Application of TMOD3 and / or ADSL in non-small cell carcinoma

Abstract

Application of TMOD3 and / or ADSL in non-small cell carcinoma. The present invention discloses the application of reagents for detecting the expression levels of TMOD3 and / or ADSL in the preparation of products for detecting non-small cell lung cancer. The present invention also discloses the application of an ADSL promoter in the preparation of a drug for treating non-small cell lung cancer. The present invention reveals that the new NSCLC oncogene TMOD3 and tumor suppressor gene ADSL play important roles in the malignant progression and ferroptosis of non-small cell lung cancer and their potential molecular mechanisms, which can provide a basis for the diagnosis, treatment and prognosis of NSCLC, and provide a new research direction and theoretical basis for precision treatment.

Description

Technical Field

[0001] The present invention relates to the field of disease treatment, and in particular to the application of TMOD3 or ADSL in non-small cell cancer. Background Art

[0002] Non-small cell lung cancer (NSCLC) is one of the malignant tumors with the highest morbidity and mortality in my country and even in the world. It seriously endangers human health and is a difficult problem that needs to be solved urgently. At present, lung cancer is still one of the biggest threats to human life and health, of which non-small cell lung cancer accounts for 80%-85%. In recent years, treatment methods including targeted therapy, chemotherapy, surgery and radiotherapy for non-small cell lung cancer have made great progress. However, there are still many serious problems to be solved, mainly including: drug sensitivity caused by heterogeneity, recurrence and poor prognosis caused by drug resistance and metastasis, and lack of targeted and precise therapeutic targets. These factors have seriously affected the clinical effect of NSCLC treatment. Therefore, exploring new NSCLC oncogenes has important theoretical significance and clinical value for a more detailed and in-depth understanding of the pathogenesis of NSCLC, discovering new therapeutic targets and developing effective treatment strategies. It is also the focus and difficulty of lung cancer research at home and abroad.

[0003] Etiological analysis shows that abnormal expression and mutation of driver genes are important factors in the occurrence and development of NSCLC. On the other hand, increasing evidence shows that ferroptosis plays an important role in the occurrence and development of non-small cell carcinoma. Ferroptosis is a new type of programmed cell death different from apoptosis and autophagy. It can inhibit the growth of tumor cells and significantly improve the therapeutic effect of tumors. It has become an important therapeutic target for cancer treatment.

[0004] Tropomyosin regulatory protein TMOD3 is an important component of the cytoskeleton and can prevent the depolymerization of tip actin filaments. Some research results show that TMOD3 may play a role in the occurrence and development of cancer. However, research on the relationship between TMOD3 and tumors is very limited. Studies have reported that microRNA-490-3p can inhibit the proliferation and invasion of liver cancer cells by targeting TMOD3. In tumors, TMOD3 can control the balance between protruding structures and contractile structures by stabilizing actin-myosin filaments. TMOD3 promotes the malignant progression of liver cancer cells by activating the ERK / MAPK signaling pathway. TMOD3 is involved in heme oxygenase-mediated tumor cytoskeleton regulation in prostate cancer.

[0005] To date, the relationship between TMOD3 and non-small cell lung cancer remains unclear, and the molecular regulatory mechanism of ferroptosis in non-small cell lung cancer cells is also unclear, which is a major scientific issue. Therefore, this application explores the role and molecular mechanism of TMOD3 in the malignant progression of non-small cell lung cancer, which has important innovative significance. Summary of the Invention

[0006] To solve the above technical problems, one of the purposes of this application is to provide the use of TMOD3 and its interacting gene ADSL in the preparation of products for diagnosing or treating non-small cell lung cancer.

[0007] To achieve the above object, the specific technical solutions of the present invention are as follows:

[0008] In the first aspect, the present invention provides the application of a reagent for detecting the expression level of TMOD3 and / or ADSL in the preparation of a product for diagnosing and / or prognosticating non-small cell lung cancer.

[0009] Furthermore, TMOD3 is highly expressed in samples for detecting non-small cell lung cancer and is positively correlated with poor prognosis; ADSL is lowly expressed in samples for detecting non-small cell lung cancer.

[0010] In the second aspect, the present invention provides a kit for diagnosing or prognosticating non-small cell lung cancer, which comprises a reagent for detecting the expression level of TMOD3 in a sample and / or a reagent for detecting the expression level of ADSL.

[0011] Furthermore, the reagent is selected from:

[0012] a probe that specifically recognizes the TMOD3 or ADSL gene; or

[0013] a primer that specifically amplifies the TMOD3 or ADSL gene; or

[0014] an antibody or ligand that specifically binds to the TMOD3 or ADSL protein.

