, [ 3 H]4-DAMP (0.2 nM) was used as a radioligand and the binding assay was performed on CHO cell membranes with human recombinant CHRM3 receptors. The incubation time at room temperature was also 60 minutes. For CHRM4, [ 3 H]4-DAMP (0.2 nM) was used as the radioligand and the binding assay was performed on CHO cell membranes with human recombinant CHRM4 receptors. The incubation time at room temperature was also 60 minutes. For CHRM5, [ 3 H]4-DAMP (0.3 nM) was used as a radioligand for binding assays to membranes of CHO cells bearing human recombinant CHRM5 receptors. The incubation time was also 60 minutes at room temperature.

[0245] Table 1. Ki values ​​of various compounds

[0246]

[0247] The value is Ki(M)

[0248] * indicates no combination

[0249] Figure 7 and 8 Results of primary BFU-E culture experiments are shown. Figure 7 Results for compounds A, B, C, H, and I are shown, while Figure 8 Results for compounds D, E, F, G, J and K are shown. Figure 7 and 8 The data in the Figure 2 demonstrate that PD102807 and compound AK induce BFU-E expansion. Using fluorescence activated cell sorting (FACS) method, highly purified BFU-E were isolated as lin-Ter-119-CD16 / CD32-Sca-1-CD41-c-Kit+CD71 / Cd24a 10％低Population. BFU-E were cultured in medium containing rmSCF, EPO, and rmIGF-1 in the presence of the indicated concentrations of PD102807 or compound AK. The number of cells in the culture system on day 9 is shown; in cultures treated with compound AK, the cell expansion fold was significantly higher than that in untreated cultures.

[0250] Fig. 9 Pharmacokinetic profiles (plasma) and brain penetration assays of PD102807 and compounds A and B are shown. Concentrations (upper panel) and concentration ratios (plasma / brain) (lower panel) are shown in Table 1. Fig. 9 shown. Fig. 9 The data in show that compared with PD102807, compounds A and B show reduced brain penetration. PD102807 and compounds A and B were injected intraperitoneally into mice. Blood was collected at each time point, and the transfer tube containing the anticoagulant was centrifuged to obtain plasma. Brain samples were collected at each time point, then quickly frozen in liquid nitrogen and kept at -75±15°C. Brain samples were homogenized. The concentrations of PD102807 and compounds A and B in plasma and brain samples were analyzed using LC-MS / MS methods.

[0251] Fig.10 The results of the efficacy assay of the compounds in an in vivo anemia animal model are shown, and compounds A and B are demonstrated to treat anemia in vivo. C57bl / 6 mice were injected with 60mg / kg phenylhydrazine to induce hemolysis. The mice were injected with a vehicle control or compound A or B (30mg / kg or 100mg / kg). Peripheral blood samples were collected in reverse into blood collection tubes with K2-EDTA using heparinized capillaries. A complete blood count was performed using Hemavet 950. Hematocrit (HCT), red blood cells (RBC), and hemoglobin (Hb) values ​​are shown.

[0252] Fig.11 The results of the efficacy determination of the compounds in the in vivo anemia animal model are shown, and it is proved that compounds B and I treat anemia in vivo. C57bl / 6 mice were injected with 60mg / kg phenylhydrazine to induce hemolysis. The mice were subcutaneously injected with a solvent control or compound B (1.5mg / kg, 3mg / kg or 5mg / kg) or I (0.5mg / kg, 0.7mg / kg or 1mg / kg). Peripheral blood samples were collected in reverse into blood collection tubes with K2-EDTA using heparinized capillaries. A complete blood count was performed using Hemavet 950. Hematocrit (HCT), red blood cells (RBC) and hemoglobin (Hb) values ​​are shown.

[0253] Fig.12 The pharmacokinetic profile (plasma) and brain penetration assays of Compound G are shown. Concentrations (upper panel) and concentration ratios (plasma / brain) (lower panel) are shown in Fig.12 middle. Fig.12 The data in show that the brain penetration of compound G is reduced compared to PD102807. Compound G was injected intraperitoneally into mice. Blood was collected at each time point, and the transfer tube containing anticoagulant was centrifuged to obtain plasma. Brain samples were collected at each time point, then quickly frozen in liquid nitrogen and kept at -75±15°C. Brain samples were homogenized. The concentration of compound G in plasma and brain samples was analyzed using LC-MS / MS method.

[0254] While there has been shown and described what are presently considered to be the preferred embodiments of the invention, various changes and modifications may be made by those skilled in the art which remain within the scope of the invention as defined by the appended claims.

Claims

1. A compound represented by the following formula: in: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 3 , R 4 and R 5 are independently selected from a hydrogen atom and the following structure (1-1): The premise is R 3 , R 4 and R 5 One of them is a structure of formula (1-1); R 6 is CH3; R 7 , R 8 and R 9 are independently selected from hydrogen atoms; And wherein the compound of formula (1) includes a pharmaceutically acceptable salt of the compound of formula (1).

2. The compound according to claim 1, wherein the compound has the following formula:

3. The compound according to claim 1 or 2, wherein R 1 A hydrogen atom.

4. The compound according to claim 1 or 2, wherein R 1 It is methyl.

5. The compound according to claim 1 or 2, wherein R 2 It is ethyl.

6. The compound according to claim 1 or 2, wherein R 1 is a hydrogen atom and R 2 It is ethyl.

7. The compound according to claim 1 or 2, wherein R 1 is methyl and R 2 It is ethyl.

8. Use of a pharmaceutically effective amount of an M4-specific antagonist in the preparation of a medicament for treating a disease or condition caused by muscarinic acetylcholine receptor subtype 4 (M4) activity in a subject, wherein the M4-specific antagonist is a compound having the formula: in: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 3 , R 4 and R 5 are independently selected from a hydrogen atom and the following structure (1-1): The premise is R 3 , R 4 and R 5 One of them is a structure of formula (1-1); R 6 is CH3; R 7 , R 8 and R 9 are independently selected from hydrogen atoms; And wherein the compound of formula (1) includes a pharmaceutically acceptable salt of the compound of formula (1).

9. The use according to claim 8, wherein the compound has the following formula:

10. The use according to claim 8 or 9, wherein R 1 A hydrogen atom.

11. The use according to claim 8 or 9, wherein R 1 It is methyl.

12. The use according to claim 8 or 9, wherein R 2 It is ethyl.

13. The use according to claim 8 or 9, wherein R 1 is a hydrogen atom and R 2 It is ethyl.

14. The use according to claim 8 or 9, wherein R 1 is methyl and R 2 It is ethyl.

15. Use of M4-specific antagonists in the preparation of drugs for promoting self-renewal of burst-forming unit erythroid (BFU-E) cells; The M4-specific antagonist is a compound having the following formula: in: R 1 is H or CH3; R 2 is a hydrocarbon group having 1 to 3 carbon atoms; R 3 , R 4 and R 5 are independently selected from a hydrogen atom and the following structure (1-1): The premise is R 3 , R 4 and R 5 One of them is a structure of formula (1-1); R 6 is CH3; R 7 , R 8 and R 9 are independently selected from hydrogen atoms; wherein the drug causes increased self-renewal of the BFU-E cells; and The compound of formula (1) includes pharmaceutically acceptable salts of the compound of formula (1).

16. The use according to claim 15, wherein the increased self-renewal of the BFU-E cells is used to treat anemia.

Images