Gene therapy expression system to alleviate FKRP cardiotoxicity

Abstract

The present invention relates to an expression system for systemic administration, comprising a sequence encoding a FKRP protein, and: a promoter sequence that allows expression of FKRP at a therapeutically acceptable level in skeletal muscle and a target sequence of a miRNA expressed in the heart; or, a promoter sequence that allows expression of FKRP at a therapeutically acceptable level in skeletal muscle and exhibits promoter activity at a toxically acceptable level in the heart; and its use for treating various diseases associated with FKRP deficiency.

Description

Technical Field

[0001] The present invention is based on the identification of cardiotoxicity of transgenic expression of FKRP (Fukutin-related protein). It provides an expression system for alleviating FKRP toxicity in the heart, in particular by modulating, i.e. partially detargeting, FKRP cardiac expression. It then provides a valuable and safe therapeutic tool for the treatment of various diseases associated with FKRP deficiency, such as limb-girdle muscular dystrophy type 2I (LGMD2I), the newly named limb-girdle muscular dystrophy type R9 (LGMD2 R9). Background Art

[0002] The term “dystroglycanopathies” regroups different genetic pathologies that result in secondary abnormal glycosylation of α-dystroglycan (αDG). This protein, found primarily in skeletal muscle, heart, eye, and brain tissue, is a heavily glycosylated membrane protein, a process that increases its weight in muscle from 70 to 156 kDa. It is part of the dystrophin-glycoprotein complex that connects the cytoskeleton to the extracellular matrix (ECM). Its high glycosylation level enables αDG to bind directly to the laminin globular domain of some ECM proteins, such as laminin in cardiac and skeletal muscle, agrin and perlecan at the neuromuscular junction, neurexin in the brain, and pikachurin in the retina. Glycosylation of αDG is a complex process that is not yet fully understood. In fact, many genes have been identified as being involved in αDG glycosylation. These discoveries have recently been accelerated by the use of high-throughput sequencing approaches to detect mutations in patients showing defective αDG glycosylation. One of these proteins is Fukutin-related protein (FKRP). It was initially classified as a putative αDG glycosyltransferase due to the presence of a DxD motif in its sequence that is common to many glycosyltransferases and the evidence for αDG hypoglycosylation in patients with mutations in the FKRP gene (Breton et al., 1999; Brockington et al., 2001). More recently, FKRP and its homolog fukutin were identified as ribitol-5-phosphate (Rbo5P) transferases that form the di-Rbo5P linker necessary for the addition of the ligand-binding moiety (Kanagawa et al., 2016).

[0003] Mutations in the FKRP gene can produce the entire spectrum of pathologies caused by defective αDG glycosylation, from limb-girdle muscular dystrophy type 2I (LGMD2I; Muller et al., 2005; new name: limb-girdle muscular dystrophy type R9 or LGMD2 R9), congenital muscular dystrophy type 1C (MDC1C; Brockington et al., 2001) to Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB; Beltran-Valero de Bernabe et al., 2004). Disease severity is inversely correlated with the number of patients, with fewer patients being affected as the severity increases (prevalence rates at www.orphanet.fr: WWS (all genes): 1-9 / 1,000,000 and LGMD2I: 1-9 / 100,000). The type of pathology appears to be at least partly related to the nature of the FKRP mutation. In particular, the homozygous L276I mutation, which replaces leucine with isoleucine at position 276 of the protein, is always associated with LGMD2I (Mercuri et al., 2003). LGMD2I is a recessive autosomal muscular dystrophy that preferentially affects the muscles of the shoulder and pelvic girdle, although heterogeneously. It is one of the most common LGMD2s in Europe, especially due to the high prevalence of the L276I mutation in northern Europe (Sveen et al., 2006). The severity of the pathology is very heterogeneous. Muscle symptoms may appear between the ages of 1-30 years and vary from Duchenne-like to a relatively benign course. The heart may also be affected with consequences such as severe heart failure and death (Muller et al., 2005). Studies using cardiac magnetic resonance imaging have shown that a very high proportion of LGMD2I patients (60-80%) develop myocardial dysfunction, such as reduced ejection fraction (Wahbi et al., 2008). Interestingly, the severity of cardiac abnormalities is not related to skeletal muscle involvement. Based on a cohort of 7 patients, Rosales et al. (2011) concluded that LGMD2I generally results in mild structural and functional cardiac abnormalities, although severe dilated cardiomyopathy may occur (one patient). Petri et al. (2015) also observed that in LGMD2 patients, LVEF (left ventricular ejection fraction) decreased significantly from 59% (15-72) to 55% (20-61) in LGMD 2I patients (n=28), p=0.03, i.e., a decrease of 0.4% per year, and LVEF ≤ 50% was associated with increased mortality in this subgroup.

[0004] Gicquel et al. (Hum Mol Genet, 2017 Mar 3. doi:10.1093 / hmg / ddx066) reported FKRP L276IGeneration of a mouse model in which recombinant adeno-associated virus (rAAV2 / 9) transfer of the murine Fkrp gene placed under the control of the desmin promoter and the polyadenylation (polyA) signal of the beta-hemoglobin (HBB2) gene was evaluated. After intramuscular or intravenous delivery, improvements in muscle pathology were observed. They obtained strong expression of FKRP at the mRNA and protein levels and showed rescue of proper glycosylation of αDG and increased laminin binding, which led to histological and functional rescue of dystrophy. As reported in WO2019 / 008157, the muscle efficiency of this construct could still be improved by using the FKRP coding sequence with a mutation, thereby avoiding the supplementary transcripts generated by the frameshifted start codon.

[0005] Therefore, FKRP-based gene replacement therapy appears to be a promising treatment for pathologies caused by FKRP deficiency. However, safe and effective treatments are still needed.

[0006] With regard to gene therapy, a safe expression system is defined as one that ensures the production of therapeutically effective amounts of a protein in the target tissue, i.e., in the tissue where the protein is needed to cure the abnormality associated with the defect of the native protein, without any toxicity, especially in essential and vital organs or tissues.

[0007] For example, with respect to neuromuscular diseases, WO2014 / 167253 reports that an expression system encoding myotubularin and calpain 3 is cardiotoxic when administered systemically, and that the toxicity can be alleviated by introducing into the construct a target sequence for a miRNA expressed in the heart or by using a promoter sequence that exhibits a toxic level acceptable to that of the heart, or even no activity. Summary of the invention

[0008] The present invention aims to alleviate or cure the devastating pathologies associated with fukutin-related protein (FKRP) deficiency, such as limb-girdle muscular dystrophy type 2I (LGMD2I), by providing an expression system that ensures production of therapeutically effective amounts of the protein in target tissues (primarily skeletal tissues) and toxically acceptable amounts of the protein in the heart.

[0009] In fact, the inventors have detected potential cardiotoxicity of expression systems encoding FKRP. This is unexpected, because patients with pathologies associated with fukutin-related protein (FKRP) deficiency, such as limb-girdle muscular dystrophy type 2I (LGMD2I), also often exhibit cardiac abnormalities. Therefore, according to common sense, sustained levels of FKRP expression in the heart are considered beneficial, especially to alleviate the cardiac symptoms of FKRP-related diseases.

[0010] It is noteworthy that document WO2014 / 167253, which provides a list of candidate genes and associated pathologies, does not mention FKRP at all. On the other hand, document WO2016 / 138387 only mentions the putative hepatotoxicity of FKRP and the possible use of mir122 target sequences in expression systems to reduce expression in the liver. Finally, document WO2019 / 008157 discloses the possibility of adding miRNA target sequences to inhibit expression in tissues where expression is undesirable or even toxic, but detargeting the heart is discouraged.

[0011] definition

[0012] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.The terminology used in the description is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0013] The articles "a" and "an" are used herein to refer to one or more than one (ie, at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0014] As used herein, "about" or "approximately" when referring to a measurable value (e.g., an amount, a duration, etc.) is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% of the specified value, as such variations are suitable for performing the disclosed methods.

[0015] Range: Throughout this disclosure, various aspects of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Therefore, the description of a range should be considered to have specifically disclosed all possible subranges and individual numerical values ​​within the range. For example, a description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within the range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0016] "Isolated" means changed or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated", but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid or protein may exist in a substantially purified form, or may exist in a non-natural environment (e.g., a host cell).

[0017] In the context of the present invention, the following abbreviations for common nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0018] "Nucleotide sequences encoding amino acid sequences" include all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA or cDNA may also include introns, so that a nucleotide sequence encoding a protein may contain introns in some versions.

[0019] "Encoding" refers to the inherent properties of a specific nucleotide sequence in a polynucleotide (e.g., a gene, cDNA, or mRNA) as a template for other polymers and macromolecules with a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence in the synthesis of biological processes, and the resulting biological properties. Therefore, if the mRNA corresponding to a gene can be transcribed and translated to produce a protein in a cell or other biological system, then the gene encodes a protein. Both the coding strand (whose nucleotide sequence is the same as the mRNA sequence, usually provided in the sequence listing) and the non-coding strand (used as a template for transcription of a gene or cDNA) can be referred to as encoding a protein or other product of the gene or cDNA.

[0020] The term "polynucleotide" as used herein is defined as a chain of nucleotides. In addition, nucleic acids are polymers of nucleotides. Therefore, nucleic acids and polynucleotides used herein are interchangeable. It is common knowledge among those skilled in the art that nucleic acids are polynucleotides that can be hydrolyzed into monomeric "nucleotides". Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any method available in the art (including, but not limited to, recombinant methods, i.e., cloning nucleic acid sequences from a recombinant library or a cell genome using common cloning techniques and PCR, etc., and by synthetic methods).

[0021] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. Polypeptides include any peptide or protein comprising two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains, which are also commonly referred to in the art as, for example, peptides, oligopeptides and oligomers, and longer chains, which are commonly referred to in the art as proteins, of which there are many types. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0022] Proteins may be "altered" and contain deletions, insertions or substitutions of amino acid residues which produce a silent change and result in functional equivalence. Deliberate amino acid substitutions may be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues as long as biological activity is retained. For example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; amino acids with similar hydrophilicity values ​​containing uncharged polar head groups may include leucine, isoleucine and valine, glycine and alanine, asparagine and glutamine, serine and threonine, and phenylalanine and tyrosine.

[0023] As used herein, "variant" refers to an amino acid sequence that is altered by one or more amino acids. Variants can have "conservative" changes, in which the substituted amino acids have similar structures or chemical properties, such as replacing leucine with isoleucine. Variants can also have "non-conservative" changes, such as replacing glycine with tryptophan. Similar minor changes can also include amino acid deletions or insertions or both. Guidance for determining which amino acid residues can be substituted, inserted, or deleted without eliminating biological or immunological activity can be found using computer programs well known in the art.

[0024] "Identical" or "homologous" refers to sequence identity or sequence similarity between two polypeptides or between two nucleic acid molecules. When a position in each of the two sequences being compared is occupied by the same base or amino acid monomer subunit, for example, if a position in each of the two DNA molecules is occupied by adenine, then the molecules are homologous or identical at that position. The percentage of homology / identity between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared times 100. For example, if 6 out of 10 positions of the two sequences match, the two sequences are 60% identical. Typically, when aligning two sequences, the comparison is made to obtain maximum homology / identity.

[0025] "Vector" is a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphiphilic compounds, plasmids and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmids and non-viral compounds that promote the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to adenoviral vectors, adeno-associated viral vectors, retroviral vectors, etc.

[0026] "Expression vector" refers to a vector containing a recombinant polynucleotide, which contains an expression control sequence operably linked to the nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression can be provided by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.

[0027] The term "promoter" as used herein is defined as a DNA sequence recognized by the transcription machinery of the cell or introduced transcription machinery, which is necessary to initiate specific transcription of a polynucleotide sequence.

[0028] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for the expression of a gene product that is operably linked to the promoter / regulatory sequence. In some cases, the sequence may be a core promoter sequence, while in other cases, the sequence may also include enhancer sequences and other regulatory elements required for the expression of the gene product. The promoter / regulatory sequence may, for example, be a sequence that expresses a gene product in a tissue-specific manner.

[0029] A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0030] An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell essentially only when an inducer corresponding to the promoter is present in the cell.

[0031] A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes the gene product to be produced preferentially in cells if the cell is a cell of the tissue type corresponding to the promoter.

[0032] The term "abnormal" when used in the context of organisms, tissues, cells, or components thereof, refers to those organisms, tissues, cells, or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) compared to those organisms, tissues, cells, or components thereof that exhibit the "normal" (expected) respective characteristic. A normal or expected characteristic for one cell or tissue type may be abnormal for a different cell or tissue type.

[0033] The terms "patient", "subject", "individual" and the like are used interchangeably herein and refer to any animal or cell thereof, whether in vitro or in vivo, suitable for the methods described herein. The subject can be a mammal, such as a human, dog, or mouse, rat, or non-human primate. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0034] A "disease" or "pathology" is a condition in a subject in which the subject is unable to maintain homeostasis, and if the disease is not ameliorated, the subject's health continues to deteriorate. In contrast, a "disorder" in a subject is a condition in which the subject is able to maintain homeostasis, but the subject's health is not as good as it would be without the disorder. A disorder will not necessarily lead to a further decline in the subject's health if left untreated.

[0035] A disease or condition is "mitigated" or "improved" if the severity of the symptoms of the disease or condition, the frequency with which a patient experiences such symptoms, or both, is reduced. This also includes arresting the progression of the disease or condition. A disease or condition is "cured" if the severity of the symptoms of the disease or condition, the frequency with which a patient experiences such symptoms, or both, are eliminated.

[0036] "Therapeutic" treatment is treatment administered to a subject who exhibits signs of a pathology, with the goal of reducing or eliminating those signs. "Prophylactic" treatment is treatment administered to a subject who does not exhibit signs of a pathology or has not yet been diagnosed with a pathology, with the goal of preventing or delaying the onset of those signs.

[0037] As used herein, "treating a disease or condition" refers to reducing the frequency or severity of at least one sign or symptom of the disease or condition experienced by a subject. In the context of treatment, disease and condition are used interchangeably herein.

[0038] An "effective amount" of a compound is an amount of the compound sufficient to provide a beneficial effect to the subject to which the compound is administered. As used herein, the phrase "therapeutically effective amount" refers to an amount sufficient or effective to prevent or treat (delay or prevent its onset, arrest its progression, inhibit, reduce or reverse) a disease or condition (including alleviating the symptoms of such a disease). An "effective amount" of a delivery vehicle is an amount sufficient to effectively bind or deliver a compound. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 : Diagram of vector construct:

[0040] A / FKRP expression cassette without the target sequence of miRNA-208a (AAV-FKRP);

[0041] B / FKRP expression cassette containing one (AAV-FKRP-single) or two (AAV-FKRP-tandem) target sequences of miRNA-208a (arrows) at the 3' end of the FKRP gene.