[0015] In the third aspect, the present invention provides the application of an ADSL promoter in the preparation of a drug for treating non-small cell lung cancer, and the ADSL promoter is selected from at least one of the following:

[0016] (a) a TMOD3 inhibitor;

[0017] (b) a ferroptosis activator;

[0018] (c) ADSL or a construct recombinantly expressing ADSL.

[0019] Furthermore, the drug for treating non-small cell lung cancer includes a drug that inhibits the proliferation of non-small cell lung cancer cells, a drug that inhibits the invasion and migration of non-small cell lung cancer cells, or a drug that promotes ferroptosis of non-small cell lung cancer cells.

[0020] The present invention confirms that TMOD3 can promote the activity of the Akt signaling pathway and inhibit ferroptosis in NSCLC cells, thereby promoting the occurrence and development of lung cancer.

[0021] Furthermore, the TMOD3 inhibitor can promote ADSL expression; the TMOD3 inhibitor includes a reagent that inhibits the expression level of TMOD3 and / or inhibits the functional activity of the TMOD3 expression product.

[0022] Furthermore, the reagent that inhibits the expression level of TMOD3 includes a TMOD3 RNA interference agent or antisense oligonucleotide; the reagent that inhibits the functional activity of the TMOD3 expression product includes an antibody that specifically binds to the TMOD3 protein.

[0023] Preferably, the RNA interference agent is a reagent that uses the sequence of TMOD3 as a target sequence and can inhibit the expression level of TMOD3, including: shRNA (small hairpin RNA), small interfering RNA (siRNA).

[0024] In a fourth aspect, the present invention provides a pharmaceutical composition for treating non-small cell lung cancer, which includes at least one of the following: a TMOD3 inhibitor, a ferroptosis activator, ADSL, or a construct for recombinant expression of ADSL;

[0025] In a fifth aspect, the present invention provides a method for screening candidate drugs for preventing and / or treating non-small cell lung cancer, which includes:

[0026] (1) Measuring the expression levels of TMOD3 and / or ADSL in cells capable of expression in the presence of a test reagent;

[0027] (2) Comparing the measurement result in step (1) with the expression levels of TMOD3 and / or ADSL measured in the absence of the test reagent;

[0028] Among them, if the measurement result in step (1) shows a decrease in TMOD3 or an increase in ADSL compared with the measurement result in the absence of the test reagent, it indicates that the test reagent is a candidate drug for preventing and / or treating non-small cell lung cancer.

[0029] Based on the above technical solutions, the present invention has the following beneficial effects:

[0030] The present invention discovers that TMOD3 interacts with ADSL, thereby inhibiting the function of ADSL and enhancing the malignant progression of NSCLC. ADSL is a tumor suppressor gene for NSCLC, but it is negatively regulated by TMOD3, inhibiting the ferroptosis process of A549 & SK-MES-1, ultimately leading to malignant progression.

[0031] The present invention reveals that the new NSCLC oncogene TMOD3 and the tumor suppressor gene ADSL play important roles in the malignant progression and ferroptosis of non-small cell lung cancer and their potential molecular mechanisms, which can provide a basis for the diagnosis, treatment and prognosis of NSCLC, and provide a new research direction and theoretical basis for precision treatment. Brief Description of the Drawings

[0032] Figure 1 Expression of TMOD3 in clinical tissues of non-small cell lung cancer: A: normal alveoli, B: normal bronchi, C: well-differentiated adenocarcinoma, D: well-differentiated squamous cell carcinoma, E: poorly-differentiated adenocarcinoma, F: poorly-differentiated squamous cell carcinoma.

[0033] Figure 2 Statistical analysis of the survival rate curve of patients with non-small cell lung cancer with high expression of TMOD3 gene.

[0034] Figure 3 Analysis of the expression of TMOD3 in non-small cell lung cancer cells and interference screening. A shows the expression of TMOD3 protein in each cell line, and B shows the expression of TMOD3 protein detected after transfection of TMOD3-siRNA into A549 and SK-MES-1 cells.

[0035] Figure 4 Interfering with TMOD3 significantly inhibits the proliferation of non-small cell lung cancer cells. Figure A shows the results of MTT assay, and Figure B shows the results of colony formation assay analysis.

[0036] Figure 5 Transwell assay analysis of the effect of interfering with TMOD3 on the invasion of non-small cell lung cancer. Figures A & B show A549 cells, and Figures C & D show SK-MES-1 cells.

[0037] Figure 6 Cell scratch assay analysis of the effect of interfering with TMOD3 on the invasion of non-small cell lung cancer. Figures A & B show A549 cells, and Figures C & D show SK-MES-1 cells.

[0038] Figure 7 Ferroptosis analysis of non-small cell lung cancer cell lines treated with TMOD3 interference. Figures A & B show that interfering with TMOD3 can further enhance the inhibitory effect of Erastin on the activity of non-small cell lung cancer cells, and Figures C & D show that interfering with TMOD3 can significantly increase the iron ion content in non-small cell lung cancer cells.