[0042] Figure 2 : Cross-sections of rat hearts injected intravenously with AAV-FKRP vector: Myocardial histological analysis on day 15 after injection of AAV-FKRP at 3 doses (1e12 vg / kg; 5e12 vg / kg; 7.5e13 vg / kg) and HES staining (top, scale bar = 50 μm) or Sirius red staining (bottom) as indicated.

[0043] Figure 3 : Cross-section of mouse hearts administered AAV-FKRP vector intravenously: Myocardial histological analysis six weeks after injection of AAV-FKRP at a dose of 1e14 vg / kg and HPS staining (top, scale = 200 μm) or Sirius red staining (bottom).

[0044] Figure 4 : Body weight curves of rats injected with PBS (buffer), AAV-FKRP, AV-FKRP-single or AAV-FKRP-tandem.

[0045] Figure 5: Vector copy number per nucleus (VCN) of AAV-FKRP, AAV-FKRP-single, and AAV-FKRP-tandem in rat TA (tibialis anterior) muscle 2 weeks after injection.

[0046] Figure 6 : Evaluation of FKRP mRNA (A) or protein (B) in rat hearts 2 weeks after injection of PBS (buffer), AAV-FKRP, AV-FKRP-single or AAV-FKRP-tandem. Asterisks (*) indicate statistical differences.

[0047] Figure 7 : Histological analysis of rat myocardium at day 15 after injection of AAV-FKRP, AAV-FKRP-single or AAV-FKRP-tandem (as indicated) at a dose of 7.5e13 vg / kg and HES staining (top, scale = 50 μm) or Sirius red staining (bottom).

[0048] Figure 8 : Evaluation of FKRP mRNA (A) or protein (B) in rat TA muscle 2 weeks after injection of PBS (buffer), AAV-FKRP, AV-FKRP-single, or AAV-FKRP-tandem.

[0049] Fig. 9 : Body weight curves of rats injected with AV-FKRP-single or AAV-FKRP-tandem.

[0050] Fig.10 : Histological analysis of rat myocardium 11 weeks after injection of AAV-FKRP-single and AAV-FKRP-tandem at a dose of 7.5e13 vg / kg and HES staining (top, scale = 50 μm) or Sirius red staining (bottom). DETAILED DESCRIPTION

[0051] The present invention is based on the inventors' discovery that expression systems designed to produce FKRP protein at high levels in skeletal muscle may simultaneously result in potentially toxic expression in the heart following systemic administration, rendering the system unsuitable for therapeutic use.

[0052] The present invention provides a technical solution to this newly discovered problem, particularly with respect to excessive cardiac leakiness in addition to skeletal muscle expression of the FKRP transgene.

[0053] Thus, in general, the present invention relates to an expression system comprising a sequence encoding a FKRP protein, said expression system allowing:

[0054] - the protein is expressed at therapeutically acceptable levels in the target tissue, advantageously in skeletal muscle; and

[0055] - The protein is expressed in all tissues, especially in the heart, at levels acceptable for toxicity.

[0056] In the framework of the present invention, an expression system is generally defined as a polynucleotide that allows the in vivo production of FKRP. According to one aspect, the system comprises a nucleic acid encoding a FKRP protein and regulatory elements required for its expression (including at least a promoter). The expression system may then correspond to an expression cassette. Alternatively, the expression cassette may be carried by a vector or a plasmid. The term "expression system" as used herein covers all aspects.

[0057] According to the present invention, target tissue is defined as the tissue or organ in which the protein will exert a therapeutic effect, especially in the case where the native gene encoding the protein is defective. According to a specific embodiment of the present invention, the target tissue refers to striated skeletal muscle, hereinafter referred to as skeletal muscle, i.e. all muscles involved in locomotion and the diaphragm. Other potential target tissues are the retina and the brain.

[0058] As mentioned above, the heart is also affected by various diseases associated with FKRP deficiency and is therefore also a potential target tissue. However, in the framework of the present application, it has been shown that FKRP can show cardiotoxicity when overexpressed. Therefore, with regard to gene transfer, the expression system should favor the expression of FKRP in the heart at toxicologically acceptable levels rather than at therapeutically acceptable levels, since cardiac abnormalities can be treated using different strategies (e.g., beta-blocker diuretics or ACE (angiotensin converting enzyme) inhibitors).

[0059] As demonstrated in this application, even if FKRP could exert a therapeutic effect in the heart, its expression level should be strictly regulated, since an excess of this protein in this tissue (especially in amounts exceeding the endogenous amount) could prove to be harmful or even lethal, and therefore toxic.

[0060] Therefore, in the context of the present invention, the heart must be protected from this potential toxicity.According to a particular embodiment, the expression system of the present invention ensures that FKRP is expressed in the heart at toxicologically acceptable protein levels.

[0061] Thus, according to a particular aspect, the present invention relates to an expression system comprising a sequence encoding a FKRP protein, said expression system allowing:

[0062] - The protein is expressed at therapeutically acceptable levels in target tissues including skeletal muscle and possibly the retina and brain; and

[0063] - The protein is expressed in all tissues, especially in the heart, at levels acceptable for toxicity.

[0064] Advantageously, the present invention relates to an expression system for systemic administration, said expression system comprising a sequence encoding a FKRP protein, wherein:

[0065] - FKRP is expressed at therapeutically acceptable levels in skeletal muscle; and

[0066] -FKRP is expressed in the heart at levels that are acceptable for toxicity.

[0067] According to a first feature, the expression system of the invention comprises a sequence encoding a FKRP protein, said sequence corresponding to a transgene. In the context of the present invention, the term "transgene" refers to a sequence, preferably an open reading frame, provided in trans using the expression system of the invention.

[0068] According to a specific embodiment, the sequence is an identical or identical copy of an endogenous sequence present in the genome of the organism that is introduced into the expression system.

[0069] According to another specific embodiment, the endogenous sequence has one or more mutations that render the protein partially or completely non-functional or even absent (lack of expression or activity of the endogenous protein) or not correctly localized in the desired subcellular compartment. In other words, preferably, the expression system of the invention is intended to be administered to subjects who have a defective copy of the sequence encoding the protein and have an associated pathology. In this context, the protein encoded by the sequence carried by the expression system of the invention can therefore be defined as a protein whose mutation leads to a pathology associated with FKRP deficiency.

[0070] Therefore, more generally, the sequences carried by the expression system of the invention can be defined as encoding proteins that are therapeutically active in the context of pathologies associated with FKRP deficiency. The concept of therapeutic activity is defined in conjunction with the term "therapeutically acceptable levels" as follows.

[0071] The sequence encoding the FKRP protein (also called "open reading frame" ORF) is a nucleic acid sequence or polynucleotide, and can be, in particular, single-stranded or double-stranded DNA (deoxyribonucleic acid), RNA (ribonucleic acid) or cDNA (complementary deoxyribonucleic acid).

[0072] Advantageously, the sequence encodes a functional protein, ie a protein capable of ensuring its native or essential function, in particular in skeletal muscle. This means that the protein produced using the expression system of the invention is appropriately expressed and localized, and is active.

[0073] According to a preferred embodiment, the sequence encodes a natural protein, which is preferably of human origin. It can also be a derivative or fragment of the protein, as long as the derivative or fragment retains the desired activity. Preferably, the term "derivative" or "fragment" refers to a protein sequence that has at least 60%, preferably 70%, even more preferably 80% or even 90%, 95% or 99% identity with the human FKRP sequence. For example, proteins from another source (non-human mammals, etc.) or truncated, even mutated but active proteins are also included. Therefore, in the context of the present invention, the term "protein" is understood to be a full-length protein (regardless of its origin), as well as its functional derivatives and fragments.

[0074] In a particular aspect, the disease treated by the expression system according to the invention is caused by a mutation in at least one gene that results in no FKRP protein being produced or a completely or partially non-functional protein being produced. According to the invention, the expression system helps produce the protein in an active form or amount that at least partially compensates for the lack of the native protein, or produces another protein that can compensate for the lack of the native protein. Thus, the administration of the expression system can improve or restore the normal phenotype in target tissues, particularly skeletal muscle, in terms of mobility and respiration.

[0075] The protein of interest in the context of the present invention is advantageously FKRP of human origin (SEQ ID NO: 5), even though for example the murine, rat or canine versions (sequences of which are available from databases) may be used.

[0076] According to a specific embodiment, the FKRP protein is a protein consisting of the sequence shown in SEQ ID NO:5 or comprising the sequence shown in SEQ ID NO:5 (corresponding to a protein of 495 amino acids). According to a specific embodiment, FKRP is a protein having the same functions as the natural human FKRP encoded by SEQ ID NO:5, in particular the ability to glycosylate α-dystroglycan (αDG) and / or at least partially alleviate one or more symptoms associated with FKRP deficiency, in particular the LGMD2I phenotype as described above. It may be a fragment and / or derivative thereof. According to one embodiment, the FKRP sequence has an identity greater than or equal to 60%, 70%, 80%, 90%, 95% or even 99% with the sequence SEQ ID NO:5.

[0077] Any sequence encoding these proteins, their functional therapeutic derivatives or fragments can be implemented as part of the expression system of the present invention. For example, the corresponding nucleotide sequence (cDNA) is the sequence identified as SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8 in WO2019 / 008157.

[0078] According to a specific embodiment, the sequence encoding FKRP comprises or consists of nucleotides 1659 to 3146 of the sequence SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 4.

[0079] Mutations in the FKRP gene in a known manner can give rise to the entire spectrum of pathologies caused by defective αDG glycosylation, from limb-girdle muscular dystrophy type 2I (LGMD2I; Muller et al., 2005), congenital muscular dystrophy type 1C (MDC1C; Brockington et al., 2001) to Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB; Beltran-Valero de Bernabe et al., 2004). Therefore, according to the strategy for replacing or transferring genes, providing in trans a sequence encoding a therapeutic FKRP, which is, for example, natural, helps to treat the pathologies.

[0080] The present invention relates to FKRP whose mutations lead to disease in one or more target tissues, particularly skeletal muscle, and FKRP produced from an expression system exhibits toxicity in at least one tissue, particularly the heart.

[0081] According to the present invention, advantageously, the expression system must allow expression of the FKRP protein in skeletal muscle at therapeutically acceptable levels.

[0082] Furthermore, according to another preferred embodiment, it must allow the expression of the FKRP protein in the heart at levels that are toxically acceptable.

[0083] In the context of the present invention, the term "protein expression" may be understood as "protein production". Therefore, the expression system must allow transcription and translation of the protein at the above-mentioned levels. Also important is the correct folding and localization of the protein.

[0084] The levels defined in the context of the present invention, ie "therapeutically acceptable" and "toxicologically acceptable", relate to the amount of protein and its activity.

[0085] The amount of protein produced in a given tissue can be assessed by immunoassay using antibodies to the protein (e.g., by Western blot or ELISA, or by mass spectrometry). Alternatively, the corresponding messenger RNA can be quantified, e.g., by PCR or RT-PCR. This quantification can be performed on one tissue sample or on several samples. Thus, in the case where the target tissue is skeletal muscle, it can be performed on one muscle type or on several muscle types (e.g., quadriceps, diaphragm, tibialis anterior, triceps, etc.).

[0086] In the context of the present invention, the term "therapeutically acceptable levels" refers to the fact that the protein produced by the expression system of the present invention contributes to the improvement of the patient's pathological condition (particularly in terms of quality of life or life span). Thus, in relation to diseases affecting skeletal muscle, this involves improving the muscle condition of a subject affected by the disease or restoring a muscle phenotype similar to that of a healthy subject. As described above, the muscle state, which is primarily defined by the strength, size, histology and function of the muscle, can be assessed by one of the following methods: biopsy, measuring the strength, tone, volume or activity of the muscle, clinical examination, medical imaging, biomarkers, etc.

[0087] Therefore, criteria that are helpful in assessing the benefit of treatment with respect to skeletal muscle and that can be assessed at different times after treatment are, in particular, at least one of the following:

[0088] - Increased life expectancy;

[0089] - Increased muscle strength;

[0090] - Improved histology; and / or

[0091] - Improved diaphragm function.

[0092] In the context of the present invention, the term "toxicologically acceptable levels" refers to the fact that the protein produced by the expression system of the present invention does not cause significant changes in the tissue (particularly histologically, physiologically and / or functionally). In particular, the expression of the protein may not be lethal. In a specific embodiment, the amount of protein produced in the tissue must not exceed the endogenous level of the protein in the tissue, particularly compared to healthy subjects. Toxicity in tissues can be assessed histologically, physiologically and functionally.

[0093] In the specific case of the heart, any toxicity of the protein can be assessed by studies of morphology and cardiac function, clinical examination, electrophysiology, imaging, biomarkers, life expectancy monitoring or histological analysis, including detection of fibrosis and / or cellular infiltration and / or inflammation, for example by staining with Sirius red or hematoxylin (e.g. hematoxylin-eosin-saffron (HES) or hematoxylin-phloxin-saffron (HFS)).

[0094] Advantageously, the efficacy and / or toxicity level of the expression system according to the invention is evaluated in animals, possibly in animals that have a defective copy of the gene encoding the protein and are therefore affected by the relevant pathology. Preferably, the expression system is administered systemically, for example by intravenous (iv) injection.

[0095] According to the invention, preferably, the expression system comprises at least one sequence which allows:

[0096] - preventing the expression of a protein or reducing its expression level in tissues where the expression of the protein is toxic, particularly in the heart; and / or

[0097] - Maintaining protein expression or increasing its expression level in target tissues, particularly in skeletal muscle and possibly in the retina and / or brain.

[0098] According to a particular embodiment, the present invention relates to an expression system, wherein it comprises at least one sequence:

[0099] - preventing the expression of FKRP in the heart or reducing its expression level; and / or

[0100] -Maintain the expression of FKRP in skeletal muscle or increase its expression level.

[0101] In the context of the present invention, the term "preventing expression" preferably refers to the case where there is no expression even in the absence of the sequence, while the term "reducing the expression level" refers to the case where expression is reduced (or decreased) by providing the sequence.

[0102] Similarly, the term "maintaining expression" preferably refers to the case where a comparable expression level exists even in the absence of the sequence, and the term "increasing the expression level" refers to the case where expression is increased by providing the sequence.

[0103] In the context of the present invention, there are at least three ways that can be combined to achieve the desired goal:

[0104] - Use of sequences that prevent the expression of a protein in tissues where the protein expression is toxic or reduce its expression level without reducing the expression level in the target tissue;

[0105] - Use of promoter sequences that ensure high expression levels in target tissues and low or no expression in tissues where protein expression is toxic;

[0106] - Use of vectors (preferably viral vectors) with appropriate tropism, ie, tropism for the target tissues higher than for tissues where protein expression would be toxic.

[0107] According to one aspect, the present invention relates to an expression system for systemic administration, comprising a sequence encoding a FKRP protein, and:

[0108] - a promoter sequence that allows expression of FKRP at therapeutically acceptable levels in skeletal muscle and a target sequence for the miRNA that is expressed in the heart; or

[0109] - A promoter sequence that allows expression of FKRP at therapeutically acceptable levels in skeletal muscle and exhibits promoter activity at toxicologically acceptable levels in the heart.

[0110] Suitably, the expression system of the invention comprises a promoter sequence controlling the transcription of the protein encoding sequence, preferably located 5' to the transgene and functionally linked thereto. Preferably, this ensures therapeutically acceptable levels of protein expression in skeletal muscle.

[0111] This can include inducible or constitutive, natural or synthetic (artificial) promoters. Similarly, they can be of any origin, including human, the same origin as the transgene or other origin.

[0112] According to a first embodiment, the promoter sequence corresponds to a non-selective promoter, i.e. a promoter with low tissue specificity and ensuring broadly similar expression levels in different tissues (perhaps in skeletal muscle and heart). The following can be cited as examples: cytomegalovirus (CMV), phosphoglycerate kinase 1 (PGK), EF1 or CMV early enhancer / chicken beta-actin (CAG) promoter.

[0113] According to a specific embodiment, this refers to a promoter sequence that is suitable for skeletal muscle expression but can cause expression in other tissues, in particular in other muscles (e.g. in the heart). Such promoters are considered to be muscle-specific, but they are not exclusive to muscle. The following can be cited as examples: promoter sequences from the desmin promoter (preferably the sequence SEQ ID NO: 6), the skeletal α-actin promoter (ACTA1), the muscle creatine kinase (MCK) promoter or the myosin heavy chain promoter and its derivatives (e.g. CK4 and MHCK7 promoters), or the C5-12 synthetic promoter.

[0114] According to a preferred embodiment of the present invention, the promoter sequence of the expression system is selected for its different promoter activities in different tissues. In this case, the sequence helps to improve the expression of protein in skeletal muscle while preventing the expression of protein in toxic tissues (mainly in the heart).

[0115] For example, in the case where the target tissue is skeletal muscle, the promoter is preferably a muscle-specific promoter. According to another advantageous feature, the promoter has low or no promoter activity in the heart, thereby allowing expression of the protein in this tissue at a toxicly acceptable level. More advantageously, low promoter activity in the heart is preferred.

[0116] According to a specific embodiment, the promoter sequence may correspond to the sequence of the promoter from the calpain 3 gene, preferably of human origin, even more preferably of sequence SEQ ID NO: 7. Another suitable promoter sequence is the promoter sequence of miRNA206 (miR206), preferably of human origin, more preferably of sequence SEQ ID NO: 8. These two promoters have been reported in document WO2014 / 167253 and are able to ensure that calpain 3 is expressed at therapeutically acceptable levels in skeletal muscle and that the protein is expressed at toxicologically acceptable levels in the heart.

[0117] According to a specific embodiment, the present invention thus relates to an expression system comprising a sequence encoding a FKRP protein, said sequence being placed under the control of a promoter having the sequence SEQ ID NO: 7 or SEQ ID NO: 8. Promoter sequences derived from the sequences SEQ ID NO: 7 and SEQ ID NO: 8 or corresponding to fragments thereof but having similar promoter activity (particularly in terms of tissue specificity and optionally effectiveness) are also covered by the present invention.

[0118] Any promoter showing an expression profile defined above, advantageously very low in the heart but sufficiently strong or even very strong in skeletal muscle, may be used.

[0119] Candidate promoter sequences can be derived from genes that have been reported to be highly active in skeletal muscle and that may have the desired expression profile, such as:

[0120] - Promoter of the γ-sarcoglycan gene;

[0121] - Skeletal α-actin (ACTA1) promoter or its derivatives;

[0122] - Muscle hybrid (MH) promoter, as disclosed by Piekarowicz et al. (2017, European Society Of Gene & Cell Therapy conference, poster P096; HUMAN GENE THERAPY 28:A44 (2017), DOI: 10.1089 / hum.2017.29055.abstracts);

[0123] - derivatives of the muscle creatine kinase promoter, in particular truncated MCK promoters with double (dMCK) or triple (tMCK) tandem MCK enhancers, or CK6 and CK8 promoters, as disclosed by Hauser et al. (2000, Molecular Therapy, Vol. 2, No 1, pages 16-24) and Wang et al. (2008, Gene Therapy, Vol. 15, pages 1489-99);

[0124] - A promoter comprising at least one sequence USE (upstream enhancer), such as identified in the Troponin I promoter sequence (Corin et al., 1995, Proc. Natl. Acad. Sci., Vol. 92, pages 6185-89) or a 100-bp deletion thereof (ΔUSE; Blain et al., 2010, Human Gene Therapy, Vol. 21, pages 127-34), possibly in 3 (x3) or 4 (x4) copies. Of particular interest are the DeltaUSEx3 (DUSEx3) promoter and the DeltaUSEx4 (DUSEx4) promoter.

[0125] The promoters of other genes can further be mentioned: troponin, myogenic factor 5 (Myf5), myosin light chain 1 / 3 fast (MLC1 / 3f), myogenic differentiation 1 (MyoD1), myogenin (Myog), paired box gene 7 (Pax7), MEF2.

[0126] Promoter sequences derived from said sequences or corresponding to fragments thereof but having similar promoter activity (particularly in terms of tissue specificity and possible effectiveness) are also covered within the present invention. Preferably, the term "derivative" or "fragment" refers to a sequence having at least 60%, preferably 70%, even more preferably 80% or even 90%, 95% or 99% identity with said sequence. Of particular interest are promoter sequences as defined above that allow for appropriate expression of FKRP in skeletal muscle and heart.

[0127] According to one embodiment, the expression system of the present invention comprises:

[0128] - a sequence encoding the FKRP protein, and

[0129] - A promoter sequence which allows expression of FKRP at therapeutically acceptable levels in skeletal muscle and exhibits promoter activity at toxicologically acceptable levels or even no activity in the heart, possibly one of those listed above.

[0130] If the promoter sequence does not allow the expression of the FKRP protein at toxically acceptable levels in all tissues, especially in the heart, it is advantageously associated with a sequence having the function of reducing the expression level of the FKRP protein in said tissues, in which protein expression is toxic.

[0131] Thus, the present application reports that the use of the desmin promoter to express FKRP leads to cardiotoxicity. In contrast, according to the present invention, the use of the desmin promoter (preferably the sequence SEQ ID NO: 6) associated with at least one miRNA-208a target sequence (preferably the sequence SEQ ID NO: 2) allows both:

[0132] - protein expression at therapeutically acceptable levels in skeletal muscle;

[0133] - Protein expression at levels acceptable for cardiotoxicity.

[0134] As already stated, said sequences are capable of preventing the expression of the FKRP protein or reducing its expression level in tissues where protein expression is toxic, in particular in the heart. This action can occur according to various mechanisms, in particular:

[0135] - According to the transcription level of protein-coding sequences;

[0136] - transcripts produced by transcription of protein-encoding sequences, e.g. by their degradation;

[0137] - Based on the translation of transcripts into proteins.

[0138] Such a sequence is preferably a target of a small RNA molecule, for example selected from the group consisting of:

[0139] -microRNA;

[0140] - Endogenous small interfering RNA or siRNA;

[0141] - Small fragments of transfer RNA (tRNA);

[0142] - RNA in intergenic regions;

[0143] - ribosomal RNA (rRNA);

[0144] - small nuclear RNA (snRNA);

[0145] - small nucleolar RNA (snoRNA);

[0146] -piwi-interacting RNA (piRNA).

[0147] Advantageously, this sequence helps to maintain the expression of the FKRP protein in the target tissue, preferably in skeletal muscle, or even increase its expression level.

[0148] Preferably, such a sequence is selected based on its effectiveness in tissues where protein expression is toxic. Since the effectiveness of the sequence may vary from tissue to tissue, it may be desirable to combine several of these sequences, selected based on their effectiveness in all target tissues where toxicity has been demonstrated.

[0149] According to a preferred embodiment, the sequence is a target sequence of a microRNA (miRNA). As is well known, such judiciously selected sequences contribute to the specific inhibition of gene expression in selected tissues.

[0150] Thus, according to a specific embodiment, the expression system of the invention comprises a target sequence of a microRNA (miRNA) expressed or present in a tissue in which the protein expression is toxic, in particular in the heart. Suitably, the amount of the miRNA present in the target tissue, preferably skeletal muscle, is less than the amount present in the tissue in which FKRP is toxic, or the miRNA may not even be expressed in the target tissue. According to a specific embodiment, the target miRNA is not expressed in skeletal muscle. According to another specific embodiment, it is specifically or even exclusively expressed in the heart.

[0151] As known to those skilled in the art, the presence or expression level of miRNA, in particular in a given tissue, can be assessed by PCR, preferably by RT-PCR, or by Northern blotting.

[0152] Different miRNAs as well as their target sequences and their tissue specificity are known to those skilled in the art and are described, for example, in document WO 2007 / 000668. MiRNAs expressed in the heart are, for example, miR-1, miR133a, miR-206, miR-499 and miR-208a. Of particular interest are miRNAs that are exclusively expressed in the heart, for example miR208a of sequence SEQ ID NO:21.

[0153] According to a particular embodiment, the expression system of the invention comprises a target sequence for miRNA-208a (also referred to as miR208a; SEQ ID NO: 21). Thus, it has been shown within the framework of the present invention that the use of this target sequence associated with FKRP can solve its cardiotoxicity problem. Preferably, this target sequence, which is identical in humans, dogs and mice, has a 22pb sequence SEQ ID NO: 2. Of course, any derivative or truncated sequence recognized by miRNA-208a can be implemented as part of the present invention. In particular, a sequence that differs from SEQ ID NO: 2 in one or several nucleotides, for example having at least 60%, 70%, 80%, 90% or even 95% identity with SEQ ID NO: 2, can be used, as long as it is able to bind to miR208a, i.e. it is a target sequence of miR208a, preferably being considered homologous to its seed sequence.

[0154] As already stated, the target sequence of the microRNA can be used alone or in combination with other sequences (advantageously the target sequence of the microRNA, which can be the same or different). These sequences can be used in tandem or in opposite directions. Regarding FKRP, it has been suggested to use the target sequence of mir122 expressed in the liver.

[0155] According to a preferred embodiment, in particular for the target sequence of miRNA208a, one (1) or more (in particular two (2) or four (4)) sequences can be implemented. Preferably, they are used in series, that is to say, all in the same direction. In the case of implementing multiple target sequences, they can be separated by DNA spacers of random sequence in a manner known to those skilled in the art.

[0156] Preferably, in the case of a target sequence of a miRNA (particularly miR208a), it is located 3' to the sequence encoding the protein, more advantageously inserted in the 3'UTR ("untranslated region") region of the expression system. Even more preferably, when the expression system comprises a polyadenylation signal at 3' of the cDNA encoding the protein, the sequence is inserted between the stop codon and the polyadenylation signal of the open reading frame.

[0157] In the context of the present invention, it has been demonstrated that at least one target sequence of miRNA-208a is suitable for obtaining toxicologically acceptable levels of FKRP protein at least in the heart.

[0158] According to one embodiment, the expression system of the present invention comprises:

[0159] - a sequence encoding the FKRP protein; and

[0160] - Target sequences of miRNAs expressed in the heart.

[0161] In addition, preferably, it further comprises a promoter sequence that controls the expression of FKRP. The promoter is preferably a promoter sequence that allows FKRP to be expressed at a therapeutically acceptable level in skeletal muscle, such as a desmin promoter, preferably a human desmin promoter (SEQ ID NO: 6).

[0162] According to a particular embodiment, the expression system comprises:

[0163] - a sequence encoding FKRP, placed under the control of a promoter allowing muscle expression (for example the promoter of desmin, preferably the promoter of human desmin, for example the sequence SEQ ID NO: 6);

[0164] - a target sequence of at least one miRNA expressed in the heart, preferably a target sequence of miRNA-208a, preferably the target sequence SEQ ID NO: 2.

[0165] According to a specific embodiment, the expression system according to the invention comprises or consists of:

[0166] - nucleotides 146 to 3946 of SEQ ID NO: 3; or

[0167] - nucleotides 146 to 3974 of SEQ ID NO:4.

[0168] In another specific form of embodiment, the expression system may comprise:

[0169] - a sequence encoding FKRP, placed under the control of a promoter, such as the promoter of desmin, preferably the promoter of human desmin, for example, the sequence of SEQ ID NO: 6, or the promoter of calpain 3, preferably the promoter of human calpain 3, for example, the sequence of SEQ ID NO: 7, or the promoter of miRNA206, preferably the promoter of human miRNA206, for example, the sequence of SEQ ID NO: 8;

[0170] - a target sequence of at least one miRNA expressed in the heart, preferably a target sequence of miRNA-208a, such as the sequence SEQ ID NO: 2, possibly two target sequences advantageously in tandem.

[0171] Thus, the different types of sequences detailed above can be combined in the same expression system.

[0172] According to the invention, the expression system or expression cassette comprises the elements necessary for the expression of the transgene present. In addition to those sequences as defined above to ensure and regulate the expression of the transgene, such a system may comprise other sequences, for example:

[0173] - a polyadenylation signal, such as polyA of SV40 or human hemoglobin, preferably inserted 3' to the coding sequence or 3' to the target sequence of the miRNA;

[0174] -Sequences that stabilize transcripts, such as intron 1 of human hemoglobin;

[0175] - Enhancer sequences.

[0176] The expression system according to the invention can be introduced into cells, tissues or bodies, in particular humans. In a manner known to those skilled in the art, the introduction can be carried out in vitro or in vivo, for example by transfection or transduction. According to another aspect, the present invention therefore comprises cells or tissues preferably of human origin, which comprise the expression system of the invention.

[0177] The expression system according to the invention (in this case an isolated nucleic acid) can be administered in a subject, i.e. in the form of naked DNA. In order to facilitate the introduction of this nucleic acid into cells, it can be combined with different chemical methods, such as colloidal dispersion systems (macromolecular complexes, nanocapsules, microspheres, beads) or lipid-based systems (oil-in-water emulsions, micelles, liposomes).