[0039] Figure 8 Effect of knocking down TMOD3 on the Akt signaling pathway in non-small cell lung cancer cells A549 (Figure A) and SK-MES-1 (Figure B).

[0040] Figure 9 qPCR confirmed that TMOD3 negatively regulates the ADSL gene in non-small cell lung cancer cells; Figure A: A549 cells, Figure B: SK-MES-1 cells.

[0041] Figure 10 Western blot confirmed that TMOD3 negatively regulates the ADSL protein in non-small cell lung cancer cells.

[0042] Figure 11 qPCR was used to detect the GSH expression level in non-small cell lung cancer cells with knocked-down TMOD3. Among them, shTMOD3-1 and shTMOD3-2 were the TMOD3 knockdown groups, and shRNA-NC was the control group.

[0043] Figure 12 qPCR was used to detect the effect of knocking down TMOD3 and the ferroptosis activator Erastin on the expression of ADSL. Among them, shTMOD3-1 and shTMOD3-2 were the TMOD3 knockdown groups, and shRNA-NC was the control group. Detailed implementation manners

[0044] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art.

[0045] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0046] Unless otherwise specified, all materials, reagents, etc. in the following examples can be obtained from commercial channels.

[0047] Example 1 Expression of TMOD3 in clinical samples of non-small cell lung cancer

[0048] A total of 118 cases of patients with non-small cell lung cancer (NSCLC) who underwent surgical resection and were pathologically diagnosed in the First Affiliated Hospital of China Medical University from 2014 to 2016 were selected. None of the 118 patients participating in this pathological correlation analysis had received radiotherapy and chemotherapy before surgery. There were 82 male patients (N = 82 cases) and 36 female patients (N = 36 cases), with ages ranging from 37 to 77 years. According to the eighth edition of the lung cancer TNM staging system of the International Union Against Cancer (UICC), there were 61 patients in stages I-IIa (N = 61 cases) and 57 patients in stages IIb-IV (N = 57 cases). According to the WHO classification system, there were 58 cases of squamous cell carcinoma (N = 58 cases), 60 cases of adenocarcinoma (N = 60 cases), 67 cases with medium to high differentiation (N = 67 cases), and 51 cases with low differentiation (N = 51 cases). For tumor size classification, there were 65 cases with a tumor size less than or equal to 3 cm (N = 65 cases) and 53 cases with a tumor size greater than 3 cm (N = 53 cases). There were 40 cases with lymph node metastasis (N = 40 cases) and 78 cases without lymph node metastasis (N = 78 cases).

[0049] The expression of TMOD3 in normal alveolar tissue, normal bronchial tissue, well-differentiated lung adenocarcinoma tissue, well-differentiated lung squamous cell carcinoma tissue, poorly-differentiated lung adenocarcinoma tissue, and poorly-differentiated lung squamous cell carcinoma tissue was analyzed by immunohistochemical staining. The results showed that compared with normal alveolar tissue and normal bronchial tissue, TMOD3 was significantly highly expressed in well-differentiated lung adenocarcinoma tissue, well-differentiated lung squamous cell carcinoma tissue, poorly-differentiated lung adenocarcinoma tissue, and poorly-differentiated lung squamous cell carcinoma tissue ( Figure 1 A-F, Table 1); meanwhile, through analysis in the GEPIA online database, it was found that the high expression of TMOD3 was closely related to the poor prognosis of patients with non-small cell lung cancer ( Figure 2 ).

[0050] The above results indicate that TMOD3 is highly expressed in clinical tissues of non-small cell lung cancer and is positively correlated with poor prognosis.

[0051] Table 1 Statistical table of clinical sample information

[0052]

[0053] Example 2 Effects of TMOD3 on the malignant progression phenotype of non-small cell lung cancer

[0054] 1. Analysis of the expression of TMOD3 in non-small cell lung cancer cells and interference screening

[0055] The non-small cell lung cancer cell lines A549, H1299, H460, and SK-MES-1, normal lung epithelial cells HEB2, and control cells Caco2 were cultured in 25T culture flasks. After resuscitating and subculturing for 2 generations, the cells could be used for experiments when the cell state was stable.

[0056] The expression of TMOD3 protein in non-small cell lung cancer cell lines A549, H1299, H460 and SK-MES-1 cells was analyzed by Western blot, and HBE2 and Caco2 cells were used as control groups for three repeated experiments. The results showed that the lung adenocarcinoma cell line A549 and the lung squamous carcinoma cell line SK-MES-1 showed high expression of TMOD3( Figure 3 A).