[0178] Alternatively, according to another preferred embodiment, the expression system of the present invention comprises a plasmid or a vector. Advantageously, such a vector is a viral vector. The viral vectors commonly used for mammalian (including human) gene therapy are known to those skilled in the art. Such a viral vector is preferably selected from the following list: a vector derived from herpes virus, a baculovirus vector, a lentivirus vector, a retrovirus vector, an adenovirus vector and an adeno-associated virus vector (AAV).

[0179] According to a specific embodiment of the present invention, the viral vector comprising the expression system is an adeno-associated virus (AAV) vector.

[0180] Adeno-associated virus (AAV) vectors have become powerful gene delivery tools for treating a variety of conditions. AAV vectors have many features that make them ideally suited for gene therapy, including a lack of pathogenicity, moderate immunogenicity, and the ability to transduce post-mitotic cells and tissues in a stable and efficient manner. By selecting the appropriate combination of AAV serotype, promoter, and delivery method, the expression of a specific gene contained in an AAV vector can be specifically targeted to one or more types of cells.

[0181] In one embodiment, the coding sequence is contained in an AAV vector. More than 100 naturally occurring AAV serotypes are known. There are many natural variants in the AAV capsid, allowing the identification and use of AAVs with properties that are particularly suitable for malnutrition pathologies. AAV viruses can be engineered using conventional molecular biology techniques, so that these particles can be optimized for cell-specific delivery of nucleic acid sequences, minimize immunogenicity, regulate stability and particle life, effectively degrade, and accurately deliver to the cell nucleus.

[0182] As mentioned above, the use of AAV vectors is a common mode of exogenous delivery of DNA because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the AAV serotypes isolated and well characterized from humans or non-human primates (NHPs), human serotype 2 is the first AAV to be developed as a gene transfer vector. Other AAV serotypes currently in use include AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, AAVrh74, AAV11, and AAV12. In addition, non-natural engineered variants and chimeric AAVs can also be useful.

[0183] The ideal AAV fragments for assembly into vectors include cap proteins (including vp1, vp2, vp3 and hypervariable regions), rep proteins (including rep 78, rep 68, rep 52 and rep 40) and sequences encoding these proteins. These fragments can be easily used in various vector systems and host cells.

[0184] Such fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs with non-naturally occurring capsid proteins. Such artificial capsids can be produced by any suitable technique using selected AAV sequences (e.g., fragments of vp1 capsid proteins) in combination with heterologous sequences, which can be obtained from a different selected AAV serotype, a non-contiguous portion of the same AAV serotype, a non-AAV viral source, or a non-viral source. The artificial AAV serotype can be, but is not limited to, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Thus, exemplary AAV or artificial AAV include AAV2 / 8 (US 7,282,199), AAV2 / 5 (available from the National Institutes of Health), AAV2 / 9 (WO2005 / 033321), AAV2 / 6 (US 6,156,303), AAVrh10 (WO2003 / 042397), AAVrh74 (WO2003 / 123503), AAV9-rh74 hybrid or AAV9-rh74-P1 hybrid (WO2019 / 193119), AAV variants disclosed in PCT / EP2020 / 061380, etc. In one embodiment, the vectors useful in the compositions and methods described herein contain at least a sequence encoding a capsid of a selected AAV serotype (e.g., an AAV8 capsid) or a fragment thereof. In another embodiment, a useful vector comprises at least a sequence or a fragment thereof encoding a selected AAV serotype rep protein (e.g., AAV8 rep protein). Optionally, such a vector may simultaneously comprise an AAV cap and a rep protein. In a vector that provides AAV rep and cap simultaneously, both AAV rep and AAV cap sequences may be a serotype source, e.g., all AAV8 sources. Alternatively, a vector in which the rep sequence is from an AAV serotype may be used that is different from the vector providing the cap sequence. In one embodiment, rep and cap sequences are expressed from different sources (e.g., different vectors, or host cells and vectors). In another embodiment, these rep sequences are fused in frame to cap sequences of different AAV serotypes to form a chimeric AAV vector, e.g., AAV2 / 8 (US 7,282,199).

[0185] According to one embodiment, the composition comprises AAV of serotype 2, 5, 8 or 9, or AAVrh74. Advantageously, the claimed vector is an AAV8 or AAV9 vector, in particular an AAV2 / 8 or AAV2 / 9 vector. More advantageously, the claimed vector is an AAV9 vector or an AAV2 / 9 vector.

[0186] In the AAV vector used in the present invention, the AAV genome can be a single-stranded (ss) nucleic acid or a double-stranded (ds) / self-complementary (sc) nucleic acid molecule.

[0187] Advantageously, the polynucleotide encoding the FKRP protein is inserted between the ITR ("inverted terminal repeat") sequences of the AAV vector. Typical ITR sequences correspond to nucleotides 1 to 145 (5'ITR sequence) of SEQ ID NO: 1 and nucleotides 3913 to 4057 (3'ITR sequence) of SEQ ID NO: 1.

[0188] Recombinant viral particles can be obtained by any method known to those skilled in the art, such as by co-transfection of 293HEK cells with the herpes simplex virus system and the baculovirus system. Vector titers are usually expressed as viral genomes per milliliter (vg / mL).

[0189] In one embodiment, the vector comprises regulatory sequences, in particular promoter sequences, advantageously as described above.

[0190] A non-exhaustive list of other possible regulatory sequences is:

[0191] - a sequence for transcriptional stabilization, such as intron 1 of hemoglobin (HBB2), corresponding, for example, to nucleotides 1207 to 1652 of SEQ ID NO: 1. As shown in the sequence SEQ ID NO: 1, the HBB2 intron is advantageously followed by a consensus Kozak sequence (GCCACC) included before the AUG start codon in the mRNA to improve the initiation of translation;

[0192] - a polyadenylation signal, such as polyA of the target gene, polyA of SV40 or beta hemoglobin (HBB2), advantageously located 3' to the sequence encoding human FKRP. As a preferred example, the poly A of HBB2 corresponds to nucleotides 3147 to 3912 of SEQ ID NO: 1;

[0193] - enhancer sequences;

[0194] - miRNA target sequence, which can inhibit the expression of the sequence encoding human FKRP in non-target tissues, where the expression is undesirable, for example in cases where it could be toxic. As an example, it can be a target sequence for miR122 to avoid liver toxicity. Preferably, the corresponding miRNA is not present in skeletal muscle.

[0195] With regard to the coding sequence SEQ ID NO:5 and, for example, the polynucleotide corresponding to nucleotides 1659 to 3146 of SEQ ID NO:1, the vector of the present invention may comprise the sequences shown in SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0196] According to a preferred embodiment, the expression system of the invention comprises a vector with an appropriate tropism, in this case a higher tropism for the target tissue (advantageously skeletal muscle) than for tissues where protein expression appears toxic. Advantageously, the expression system of the invention comprises a vector with a higher tropism for skeletal muscle than for the heart. It may be an AAV vector containing a capsid selected to minimize or not target / transduce the heart or to preferentially or even exclusively target / transduce skeletal muscle.

[0197] Further aspects of the invention relate to:

[0198] - A cell comprising the expression system of the present invention as disclosed above or a vector comprising said expression system.

[0199] The cell can be any type of cell, i.e., a prokaryotic cell or a eukaryotic cell. The cell can be used for the proliferation of the vector or can be further introduced (e.g., transplanted) into a host or subject. The expression system or vector can be introduced into the cell by any means known in the art, such as by transformation, electroporation, or transfection. Vesicles derived from the cell can also be used.

[0200] - a transgenic animal (advantageously non-human) comprising the expression system of the invention, a vector comprising said expression system, or a cell comprising said expression system or said vector as disclosed above.

[0201] Another aspect of the invention relates to a composition comprising an expression system, vector or cell as disclosed above for use as a medicament.

[0202] According to the embodiment, the composition comprises at least the gene therapy product (expression system, vector or cell), and possibly other active molecules (other gene therapy products, chemical molecules, peptides, proteins, ...) specifically used to treat the same disease or another disease.

[0203] According to a specific embodiment, the use of the expression system according to the invention is combined with the use of an anti-inflammatory drug or ribitol.

[0204] The present invention then provides a pharmaceutical composition comprising the expression system, vector or cell of the present invention. Such a composition comprises a therapeutically effective amount of a therapeutic agent (the expression system or vector or cell of the present invention) and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" refers to a diluent, adjuvant, excipient or carrier that is applied together with the therapeutic agent, approved by a regulatory agency of a federal or state government or listed in the U.S. or European Pharmacopoeia or other generally recognized pharmacopoeias for animals and humans. The term "carrier" refers to a diluent, adjuvant, excipient or carrier that is applied together with the therapeutic agent. Such a pharmaceutical carrier can be a sterile liquid, such as water and oil, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions and dextrose and glycerol aqueous solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talcum powder, sodium chloride, skim milk powder, glycerol, propylene glycol, water, ethanol, etc.

[0205] If necessary, the composition may also contain a small amount of a wetting agent or emulsifier or pH buffer. These compositions may take the form of solutions, suspensions, emulsions, sustained-release formulations, and the like. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin. Such compositions will contain a therapeutically effective amount of a therapeutic agent, preferably in a purified form, and a suitable amount of a carrier to provide a form suitable for administration to a subject.

[0206] In a preferred embodiment, the composition is formulated as a pharmaceutical composition suitable for intravenous administration to humans according to conventional procedures. Typically, the composition for intravenous administration is a solution in a sterile isotonic aqueous buffer. If necessary, the composition may also include a solubilizing agent and a local anesthetic, such as lidocaine, to relieve pain at the injection site.

[0207] In one embodiment, the composition according to the invention is suitable for administration in humans. The composition is preferably in liquid form, advantageously a saline composition, more advantageously a phosphate buffered saline (PBS) composition or a Ringer-lactic acid solution.

[0208] The amount of the therapeutic agent of the present invention (i.e., expression system or vector or cell) that will effectively treat the target disease can be determined by standard clinical techniques. In addition, in vivo and / or in vitro assays can be optionally used to help predict the optimal dosage range. The precise dose used in the formulation also depends on the route of administration, body weight, and severity of the disease and should be determined according to the judgment of the practitioner and the circumstances of each patient.

[0209] Appropriate administration should allow for the delivery of therapeutically effective amounts of the gene therapy product to target tissues, particularly skeletal muscle and possibly the heart. In the context of the present invention, when the gene therapy product is a viral vector comprising a polynucleotide encoding human FKRP, the therapeutic dose is defined as the number of viral particles (vg for viral genomes) containing the FKRP sequence administered per kilogram (kg) of subject.

[0210] Available routes of administration are topical, enteral (systemic effect, but delivered via the gastrointestinal tract (GI)) or parenteral (systemic effect, but delivered via routes other than the gastrointestinal tract). Preferred routes of administration for the compositions disclosed herein are parenteral, including intramuscular administration (i.e., into the muscle) and systemic administration (i.e., into the circulatory system). In this context, the term "injection" (or "perfusion" or "infusion") encompasses intravascular, particularly intravenous (IV), intramuscular (IM), intraocular, intrathecal or intracerebral administration. Injections are usually performed using a syringe or catheter.

[0211] In one embodiment, systemic delivery of the composition includes administering the composition near the local treatment site, i.e., in a vein or artery near a weakened muscle. In certain embodiments, the present invention includes local delivery of the composition, which produces a systemic effect. This route of administration (commonly referred to as "local (locally limited) infusion", "administration by isolated (isolated) limb perfusion" or "high pressure transvenous limb perfusion") has been successfully used as a gene delivery method for muscular dystrophy.

[0212] According to one aspect, the composition is administered to an isolated limb (locally) by infusion or perfusion. In other words, the invention includes local delivery of the composition in the leg and / or arm by an intravascular route of administration (i.e., venous (transvenous) or arterial) under pressure. This is typically achieved by using a tourniquet to temporarily block blood circulation while allowing local diffusion of the injected product, such as disclosed by Toromanoff et al. (2008).

[0213] In one embodiment, the composition is injected into a limb of the subject. When the subject is a human, the limb can be an arm or a leg. According to one embodiment, the composition is administered at the lower part of the subject's body (e.g., below the knee) or at the upper part of the subject's body (e.g., below the elbow).

[0214] The preferred method of administration according to the present invention is systemic administration. Systemic injection opens up the way to inject the entire body to reach the entire muscle of the subject's body (including the heart and diaphragm) and then truly treat these systemic and still incurable diseases. In certain embodiments, systemic delivery includes delivering the composition to the subject so that the composition can be distributed throughout the subject's body.

[0215] According to a preferred embodiment, systemic administration is performed by injecting the composition in a blood vessel, ie intravascular (intravenous or intraarterial) administration. According to one embodiment, the composition is administered by intravenous injection through a peripheral vein.

[0216] Systemic administration is usually performed under the following conditions:

[0217] - a flow rate between 1 and 10 mL / min, advantageously between 1 and 5 mL / min, for example 3 mL / min;

[0218] - The total injection volume can vary between 1 and 20 mL, preferably 5 mL of the vector formulation per kg of subject. The injection volume should not exceed 10% of the total blood volume, preferably about 6%.

[0219] When delivered systemically, the composition is preferably delivered in an amount of less than or equal to 10 15 vg / kg or even 10 14 vg / kg, advantageously higher than or equal to 10 10 , 10 11 or even 10 12 vg / kg. Specifically, the dose can be 5.10 12 vg / kg and 10 14 vg / kg, such as 1, 2, 3, 4, 5, 6, 7, 8 or 9.10 13 vg / kg. For example, 1, 2, 3, 4, 5, 6, 7, 8 or 9.10 12 vg / kg to avoid potential toxicity and / or immune response. As known to those skilled in the art, the lowest possible dose that gives satisfactory results in terms of efficacy is preferred.

[0220] In specific embodiments, treatment comprises a single administration of the composition.

[0221] "Dystroglycanopathy" refers to a disease or pathology associated with abnormal glycosylation of alpha-dystroglycan (αDG). The defect may be caused by a defect in FKRP. According to a specific embodiment, the pathology is selected from the group consisting of limb-girdle muscular dystrophy type 2I or R9 (LGMD2I or LGMD2 R9), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB), advantageously LGMD2I.

[0222] Subjects that can benefit from the compositions of the present invention include all patients diagnosed with such diseases or at risk of developing such diseases. Subjects to be treated can then be selected by any method known to those skilled in the art (including, for example, FKRP gene sequencing) based on the identification of mutations or deletions in the FKRP gene, and / or by any method known to those skilled in the art to assess FKRP expression levels or activity. Therefore, the subjects include subjects who have already shown symptoms of the disease and subjects at risk of developing the disease. In one embodiment, the subjects include subjects who have already shown symptoms of the disease and subjects at risk of developing the disease. In another embodiment, the subjects are ambulatory patients and patients who are not ambulatory in the early stages.

[0223] Such compositions are particularly intended for use in gene therapy, in particular for the treatment of limb-girdle muscular dystrophy type 2I (LGMD2I), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB), advantageously LGMD2I.

[0224] According to one embodiment, the present invention relates to a method for treating dystroglycanosis, comprising administering to a subject a gene therapy product (expression system, vector or cell) as described above.

[0225] Advantageously, the dystroglycan disease is a pathology associated with abnormal glycosylation of alpha-dystroglycan (αDG) and / or FKRP deficiency. More advantageously, the pathology is limb-girdle muscular dystrophy type 2I (LGMD2I), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) or muscle-eye-brain disease (MEB).

[0226] In another aspect, the present invention provides a method for increasing the glycosylation of α-dystroglycan (αDG) in a cell, comprising delivering the expression system or vector of the present invention to the cell, wherein the FKRP polynucleotide is expressed in the cell, thereby producing FKRP and increasing the glycosylation of αDG.

[0227] Advantageously, the expression system is administered systemically in vivo, in particular in an animal, advantageously in a mammal and more preferably in a human.

[0228] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of those skilled in the art. Such techniques are fully explained in the literature, such as "Molecular Cloning: A Laboratory Manual", fourth edition (Sambrook, 2012); "Oligonucleotide Synthesis" (Gait, 1984); "Culture of Animal Cells" (Freshney, 2010); "Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1997); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Short Protocols in Molecular Biology" (Ausubel, 2002); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting", (Babar, 2011); "Current Protocols in Immunology" (Coligan, 2002). These techniques are applicable to the production of polynucleotides and polypeptides of the present invention, and therefore can be considered in preparing and practicing the present invention. Particularly useful techniques for specific embodiments will be discussed in the following sections.

[0229] The disclosures of each patent, patent application, and publication cited herein are hereby incorporated by reference in their entirety.

[0230] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and perform the claimed methods.

[0231] Experimental Examples

[0232] The present invention is further described in detail with reference to the following experimental examples and accompanying drawings. These examples are provided for illustrative purposes only and are not intended to be limiting.

[0233] In the application, the invention is described with respect to an AAV9 vector comprising a sequence encoding FKRP and one or two target sequences for miR208a placed under the control of a desmin promoter.

[0234] Materials and methods:

[0235] 1) Production of recombinant AAV vectors:

[0236] The expression cassette contained in the vector AAV-FKRP (SEQ ID NO: 1; see Figure 1 A) Corresponding to nucleotides 496 to 4550 of the sequence SEQ ID NO: 11 disclosed in WO2019 / 008157. 22 pb of the target sequence of miRNA-208a (SEQ ID NO: 2) (1 or 2 sequences, respectively), each separated by a DNA spacer, has been added to the 3'UTR region of FKRP cDNA. The corresponding expression cassette ( Figure 1 B) have the sequences SEQ ID NO: 3 and SEQ ID NO: 4, respectively, resulting in the vectors AAV-FKRP-single and AAV-FKRP-tandem.

[0237] In detail, the expression cassette of SEQ ID NO: 1 comprises:

[0238] - a 5'ITR sequence corresponding to nucleotides 1 to 145 of SEQ ID NO: 1; followed by

[0239] - human desmin promoter (SEQ ID NO:6) corresponding to nucleotides 146 to 1206 of SEQ ID NO:1; followed by

[0240] - The HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 1; followed by the previously inserted consensus Kozak sequence (GCCACC)

[0241] - a polynucleotide encoding human FKRP corresponding to nucleotides 1659 to 3146 of SEQ ID NO: 1 (SEQ ID NO: 5); followed by

[0242] - an HBB2 polyA sequence corresponding to nucleotides 3147 to 3912 of SEQ ID NO: 1; followed by

[0243] - a 3' ITR sequence corresponding to nucleotides 3913 to 4057 of SEQ ID NO: 1.

[0244] In detail, the expression cassette of SEQ ID NO: 3 comprises:

[0245] - a 5'ITR sequence corresponding to nucleotides 1 to 145 of SEQ ID NO: 3; followed by

[0246] - human desmin promoter (SEQ ID NO: 6) corresponding to nucleotides 146 to 1206 of SEQ ID NO: 3; followed by

[0247] - The HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 3; followed by the previously inserted consensus Kozak sequence (GCCACC)

[0248] - a polynucleotide encoding human FKRP corresponding to nucleotides 1659 to 3146 of SEQ ID NO: 3 (SEQ ID NO: 5); followed by

[0249] - the target sequence of miR208a corresponding to nucleotides 3153 to 3174 of SEQ ID NO: 3 (SEQ ID NO: 2); followed by

[0250] - an HBB2 polyA sequence corresponding to nucleotides 3181 to 3946 of SEQ ID NO: 3; followed by

[0251] - a 3' ITR sequence corresponding to nucleotides 3947 to 4091 of SEQ ID NO:3.

[0252] In detail, the expression cassette of SEQ ID NO:4 comprises:

[0253] - a 5'ITR sequence corresponding to nucleotides 1 to 145 of SEQ ID NO: 4; followed by

[0254] - human desmin promoter (SEQ ID NO:6) corresponding to nucleotides 146 to 1206 of SEQ ID NO:4; followed by

[0255] - The HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 4; followed by the previously inserted consensus Kozak sequence (GCCACC)

[0256] - a polynucleotide encoding human FKRP corresponding to nucleotides 1659 to 3146 of SEQ ID NO: 4 (SEQ ID NO: 5); followed by

[0257] - two tandem miR208a target sequences corresponding to nucleotides 3153 to 3174 and nucleotides 3181 to 3202 of SEQ ID NO: 4 (SEQ ID NO: 2); followed by

[0258] - an HBB2 polyA sequence corresponding to nucleotides 3209 to 3974 of SEQ ID NO: 4; followed by

[0259] - a 3' ITR sequence corresponding to nucleotides 3975 to 4119 of SEQ ID NO:4.

[0260] Using the three-plasmid transfection scheme as described previously (Bartoli et al., 2006), adenovirus-free rAAV2 / 9 virus preparations were produced by packaging the AAV2-ITR recombinant genome in the AAV9 capsid. In brief, HEK293 cells were co-transfected with pAAV-h junction protein-hFKRP, RepCap plasmid (pAAV2.9, Dr J. Wilson, UPenn) and adenovirus helper plasmid (pXX6; Apparailly et al., 2005) at a ratio of 1:1:2. Crude viral lysate was harvested 60 hours after transfection and lysed by freeze-thaw cycles. The viral lysate was purified by two rounds of CsCl ultracentrifugation followed by dialysis. The viral genome was quantified by TaqMan real-time PCR analysis using primers and probes specific to the FKRP coding sequence contained in the AAV vector genome. The primer pairs and TaqMan probes used for amplification are:

[0261] FKRPopt forward: GCCCTTCTACCCCAGGAATG (SEQ ID NO: 9)

[0262] FKRPopt reverse: AAACTTCAGCTCCAGGAACCTC (SEQ ID NO: 10); and

[0263] FKRPopt probe: TGCCCTTTGCTGGCTTTGTGGCCCAGGC (SEQ ID NO: 11).

[0264] Vector titers are expressed as viral genomes per milliliter (vg / ml).

[0265] 2) In vivo experiments:

[0266] Rats and mice were treated in accordance with French and European legislation on animal experiments. In this study, 10-12 week old Sprague-Dawley male rats and 4 week old male FKRP deficient mice (Gicquel et al., P094, Conférence European Society Of Gene & Cell Therapy 2017, doi: 10.1089 / hum.2017.29055.abstracts) were used.

[0267] According to the indicated dosage, the recombinant vector was injected into the tail vein of rats and mice as shown. An equal volume of saline buffer (PBS) was used as a control. Clinical status and animal weight were monitored regularly. Animals were killed at the specified time (2 weeks or 11 weeks for rats; 6 weeks for mice).

[0268] 3) Western Blot:

[0269] Heart and muscle tissue were cultured in PBS supplemented with EDTA-free complete protease inhibitor cocktail (Roche, Mechanical homogenization was performed in RIPA lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA) from Sigma-Aldrich, Switzerland. The nucleic acids contained in the samples were degraded by incubation with benzonase (Sigma, St. Louis, MO, USA) at 37°C for 15 minutes.

[0270] Proteins were separated using precast polyacrylamide gels (4-15%, BioRad, Hercules, CA, USA) and then transferred to nitrocellulose membranes.

[0271] Rabbit polyclonal antibodies against FKRP have been described previously (Gicquel et al., 2017). Nitrocellulose membranes were probed with antibodies against FKRP (1:100) and GAPDH (Santa Cruz Biotechnologies, Dallas, TX, USA, 1:5000) for 2 h at room temperature for normalization.

[0272] Finally, the membrane The cells were incubated together for detection by Odyssey infrared scanner (LI-CORBiosciences, Lincoln, NE, USA).

[0273] 4) PCR:

[0274] The vector copy number (VCN) in TA muscle was quantified by quantitative RT-PCR of the HBB2 polyA sequence contained in the vector genome and normalized using the titin gene (TTN).

[0275] HBB2pA forward: CTTGACTCCACTCAGTTCTCTTGCT (SEQ ID NO: 12);

[0276] HBB2pA reverse: CCAGGCGAGGAGAAACCA (SEQ ID NO: 13); and

[0277] HBB2pA probe: CTCGCCGTAAAACATGGAAGGAACACTTC (SEQ ID NO: 14).

[0278] TTN forward: GTCCCCTGCGTATCTGCTATG (SEQ ID NO: 15);

[0279] TTN reverse: CGCTCGTTTTCAATACTACCTCTCT (SEQ ID NO: 16); and

[0280] TTN probe: TCCGCAGCTCTAGTGGAAGAACCACC (SEQ ID NO: 17).

[0281] FKRP mRNA was extracted from TA muscle and heart using the TriZOL method and then quantified by quantitative RT-PCR using oligonucleotides and probes designed on the codon-optimized FKRP sequence and normalized by the expression of the P0 gene.

[0282] P0 forward: CTCCAAGCAGATGCAGCAGA (SEQ ID NO: 18);

[0283] P0 reverse: ATAGCCTTGCGCATCATGGT (SEQ ID NO: 19); and

[0284] P0 probe: CCGTGGTGCTGATGGGCAAGAA (SEQ ID NO: 20).

[0285] FKRPopt forward (SEQ ID NO: 9), FKRPopt reverse (SEQ ID NO: 10), and FKRPopt probe (SEQ ID NO: 11) are as described above.

[0286] 5) Histology:

[0287] Cross-sectional cryosections (8 μm thick) of the myocardium were stained with hematoxylin-eosin-saffron (HES), Sirius red, or hematoxylin-phlox red-saffron (HFS) using standard protocols.

[0288] Sections were mounted with PERTEX medium (Leica). Digital images were captured using an Axio Scan Z1 slide scanner (Zeiss).

[0289] result:

[0290] 1 / FKRP gene transfer induces cardiotoxicity

[0291] 1-1 / In rats

[0292] Five male Sprague-Dawley rats aged 10-12 weeks were transfected with AAV-FKRP at three different doses: Figure 1 A; systemic administration containing SEQ ID NO: 1): 1 e 12, 5 e 12 and 7.5 e 13 vg / kg. Two weeks after injection, the rats were euthanized and samples were taken. Heart sections were stained with hematoxylin-eosin-saffron (HES) and Sirius red.

[0293] Histology of rat hearts after administration of AAV-FKRP showed cardiac damage: Figure 2 As shown, rats were e Inflammation and fibrosis were clearly observed at day 15 after injection of the 13 vg / kg dose. In addition, one rat died under these conditions.

[0294] 1-2 / In mice

[0295] Since the mouse is the only mammalian species for which an animal model of FKRP deficiency has been developed and therefore the only species in which the therapeutic effects of the expression system can be explored, the potential cardiotoxicity of the AAV-FKRP vector was also investigated in this model.

[0296] AAV-FKRP was systemically administered to six 4-week-old male FKRP-deficient mice at the following four doses: 5 e 12.1.5 e 13.4.5 e 13 and 1 e 14 vg / kg. Six weeks after injection, mice were euthanized and samples were taken. Heart sections were stained with hematoxylin-radix-saffron (HPS) and Sirius red.

[0297] Even at the highest dose (1 e 14 vg / kg), all mice survived the study. In contrast (see below), one rat survived the study at 7.5 e Death occurred 2 weeks after administration of a dose of 13 vg / kg. This revealed that mice were less affected by systemic administration of AAV-FKRP than rats.

[0298] However, cardiac histology of mice after AAV-FKRP administration revealed cardiac damage: Figure 3 As shown, at a dose of 1 e Inflammation and fibrosis were observed in mice 6 weeks after 14 vg / kg injection.

[0299] Overall, the data presented reveal a cardiotoxic effect of AAV-FKRP, which was confirmed in 2 species (rat and mouse) and was completely unexpected.

[0300] 2 / Reducing FKRP transgenic expression in the heart alleviates cardiotoxicity without affecting muscle expression

[0301] As a proof of concept for preventing FKRP cardiotoxicity, one or two copies of the target sequence of a cardiac-specific micro-RNA (i.e., the target sequence of miR-208a) were introduced into the AAV-FKRP vector. The vector thus obtained ( Figure 1 B) are designated as AAV-FKRP-single (containing one target sequence for miR-208a and comprising SEQ ID NO: 3) and AAV-FKRP-tandem (containing two target sequences for miR-208a in the same orientation and comprising SEQ ID NO: 4).

[0302] 2-1 / Short-term (2-week) study in rats

[0303] Based on previous data, the rat model was chosen for further experiments because this animal model revealed cardiotoxicity in a rapid and clear manner, especially at a dose of 7.5 e 13 vg / kg.

[0304] Five male Sprague-Dawley rats aged 10-12 weeks were given a 7.5 e AAV-FKRP containing 0, 1 or 2 copies of the target of miR-208a (SEQ ID NO: 2) was systemically administered at a dose of 13 vg / kg. Two weeks after injection, the rats were euthanized and samples were taken.

[0305] a) Survival and weight follow-up:

[0306] The survival data is shown in the following table:

[0307] Injectable (iv) Survival Buffer 5 / 5 AAV-FKRP 4 / 5 AAV-FKRP-Single 5 / 5 AAV-FKRP-Tandem 5 / 5

[0308] The data showed that the only death occurred in the cohort administered AAV-FKRP, likely due to cardiotoxicity of this construct.

[0309] also, Figure 4 It was shown that rats injected with AAV-FKRP did not gain weight over time, whereas rats injected with AAV-FKRP-single or AAV-FKRP-tandem gained weight over time.

[0310] In conclusion, after 2 weeks, rats administered with AAV-FKRP-single or AAV-FKRP-tandem appeared to be healthier than rats administered with AAV-FKRP.

[0311] b) Quantification of vector copy number in TA muscle:

[0312] Using the titin gene (TTN) Figure 5 The data shown in were further normalized based on the quantification of the HBB2 polyA sequence contained in each vector genome, revealing similar infection levels of skeletal muscle tissue (i.e., TA muscle) with the three vectors.

[0313] Importantly, this confirmed that the introduction of the target sequence for miR208a did not have any negative impact on the efficiency of vector transfer in muscle, where the protein should be produced at therapeutic levels to cure muscle abnormalities associated with FKRP deficiency.

[0314] c) FKRP expression in the heart after gene transfer:

[0315] like Figure 6 As shown, a significant reduction in FKRP transgene expression was observed using constructs AAV-FKRP-single and AAV-FKRP-tandem compared to AAV-FKRP at the mRNA level (A) as well as at the protein level (B).

[0316] Notably, a single target sequence of miR208a was sufficient to observe this reduction.

[0317] d) Cardiac damage after gene transfer:

[0318] Figure 7 The data presented in revealed that the constructs AAV-FKRP-single and AAV-FKRP-tandem induced significantly reduced cardiac damage compared to AAV-FKRP. In other words, when FKRP transgene expression was reduced in the heart (even if regulated by adequate micro-RNA), the toxic effects were abolished.

[0319] e) FKRP expression in skeletal muscle after gene transfer:

[0320] like Figure 8 As shown, no reduction in FKRP transgene expression was observed for constructs AAV-FKRP-single and AAV-FKRP-tandem compared to AAV-FKRP in relation to TA muscle, both at the mRNA level (A) as well as at the protein level (B).

[0321] This demonstrates that the heart can be specifically detargeted using miR208a.Importantly, the introduction of the target sequence for miR208a did not have any negative impact on the efficiency of FKRP expression in skeletal muscle, where the protein should be produced at therapeutic levels to cure the muscle abnormalities associated with its deficiency.

[0322] 2-2 / Long-term (11-week) study in rats

[0323] The same experiments as reported above have been performed on rats, but 11 weeks after the injection.

[0324] a) Survival and weight follow-up:

[0325] Note that one rat died when sacrificed 2 weeks after AAV-FKRP administration, while all rats had severe cardiac damage. In contrast, all rats injected with AAV-FKRP-single or AAV-FKRP-tandem survived even 11 weeks after administration.

[0326] also, Fig. 9 It was shown that the body weight of rats injected with AAV-FKRP-single or AAV-FKRP-tandem did increase over time.

[0327] In conclusion, after 11 weeks, it appeared that all rats administered AAV-FKRP-single or AAV-FKRP-tandem were in good condition.

[0328] b) Cardiac damage after gene transfer:

[0329] also, Fig.10 It was confirmed that even after 11 weeks, no cardiac damage was observed.

[0330] In conclusion, the vectors AAV-FKRP-single and AAV-FKRP-tandem did not show any cardiotoxicity.

[0331] References:

[0332] Apparailly,F.,Khoury,M.,Vervoordeldonk,MJ,Adriaansen,J.,Gicquel,E.,Perez,N.,Riviere,C.,Louis-Plence,P.,Noel,D.,Danos,O.et al.(2005)Adeno-associated virus pseudotype 5vector improves gene transfer in arthriticjoints.Hum.Gene Ther.,16,426-434.

[0333] Bartoli,M.,Poupiot,J.,Goyenvalle,A.,Perez,N.,Garcia,L.,Danos,O.andRichard,I.(2006)Noninvasive monitoring of therapeutic gene transfer in animalmodels of muscular dystrophies.Gene Ther.,13,20-28.

[0334] Beltran-Valero de Bernabe,D.,Voit,T.,Longman,C.,Steinbrecher,A.,Straub,V.,Yuva,Y.,Herrmann,R.,Sperner,J.,Korenke,C.,Diesen,C.et al.(2004)Mutations in the FKRP gene can cause muscle-eye-brain disease and Walker-Warburg syndrome.J.Med.Genet.,41,e61.

[0335] Breton,C.and Imberty,A.(1999)Structure / function studies of glycosyltransferases.Curr.Opin.Struct.Biol.,9,563-571.

[0336] Brockington,M.,Blake,D.J.,Prandini,P.,Brown,S.C.,Torelli,S.,Benson,M.A.,Ponting,C.P.,Estournet,B.,Romero,N.B.,Mercuri,E.et al.(2001)Mutations inthe fukutin-related protein gene(FKRP)cause a form of congenital musculardystrophy with secondary laminin alpha2 deficiency and abnormal glycosylationof alpha-dystroglycan.Am.J.Hum.Genet.,69,1198-1209.

[0337] Gicquel et al.(2017)Hum Mol Genet,doi:10.1093 / hmg / ddx066.

[0338] Kanagawa,M.,Kobayashi,K.,Tajiri,M.,Manya,H.,Kuga,A.,Yamaguchi,Y.,Akasaka-Manya,K.,Furukawa,J.I.,Mizuno,M.,Kawakami,H.et al.(2016)Identification of a Post-translational Modification with Ribitol-Phosphateand Its Defect in Muscular Dystrophy.Cell reports,in press.

[0339] Mercuri,E.,Brockington,M.,Straub,V.,Quijano-Roy,S.,Yuva,Y.,Herrmann,R.,Brown,S.C.,Torelli,S.,Dubowitz,V.,Blake,D.J.et al.(2003)Phenotypicspectrum associated with mutations in the fukutin-related proteingene.Ann.Neurol.,53,537-542.

[0340] Muller,T.,Krasnianski,M.,Witthaut,R.,Deschauer,M.and Zierz,S.(2005)Dilated cardiomyopathy may be an early sign of the C826A Fukutin-relatedprotein mutation.Neuromuscul.Disord.,15,372-376.

[0341] Petri et al.(2015),International Journal of Cardiology,182(2015)403–411.

[0342] Rosales et al. (2011), Journal of Cardiovascular Magnetic Resonance, 13:39.

[0343] Sveen,ML,Schwartz,M.and Vissing,J.(2006)High prevalence andphenotype-genotype correlations of limb girdle muscular dystrophy type 2I inDenmark.Ann.Neurol.,59,808-815.

[0344] Toromanoff et al. (2008), Molecular Therapy 16(7):1291-99.

[0345] Wahbi, K., Meune, C., Hamouda el, H., Stojkovic, T., Laforet, P., Becane, HM, Eymard, B. and Duboc, D. (2008) Cardiac assessment of limb-girdle musculardystrophy 2I patients: an echography, Holter ECG and magnetic resonance imagingstudy.Neuromuscul.Disord.,18,650-655. Sequence Listing <110> genison University of Evry-Val-d'Essonne National Institutes of Health and Medicine <120> Gene therapy expression system to alleviate FKRP cardiotoxicity <130> G143-B-57711 PCT <150> EP19306134.8 <151> 2019-09-19 <160> twenty one <170> BiSSAP 1.3.6 <210> 1 <211> 4057 <212> DNA <213> Artificial sequence <220> <223> K7 AAV-FKRP <400> 1 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgccccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttccttaccc cctgcccccc acagctcctc tcctgtgcct 180 tgtttcccag ccatgcgttc tcctctataa atacccgctc tggtatttgg ggttggcagc 240 tgttgctgcc agggagatgg ttgggttgac atgcggctcc tgacaaaaca caaacccctg 300 gtgtgtgtgg gcgtgggtgg tgtgagtagg gggaatgaatc agggagggg cggggaccc 360 aggggggcagg agccacacaa agtctgtgcg ggggtgggag cgcacatagc aattggaaac 420 tgaaagctta tcagaccctt tctggaaatc agcccactgt ttaaaactt gaggccccac 480 cctcgacagt accggggagg aagagggcct gcactagtcc agagggaaac tgaggctcag 540 ggctagctcg cccatagaca tacatggcag gcaggctttg gccaggatcc ctccgcctgc 600 caggcgtctc cctgccctcc cttcctgcct agagacccccc accctcaagc ctggctggtc 660 tttgcctgag acccaaacct cttcgacttc aagagaatat ttaggaacaa ggtggtttag 720 ggcctttcct gggaacaggc cttgaccctt taagaaatga cccaaagtct ctccttgacc 780 aaaaagggga ccctcaaact aaagggaagc ctctcttctg ctgtctcccc tgaccccact 840 cccccccacc ccaggacgag gagataacca gggctgaaag aggcccgcct gggggctgca 900 gacatgcttg ctgcctgccc tggcgaagga ttggcaggct tgcccgtcac aggacccccg 960 ctggctgact caggggcgca ggcctcttgc gggggagctg gcctccccgc ccccacggcc 1020 acgggccgcc ctttcctggc aggacagcgg gatcttgcag ctgtcagggg aggggaggcg 1080 ggggctgatg tcaggaggga tacaaatagt gccgacggct gggggccctg tctcccctcg 1140 ccgcatccac tctccggccg gccgcctgcc cgccgcctc tccgtgcgcc cgccagcctc 1200 gccgcgtac acatattgac caaatcaggg taattttgca tttgtaattt taaaaatgc 1260 tttcttcttt tatatacttt ttttgttat cttatttcta atactttccc taatctcttt 1320 ctttcagggc aataatgata caatgtatca tgcctctttg caccattcta aagaataaca 1380 gtgataattt ctgggttaag gcaatagcaa tatttctgca tataaatatt tctgcatata 1440 aattgtaact gatgtaagag gtttcatatt gctaatagca gctacaatcc agctaccatt 1500 ctgcttttat tttttggttg ggataaggct ggattattct gagtccaagc taggcccttt 1560 tgctaatctt gttcatacct cttatcttcc tcccacagct cctgggcaac gtgctggtct 1620 ctgtgctggc ccatcacttt ggcaaagaat tcgccaccat gagactgacc aggtgccagg 1680 ctgccctggc tgctgccatc accctgaacc tgctggtgct gttctatgtg agctggctgc 1740 agcaccagcc caggaacagc agggccaggg gccccaggag ggcctctgct gctggcccca 1800 gggtgacagt gctggtgagg gagtttgagg cctttgacaa tgctgtgcct gagctggtgg 1860 acagcttcct gcagcaggac cctgcccagc ctgtggtggt ggctgctgat accctgccct 1920 acccccccct ggccctgccc aggatcccca atgtgaggct ggccctgctg cagcctgccc 1980 tggacaggcc tgctgctgcc agcaggcctg agacctatgt ggccacagag tttgtggccc 2040 tggtgcctga tggggccagg gctgaggccc ctggcctgct ggagaggatg gtggaggccc 2100 tgagggctgg ctctgccagg ctggtggctg cccctgtggc cacagccaac cctgccaggt 2160 gcctggccct gaatgtgagc ctgagagagt ggacagccag gtatggggct gcccctgctg 2220 cccccaggtg tgatgccctg gatggagatg ctgtggtgct gctgagggcc agggacctgt 2280 tcaacctgtc tgcccccctg gccaggcctg tggggaccag cctgtttctg cagacagccc 2340 tgaggggctg ggctgtgcag ctgctggacc tgacctttgc tgctgccagg cagccccccc 2400 tggctacagc ccacgccagg tggaaggctg agagggaggg cagggccagg agggctgccc 2460 tgctgagggc cctggggatc aggctggtga gctgggaggg gggcaggctg gagtggtttg 2520 gctgcaacaa ggagacaacc aggtgctttg ggacagtggt gggggatacc cctgcctacc 2580 tgtatgagga gaggtggacc cccccctgct gcctgagggc cctgagggag acagccaggt 2640 atgtggtggg ggtgctggag gctgctgggg tgaggtactg gctggagggg ggcagcctgc 2700 tgggggctgc caggcacggg gacattatcc cctgggacta tgatgtggac ctgggcatct 2760 acctggagga tgtgggcaac tgtgagcagc tgaggggggc tgaggctggc tctgtggtgg 2820 atgagagggg ctttgtgtgg gagaaggctg tggaggggga ctttttcagg gtgcagtact 2880 ctgagagcaa ccacctgcac gtggacctgt ggcccttcta ccccaggaat ggggtgatga 2940 ccaaggacac ctggctggac cacaggcagg atgtggagtt ccctgagcac ttcctgcagc 3000 ccctggtgcc cctgcccttt gctggctttg tggcccaggc ccccaacaac tacaggaggt 3060 tcctggagct gaagtttggc cctggggtga ttgagaaccc ccagtacccc aaccctgccc 3120 tgctgagcct gacaggctct ggctgaattc accccaccag tgcaggctgc ctatcagaaa 3180 gtggtggctg gtgtggctaa tgccctggcc cacaagtatc actaagctcg ctttcttgct 3240 gtccaatttc tattaaaggt tcctttgttc cctaagtcca actactaaac tgggggatat 3300 tatgaagggc cttgagcatc tggattctgc ctaataaaaa acatttattt tcattgcaat 3360 gatgtattta aattatttct gaatatttta ctaaaaaggg aatgtgggag gtcagtgcat 3420 ttaaaacata aagaaatgaa gagctagttc aaaccttggg aaaatacact atatcttaaa 3480 ctccatgaaa gaaggtgagg ctgcaaacag ctaatgcaca ttggcaacag ccctgatgcc 3540 tatgccttat tcatccctca gaaaaggatt caagtagagg cttgatttgg aggttaaagt 3600 tttgctatgc tgtattttac attacttatt gttttagctg tcctcatgaa tgtcttttca 3660 ctacccattt gcttatcctg catctctcag ccttgactcc actcagttct cttgcttaga 3720 gataccacct ttcccctgaa gtgttccttc catgttttac ggcgagatgg tttctcctcg 3780 cctggccact cagccttagt tgtctctgtt gtcttataga ggtctacttg aagaaggaaa 3840 aacagggggc atggtttgac tgtcctgtga gcccttcttc cctgcctccc ccactcacag 3900 tgacccggaa tcaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct 3960 cgctcactga ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct 4020 cagtgagcga gcgagcgcgc agagagggag tggccaa 4057 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR208a Target Sequence <400> 2 acaagctttt tgctcgtctt at 22 <210> 3 <211> 4091 <212> DNA <213> Artificial Sequence <220> <223> K7 AAV-FKRP - single <400> 3 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttccttaccc cctgcccccc acagctcctc tcctgtgcct 180 tgtttcccag ccatgcgttc tcctctataa atacccgctc tggtatttgg ggttggcagc 240 tgttgctgcc agggagatgg ttgggttgac atgcggctcc tgacaaaaca caaacccctg 300 gtgtgtgtgg gcgtgggtgg tgtgagtagg gggatgaatc agggaggggg cgggggaccc 360 agggggcagg agccacacaa agtctgtgcg ggggtgggag cgcacatagc aattggaaac 420 tgaaagctta tcagaccctt tctggaaatc agcccactgt ttataaactt gaggccccac 480 cctcgacagt accggggagg aagagggcct gcactagtcc agagggaaac tgaggctcag 540 ggctagctcg cccatagaca tacatggcag gcaggctttg gccaggatcc ctccgcctgc 600 caggcgtctc cctgccctcc cttcctgcct agagaccccc accctcaagc ctggctggtc 660 tttgcctgag acccaaacct cttcgacttc aagagaatat ttaggaacaa ggtggtttag 720 ggcctttcct gggaacaggc cttgaccctt taagaaatga cccaaagtct ctccttgacc 780 aaaaagggga ccctcaaact aaagggaagc ctctcttctg ctgtctcccc tgaccccact 840 cccccccacc ccaggacgag gagataacca gggctgaaag aggcccgcct gggggctgca 900 gacatgcttg ctgcctgccc tggcgaagga ttggcaggct tgcccgtcac aggacccccg 960 ctggctgact caggggcgca ggcctcttgc gggggagctg gcctccccgc ccccacggcc 1020 acgggccgcc ctttcctggc aggacagcgg gatcttgcag ctgtcagggg aggggaggcg 1080 ggggctgatg tcaggaggga tacaaatagt gccgacggct gggggccctg tctcccctcg 1140 ccgcatccac tctccggccg gccgcctgcc cgccgcctc tccgtgcgcc cgccagcctc 1200 gccgcgtac acatattgac caaatcaggg taattttgca tttgtaattt taaaaatgc 1260 tttcttcttt tatatacttt ttttgttat cttatttcta atactttccc taatctcttt 1320 ctttcagggc aataatgata caatgtatca tgcctctttg caccattcta aagaataaca 1380 gtgataattt ctgggttaag gcaatagcaa tatttctgca tataaatatt tctgcatata 1440 aattgtaact gatgtaagag gtttcatatt gctaatagca gctacaatcc agctaccatt 1500 ctgcttttat tttttggttg ggataaggct ggattattct gagtccaagc taggcccttt 1560 tgctaatctt gttcatacct cttatcttcc tcccacagct cctgggcaac gtgctggtct 1620 ctgtgctggc ccatcacttt ggcaaagaat tcgccaccat gagactgacc aggtgccagg 1680 ctgccctggc tgctgccatc accctgaacc tgctggtgct gttctatgtg agctggctgc 1740 agcaccagcc caggaacagc agggccaggg gccccaggag ggcctctgct gctggcccca 1800 gggtgacagt gctggtgagg gagtttgagg cctttgacaa tgctgtgcct gagctggtgg 1860 acagcttcct gcagcaggac cctgcccagc ctgtggtggt ggctgctgat accctgccct 1920 acccccccct ggccctgccc aggatcccca atgtgaggct ggccctgctg cagcctgccc 1980 tggacaggcc tgctgctgcc agcaggcctg agacctatgt ggccacagag tttgtggccc 2040 tggtgcctga tggggccagg gctgaggccc ctggcctgct ggagaggatg gtggaggccc 2100 tgagggctgg ctctgccagg ctggtggctg cccctgtggc cacagccaac cctgccaggt 2160 gcctggccct gaatgtgagc ctgagagagt ggacagccag gtatggggct gcccctgctg 2220 cccccaggtg tgatgccctg gatggagatg ctgtggtgct gctgagggcc agggacctgt 2280 tcaacctgtc tgcccccctg gccaggcctg tggggaccag cctgtttctg cagacagccc 2340 tgaggggctg ggctgtgcag ctgctggacc tgacctttgc tgctgccagg cagccccccc 2400 tggctacagc ccacgccagg tggaaggctg agagggaggg cagggccagg agggctgccc 2460 tgctgagggc cctggggatc aggctggtga gctgggaggg gggcaggctg gagtggtttg 2520 gctgcaacaa ggagacaacc aggtgctttg ggacagtggt gggggatacc cctgcctacc 2580 tgtatgagga gaggtggacc cccccctgct gcctgagggc cctgagggag acagccaggt 2640 atgtggtggg ggtgctggag gctgctgggg tgaggtactg gctggagggg ggcagcctgc 2700 tgggggctgc caggcacggg gacattatcc cctgggacta tgatgtggac ctgggcatct 2760 acctggagga tgtgggcaac tgtgagcagc tgaggggggc tgaggctggc tctgtggtgg 2820 atgagagggg ctttgtgtgg gagaaggctg tggaggggga ctttttcagg gtgcagtact 2880 ctgagagcaa ccacctgcac gtggacctgt ggcccttcta ccccaggaat ggggtgatga 2940 ccaaggacac ctggctggac cacaggcagg atgtggagtt ccctgagcac ttcctgcagc 3000 ccctggtgcc cctgcccttt gctggctttg tggcccaggc ccccaacaac tacaggaggt 3060 tcctggagct gaagtttggc cctggggtga ttgagaaccc ccagtacccc aaccctgccc 3120 tgctgagcct gacaggctct ggctgatcta gaacaagctt tttgctcgtc ttatctcgag 3180 attcacccca ccagtgcagg ctgcctatca gaaagtggtg gctggtgtgg ctaatgccct 3240 ggcccacaag tatcactaag ctcgctttct tgctgtccaa tttctattaa aggttccttt 3300 gttccctaag tccaactact aaactggggg atattatgaa gggccttgag catctggatt 3360 ctgcctaata aaaaacattt attttcattg caatgatgta tttaaattat ttctgaatat 3420 tttactaaaa agggaatgtg ggaggtcagt gcatttaaaa cataaagaaa tgaagagcta 3480 gttcaaacct tgggaaaata cactatatct taaactccat gaaagaaggt gaggctgcaa 3540 acagctaatg cacattggca acagccctga tgcctatgcc ttattcatcc ctcagaaaag 3600 gattcaagta gaggcttgat ttggaggtta aagttttgct atgctgtatt ttacattact 3660 tattgtttta gctgtcctca tgaatgtctt ttcactaccc atttgcttat cctgcatctc 3720 tcagccttga ctccactcag ttctcttgct tagagatacc acctttcccc tgaagtgttc 3780 cttccatgtt ttacggcgag atggtttctc ctcgcctggc cactcagcct tagttgtctc 3840 tgttgtctta tagaggtcta cttgaagaag gaaaaacagg gggcatggtt tgactgtcct 3900 gtgagccctt cttccctgcc tcccccactc acagtgaccc ggaatcagga acccctagtg 3960 atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 4020 gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagagag 4080 ggagtggcca a 4091 <210> 4 <211> 4119 <212> DNA <213> Artificial Sequence <220> <223> K7 AAV-FKRP-Tandem <400> 4 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgccccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttccttaccc cctgcccccc acagctcctc tcctgtgcct 180 tgtttcccag ccatgcgttc tcctctataa atacccgctc tggtatttgg ggttggcagc 240 tgttgctgcc agggagatgg ttgggttgac atgcggctcc tgacaaaaca caaacccctg 300 gtgtgtgtgg gcgtgggtgg tgtgagtagg gggaatgaatc agggagggg cggggaccc 360 aggggggcagg agccacacaa agtctgtgcg ggggtgggag cgcacatagc aattggaaac 420 tgaaagctta tcagaccctt tctggaaatc agcccactgt ttaaaactt gaggccccac 480 cctcgacagt accggggagg aagagggcct gcactagtcc agagggaaac tgaggctcag 540 ggctagctcg cccatagaca tacatggcag gcaggctttg gccaggatcc ctccgcctgc 600 caggcgtctc cctgccctcc cttcctgcct agagacccccc accctcaagc ctggctggtc 660 tttgcctgag acccaaacct cttcgacttc aagagaatat ttaggaacaa ggtggtttag 720 ggcctttcct gggaacaggc cttgaccctt taagaaatga cccaaagtct ctccttgacc 780 aaaaagggga ccctcaaact aaagggaagc ctctcttctg ctgtctcccc tgaccccact 840 cccccccacc ccaggacgag gagataacca gggctgaaag aggcccgcct gggggctgca 900 gacatgcttg ctgcctgccc tggcgaagga ttggcaggct tgcccgtcac aggacccccg 960 ctggctgact caggggcgca ggcctcttgc gggggagctg gcctccccgc ccccacggcc 1020 acgggccgcc ctttcctggc aggacagcgg gatcttgcag ctgtcagggg aggggaggcg 1080 ggggctgatg tcaggaggga tacaaatagt gccgacggct gggggccctg tctcccctcg 1140 ccgcatccac tctccggccg gccgcctgcc cgccgcctc tccgtgcgcc cgccagcctc 1200 gccgcgtac acatattgac caaatcaggg taattttgca tttgtaattt taaaaatgc 1260 tttcttcttt tatatacttt ttttgttat cttatttcta atactttccc taatctcttt 1320 ctttcagggc aataatgata caatgtatca tgcctctttg caccattcta aagaataaca 1380 gtgataattt ctgggttaag gcaatagcaa tatttctgca tataaatatt tctgcatata 1440 aattgtaact gatgtaagag gtttcatatt gctaatagca gctacaatcc agctaccatt 1500 ctgcttttat tttttggttg ggataaggct ggattattct gagtccaagc taggcccttt 1560 tgctaatctt gttcatacct cttatcttcc tcccacagct cctgggcaac gtgctggtct 1620 ctgtgctggc ccatcacttt ggcaaagaat tcgccaccat gagactgacc aggtgccagg 1680 ctgccctggc tgctgccatc accctgaacc tgctggtgct gttctatgtg agctggctgc 1740 agcaccagcc caggaacagc agggccaggg gccccaggag ggcctctgct gctggcccca 1800 gggtgacagt gctggtgagg gagtttgagg cctttgacaa tgctgtgcct gagctggtgg 1860 acagcttcct gcagcaggac cctgcccagc ctgtggtggt ggctgctgat accctgccct 1920 acccccccct ggccctgccc aggatcccca atgtgaggct ggccctgctg cagcctgccc 1980 tggacaggcc tgctgctgcc agcaggcctg agacctatgt ggccacagag tttgtggccc 2040 tggtgcctga tggggccagg gctgaggccc ctggcctgct ggagaggatg gtggaggccc 2100 tgagggctgg ctctgccagg ctggtggctg cccctgtggc cacagccaac cctgccaggt 2160 gcctggccct gaatgtgagc ctgagagagt ggacagccag gtatggggct gcccctgctg 2220 cccccaggtg tgatgccctg gatggagatg ctgtggtgct gctgagggcc agggacctgt 2280 tcaacctgtc tgcccccctg gccaggcctg tggggaccag cctgtttctg cagacagccc 2340 tgaggggctg ggctgtgcag ctgctggacc tgacctttgc tgctgccagg cagccccccc 2400 tggctacagc ccacgccagg tggaaggctg agagggaggg cagggccagg agggctgccc 2460 tgctgagggc cctggggatc aggctggtga gctgggaggg gggcaggctg gagtggtttg 2520 gctgcaacaa ggagacaacc aggtgctttg ggacagtggt gggggatacc cctgcctacc 2580 tgtatgagga gaggtggacc cccccctgct gcctgagggc cctgagggag acagccaggt 2640 atgtggtggg ggtgctggag gctgctgggg tgaggtactg gctggagggg ggcagcctgc 2700 tgggggctgc caggcacggg gacattatcc cctgggacta tgatgtggac ctgggcatct 2760 acctggagga tgtgggcaac tgtgagcagc tgaggggggc tgaggctggc tctgtggtgg 2820 atgagagggg ctttgtgtgg gagaaggctg tggaggggga ctttttcagg gtgcagtact 2880 ctgagagcaa ccacctgcac gtggacctgt ggcccttcta ccccaggaat ggggtgatga 2940 ccaaggacac ctggctggac cacaggcagg atgtggagtt ccctgagcac ttcctgcagc 3000 ccctggtgcc cctgcccttt gctggctttg tggcccaggc ccccaacaac tacaggaggt 3060 tcctggagct gaagtttggc cctggggtga ttgagaaccc ccagtacccc aaccctgccc 3120 tgctgagcct gacaggctct ggctgatcta gaacaagctt tttgctcgtc ttatcctagg 3180 acaagctttt tgctcgtctt atctcgagat tcaccccacc agtgcaggct gcctatcaga 3240 aagtggtggc tggtgtggct aatgccctgg cccacaagta tcactaagct cgctttcttg 3300 ctgtccaatt tctattaaag gttcctttgt tccctaagtc caactactaa actgggggat 3360 attatgaagg gccttgagca tctggattct gcctaataaa aaacatttat tttcattgca 3420 atgatgtatt taaattattt ctgaatattt tactaaaaag ggaatgtggg aggtcagtgc 3480 atttaaaaca taaagaaatg aagagctagt tcaaaccttg ggaaaataca ctatatctta 3540 aactccatga aagaaggtga ggctgcaaac agctaatgca cattggcaac agccctgatg 3600 cctatgcctt attcatccct cagaaaagga ttcaagtaga ggcttgattt ggaggttaaa 3660 gttttgctat gctgtatttt acattactta ttgttttagc tgtcctcatg aatgtctttt 3720 cactacccat ttgcttatcc tgcatctctc agccttgact ccactcagtt ctcttgctta 3780 gagataccac ctttcccctg aagtgttcct tccatgtttt acggcgagat ggtttctcct 3840 cgcctggcca ctcagcctta gttgtctctg ttgtcttata gaggtctact tgaagaagga 3900 aaaacagggg gcatggtttg actgtcctgt gagcccttct tccctgcctc ccccactcac 3960 agtgacccgg aatcaggaac ccctagtgat ggagttggcc actccctctc tgcgcgctcg 4020 ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc 4080 ctcagtgagc gagcgagcgc gcagagaggg agtggccaa 4119 <210> 5 <211> 495 <212> PRT <213> Homo sapiens <220> <223> FKRP <400> 5 Met Arg Leu Thr Arg Cys Gln Ala Ala Leu Ala Ala Ala Ile Thr Leu 1 5 10 15 Asn Leu Leu Val Leu Phe Tyr Val Ser Trp Leu Gln His Gln Pro Arg 20 25 30 Asn Ser Arg Ala Arg Gly Pro Arg Arg Ala Ser Ala Ala Gly Pro Arg 35 40 45 Val Thr Val Leu Val Arg Glu Phe Glu Ala Phe Asp Asn Ala Val Pro 50 55 60 Glu Leu Val Asp Ser Phe Leu Gln Gln Asp Pro Ala Gln Pro Val Val 65 70 75 80 Val Ala Ala Asp Thr Leu Pro Tyr Pro Pro Leu Ala Leu Pro Arg Ile 85 90 95 Pro Asn Val Arg Leu Ala Leu Leu Gln Pro Ala Leu Asp Arg Pro Ala 100 105 110 Ala Ala Ser Arg Pro Glu Thr Tyr Val Ala Thr Glu Phe Val Ala Leu 115 120 125 Val Pro Asp Gly Ala Arg Ala Glu Ala Pro Gly Leu Leu Glu Arg Met 130 135 140 Val Glu Ala Leu Arg Ala Gly Ser Ala Arg Leu Val Ala Ala Pro Val 145 150 155 160 Ala Thr Ala Asn Pro Ala Arg Cys Leu Ala Leu Asn Val Ser Leu Arg 165 170 175 Glu Trp Thr Ala Arg Tyr Gly Ala Ala Pro Ala Ala Pro Arg Cys Asp 180 185 190 Ala Leu Asp Gly Asp Ala Val Val Leu Leu Arg Ala Arg Asp Leu Phe 195 200 205 Asn Leu Ser Ala Pro Leu Ala Arg Pro Val Gly Thr Ser Leu Phe Leu 210 215 220 Gln Thr Ala Leu Arg Gly Trp Ala Val Gln Leu Leu Asp Leu Thr Phe 225 230 235 240 Ala Ala Ala Arg Gln Pro Pro Leu Ala Thr Ala His Ala Arg Trp Lys 245 250 255 Ala Glu Arg Glu Gly Arg Ala Arg Arg Ala Ala Leu Leu Arg Ala Leu 260 265 270 Gly Ile Arg Leu Val Ser Trp Glu Gly Gly Arg Leu Glu Trp Phe Gly 275 280 285 Cys Asn Lys Glu Thr Thr Arg Cys Phe Gly Thr Val Val Gly Asp Thr 290 295 300 Pro Ala Tyr Leu Tyr Glu Glu Arg Trp Thr Pro Pro Cys Cys Leu Arg 305 310 315 320 Ala Leu Arg Glu Thr Ala Arg Tyr Val Val Gly Val Leu Glu Ala Ala 325 330 335 Gly Val Arg Tyr Trp Leu Glu Gly Gly Ser Leu Leu Gly Ala Ala Arg 340 345 350 His Gly Asp Ile Ile Pro Trp Asp Tyr Asp Val Asp Leu Gly Ile Tyr 355 360 365 Leu Glu Asp Val Gly Asn Cys Glu Gln Leu Arg Gly Ala Glu Ala Gly 370 375 380 Ser Val Val Asp Glu Arg Gly Phe Val Trp Glu Lys Ala Val Glu Gly 385 390 395 400 Asp Phe Phe Arg Val Gln Tyr Ser Glu Ser Asn His Leu His Val Asp 405 410 415 Leu Trp Pro Phe Tyr Pro Arg Asn Gly Val Met Thr Lys Asp Thr Trp 420 425 430 Leu Asp His Arg Gln Asp Val Glu Phe Pro Glu His Phe Leu Gln Pro 435 440 445 Leu Val Pro Leu Pro Phe Ala Gly Phe Val Ala Gln Ala Pro Asn Asn 450 455 460 Tyr Arg Arg Phe Leu Glu Leu Lys Phe Gly Pro Gly Val Ile Glu Asn 465 470 475 480 Pro Gln Tyr Pro Asn Pro Ala Leu Leu Ser Leu Thr Gly Ser Gly 485 490 495 <210> 6 <211> 1061 <212> DNA <213> Artificial sequence <220> <223> Desmin promoter <400> 6 taccccctgc cccccacagc tcctctcctg tgccttgttt cccagccatg cgttctcctc 60 tataaatacc cgctctggta tttggggttg gcagctgttg ctgccaggga gatggttggg 120 ttgacatgcg gctcctgaca aaacacaaac ccctggtgtg tgtgggcgtg ggtggtgtga 180 gtagggggat gaatcaggga gggggcgggg gacccagggg gcaggagcca cacaaagtct 240 gtgcgggggt gggagcgcac atagcaattg gaaactgaaa gcttatcaga ccctttctgg 300 aaatcagccc actgtttata aacttgaggc cccaccctcg acagtaccgg ggaggaagag 360 ggcctgcact agtccagagg gaaactgagg ctcagggcta gctcgcccat agacatacat 420 ggcaggcagg ctttggccag gatccctccg cctgccaggc gtctccctgc cctcccttcc 480 tgcctagaga cccccaccct caagcctggc tggtctttgc ctgagaccca aacctcttcg 540 acttcaagag aatatttagg aacaaggtgg tttagggcct ttcctgggaa caggccttga 600 ccctttaaga aatgacccaa agtctctcct tgaccaaaaa ggggaccctc aaactaaagg 660 gaagcctctc ttctgctgtc tcccctgacc ccactccccc ccaccccagg acgaggagat 720 aaccagggct gaaagaggcc cgcctggggg ctgcagacat gcttgctgcc tgccctggcg 780 aaggattggc aggcttgccc gtcacaggac ccccgctggc tgactcaggg gcgcaggcct 840 cttgcggggg agctggcctc cccgccccca cggccacggg ccgccctttc ctggcaggac 900 agcgggatct tgcagctgtc aggggagggg aggcgggggc tgatgtcagg agggatacaa 960 atagtgccga cggctggggg ccctgtctcc cctcgccgca tccactctcc ggccggccgc 1020 ctgcccgccg cctcctccgt gcgcccgcca gcctcgcccg c 1061 <210> 7 <211> 1654 <212> DNA <213> Artificial Sequence <220> <223> Calpain 3 Promoter <400> 7 cacatgcctc cactctgcca tacttgaaat gtgctcatct ccttacagcc cagggagcag 60 ctattgtggg tagaagacaa ggtggaggcc aggcaggcac ttcccttccc cagagccact 120 tatgctctca tctaagagcc ctgaaaccag gtgtgacatc ccaggagttg acagacagtc 180 tggttcagta tctaattcca acttctgtct cagatgccta atgtggcatg gctgaatgag 240 tcaacatata acctgtacag taagtcctca cttaacatca ttgataggtg cttgtaaact 300 gtgactttaa cgaaaacata ccgtgtgctg tagggactta actcttgttt atatcagtta 360 gcctggttc actatacagt acatcatttt gcttaaagtc acagcttacg agaacctatc 420 gatgatgtta agtgaggatt ttctctgctc aggtgcacttt tttttttttt tttaagacgg 480 agtctctttc tgtcacctgg gctggagtgc agtggcgcga tctgggttca ctacaacctc 540 tgcctcctgg gttcaagcaa ttcttctgtc tcagcctccc aagtagctgg gattacaggc 600 acccgccgcc acacccggct tatttttgta tttttagtag agacagggtt tcactattgt 660 tggccatgct ggtctcgaac tcctgacctc atgtgatcca cccgcctcgg cctcccaaag 720 tgcagagatt agagacgtga gccacatggc ccagcaggac cactttttag cagattcagt 780 cccagtgttc atttgtgga tggggagaga caagaggtgg caaggtcaag tgtgcaggta 840 gagacaggga ttttctcaaa tgaggactct gctgagtagc attttccatg cagacatttc 900 caatgagcgc tgacccaaga acattctaaa aaagatacca aatctaacat tgaataatgt 960 tctgatatcc taaaatttta ggactaaaaa tcatgttctc taaaattcac agaatatttt 1020 tgtagaattc agtacctccc gttcacccta actagctttt ttgcaatatt gttttccatt 1080 catttgatgg ccagtagttg ggtggtctgt ataactgcct actcaataac atgtcagcag 1140 ttctcagctt ctttccagtg ttcaccttac tcagatactc ccttttcatt ttctggcaac 1200 accagcactt catggcaaca gaaatgtccc tagccaggtt ctctctctac catgcagtct 1260 ctcttgctct catactcaca gtgtttcttc acatctattt ttagttttcc tggctcaagc 1320 atcttcaggc cactgaaaca caaccctcac tctctttctc tctccctctg gcatgcatgc 1380 tgctggtagg agacccccaa gtcaacattg cttcagaaat cctttagcac tcatttctca 1440 ggagaactta tggcttcaga atcacagctc ggtttttaag atggacataa cctgtacgac 1500 cttctgatgg gctttcaact ttgaactgga tgtggacact tttctctcag atgacagaat 1560 tactccaact tcccctttgc agttgcttcc tttccttgaa ggtagctgta tcttattttc 1620 tttaaaaagc tttttcttcc aaagccactt gcca 1654 <210> 8 <211> 805 <212> DNA <213> Artificial Sequence <220> <223> miR206 Promoter <400> 8 gggggccaac tcttcctttg gcatatgttt ccccattttc tggcagagaa tcagatacca 60 caaagttcaa aaccccatct ccctccagcc agggtggcca tccagaccct gagtggctca 120 acagctgcca atgtccctca tccttctgag gctcaggcct cacagattgt ggggcaggtg 180 atgggctagg gggagcagaa gcccgacaaa aggatccttc ccacagtgaa caatggtgct 240 tggaatgctg gatgggcagc tgctgcccat caacaagcac ccaaaacaga tagacgtaca 300 gtaggaagta caggagggcc ggtgtgtttc taagcatgag tggctctctg cgtgaatgtg 360 gaaaatttct ctgttggatt ctctcttctt tttaattttc ccttcactgg atcccaaaca 420 ttaaaaaaga atcacattca aaatgcacaa aaacagcagc agtgaattaa ttagtagtaa 480 taacaaagga ctggatagac tgtagctgca caagaataag ccagggaaac gtggtgctgc 540 ttatctgtga acaaacagta ggaaggattt ggtcccaagc agcactgcca ttcctcacaa 600 cagatttatt tcagcatgat ttggtcgggc gggggggatt taggatgagt tgagatccca 660 gtgatcttct cgctaagagt ttcctgcctg ggcaaggagg aaagatgcta caagtggccc 720 acttctgaga tgcgggctgc ttctggatga cactgcttcc cgaggccaca tgcttcttta 780 tatccccata tggattactt tgcta 805 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FKRPopt Forward <400> 9 gcccttctac cccaggaatg 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FKRPopt Reverse <400> 10 aaacttcagc tccaggaacc tc 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> FKRPopt Probe <400> 11 tgccctttgc tggctttgtg gcccaggc 28 <210> 12 <211> 25 <212> DNA <213> Artificial sequence <220> <223> HBB2pA forward <400> 12 cttgactcca ctcagttctc ttgct 25 <210> 13 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HBB2pA reverse <400> 13 ccaggcgagg agaaacca 18 <210> 14 <211> 29 <212> DNA <213> Artificial sequence <220> <223> HBB2pA probe <400> 14 ctcgccgtaaaacatggaaggaacacttc 29 <210> 15 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> TTN forward <400> 15 gtcccctgcg tatctgctat g 21 <210> 16 <211> 25 <212> DNA <213> Artificial sequence <220> <223> TTN Reverse <400> 16 cgctcgtttt caatactacc tctct 25 <210> 17 <211> 26 <212> DNA <213> Artificial sequence <220> <223> TTN probe <400> 17 tccgcagctc tagtggaaga accacc 26 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <223> P0 forward <400> 18 ctccaagcag atgcagcaga 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> P0 Reverse <400> 19 atagccttgc gcatcatggt 20 <210> 20 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> P0 probe <400> 20 ccgtggtgct gatgggcaag aa 22 <210> twenty one <211> twenty two <212> RNA <213> Artificial sequence <220> <223> miR208a <400> twenty one auaagacgag caaaaagcuu gu 22

Claims

1. An expression system for systemic administration, the expression system comprising: - a sequence encoding the FKRP protein of SEQ ID NO: 5, placed under the control of a promoter sequence allowing expression of FKRP at therapeutically acceptable levels in skeletal muscle; and - One or two miR208a target sequences as shown in SEQ ID NO:

2. 2 . The expression system according to claim 1 , wherein the sequence encoding the FKRP protein consists of nucleotides 1659 to 3146 of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO:

4. 3 .

3. The expression system according to claim 1 or 2, wherein the expression system comprises a desmin promoter. The expression system according to claim 3 , wherein the sequence of the desmin promoter is SEQ ID NO:

6. 5 . The expression system according to claim 4 , wherein the expression system consists of nucleotides 146 to 3946 of the sequence SEQ ID NO: 3 or nucleotides 146 to 3974 of the sequence SEQ ID NO:

4.

6. The expression system according to claim 1 or 2, wherein the expression system comprises a promoter selected from the group consisting of: cytomegalovirus (CMV) promoter, phosphoglycerate kinase 1 (PGK-1) promoter, EF1 promoter, CMV early enhancer / chicken β-actin (CAG) promoter, skeletal α-actin 1 (ACTA1) promoter, muscle creatine kinase (MCK) promoter, myosin heavy chain promoter, CK4 promoter, MHCK7 promoter, C5-12 synthetic promoter, γ - Sarcoglycan promoter, muscle hybrid (MH) promoter, dMCK promoter, tMCK promoter, CK6 promoter, CK8 promoter, DUSEx3 promoter, DUSEx4 promoter, troponin promoter, myogenic factor 5 (Myf5) promoter, myosin light chain 1 / 3 fast (MLC1f or MLC3f) promoter, myogenic differentiation 1 (MyoD1) promoter, myogenin (Myog) promoter, paired box gene 7 (Pax7) promoter and MEF2 promoter. 7 . The expression system according to claim 6 , wherein the promoter is selected from the group consisting of: dMCK promoter, tMCK promoter, DUSEx3 promoter and DUSEx4 promoter.

8. The expression system according to claim 1 or 2, wherein the expression system comprises a viral vector.

9. The expression system of claim 8, wherein the viral vector is an adeno-associated viral vector (AAV).

10. The expression system according to claim 9, wherein the expression system comprises an AAV vector of serotype 8, or an AAV vector of serotype 9, or an AAV2 / 8 vector, or an AAV2 / 9 vector.

11. A pharmaceutical composition comprising the expression system according to any one of claims 1 to 10.

12. Use of the expression system according to any one of claims 1 to 10 or the pharmaceutical composition according to claim 11 for the manufacture of a medicament for the treatment of dystroglycanosis.

13. Use according to claim 12, wherein the dystroglycan disease is selected from the group consisting of limb-girdle muscular dystrophy type 2I, congenital muscular dystrophy type 1C, Walker-Warburg syndrome and muscle-eye-brain disease.

14. The use according to any one of claims 12 to 13, wherein the expression system or pharmaceutical composition is administered systemically.

15. The use according to claim 14, wherein the expression system or pharmaceutical composition is administered by intravenous injection.

Images