[0057] To further explore the role of TMOD3 in non-small cell lung cancer, the inventors designed three TMOD3 interference sequences, and the interference sequences are as follows:

[0058] siRNA1 (si1): GGACAGCTGTAGAATTGGA, SEQ ID No.1;

[0059] siRNA2 (si2): GGCACTGATTGATGCGTTA, SEQ ID No.2;

[0060] siRNA3 (si3): GGCCTGTAGCTGATGCGTTA, SEQ ID No.3.

[0061] TMOD3 was knocked down by siRNA interference technology, and the specific steps are as follows:

[0062] (1) Add 200 μl of Je'tPRIME buffer to a 1.5 ml EP tube, add 20 μM siRNA, vortex for 10 s and then centrifuge instantaneously, and let it stand for 5 min;

[0063] (2) Add 4 μl of JetPRIME Reagent transfection reagent, vortex for 10 s and then centrifuge instantaneously, and let it stand for 10 min;

[0064] (3) Add the mixture to serum-containing / serum-free Opti-MEM medium;

[0065] (4) Replace the complete medium 6 h after transfection with siRNA;

[0066] (5) Harvest the cells 48 h after transfection to detect the knockdown efficiency of TMOD3.

[0067] Through Western blot experiments, it was found that both siRNA1-2 had the effect of knocking down TMOD3, and among them, siRNA1 had the most ideal TMOD3 knockdown efficiency, which could significantly inhibit the expression of TMOD3 in A549 and SK-MES-1 cells( Figure 3 B). Therefore, TMOD3 siRNA1 was preferably used for research in subsequent experiments.

[0068] 2. Interfere with TMOD3 in non-small cell lung cancer cells and detect its effect on cell proliferation

[0069] (1) MTT

[0070] Interfere with TMOD3 in A549 and SK-MES-1 cells. Apply the MTT assay kit (Beyotime, ST316) combined with an enzyme-linked immunosorbent assay (ELISA) reader (Epoch, Biotek, USA) to measure the absorbance at 450 nm at 24 h, 48 h, 72 h, and 96 h after interfering with TMOD3. The results show that compared with the control interference treatment, interfering with TMOD3 significantly inhibits cell viability, indicating that interfering with TMOD3 can significantly inhibit the proliferation of non-small cell lung cancer cells ( Figure 4 A).

[0071] (2) Colony formation assay

[0072] Interfere with TMOD3 in A549 and SK-MES-1 cells. Apply the colony formation assay to analyze the proliferation of non-small cell lung cancer cells. The specific steps are as follows:

[0073] Seed cells in a 6-well plate and incubate overnight; the next day, when the cell confluence reaches 50 - 60%, transfect siRNA and infect TMOD3 for 48 h; harvest the cells and count them. Then, reseed the cells into a new 6-well plate according to the quantity gradient and continue to culture the cells for 14 days; harvest the cells, wash them with PBS, fix them with methanol, and stain them with crystal violet for 30 min; wash the crystal violet with double-distilled water, air-dry the cells, and take pictures.

[0074] The results show that compared with the control interference treatment, interfering with TMOD3 significantly reduces the number of colony formations of lung cancer cells, further indicating that interfering with TMOD3 can significantly inhibit the proliferation of non-small cell lung cancer cells ( Figure 4 B).

[0075] The above experiments show that interfering with TMOD3 significantly inhibits the proliferation of non-small cell lung cancer cells.

[0076] 3. Interfere with TMOD3 in non-small cell lung cancer cells and detect its effect on cell invasion and migration

[0077] (1) Transwell

[0078] Interfere with TMOD3 in A549 and SK-MES-1 cells. Use a Transwell 6-well cell culture plate to detect the cell invasion ability. The specific steps are as follows:

[0079] (a) Coating with Matrigel: Dilute Matrigel with serum-free cell culture medium or PBS buffer at a ratio of 1:8 under 4°C. Take 100 μl and evenly spread it on the surface of the polycarbonate membrane in the upper chamber, and place it at 37°C for 0.5 - 1 h to polymerize it into a gel;

[0080] (b) Cell culture: Take the cells to be tested in the logarithmic growth phase, wash them with PBS, then suspend the cells with serum-free medium, and adjust the cell density to 1 - 10*10 5 / ml;

[0081] (c) Seeding cells: Generally add 500 - 650 μL of medium containing 5% - 10% FBS or chemokine to the lower chamber of a 24-well plate, then use forceps to place the Transwell chamber into the 24-well plate. Take 100 - 200 μL of cell suspension and add it to the upper chamber (the number of cells per well is 1×10 5 ), and finally place it in an incubator for 12 - 48 h.

[0082] (d) Cell fixation: Take out the chamber, aspirate the medium, and gently wipe the Matrigel and the cells in the upper chamber with a cotton swab. Take a new 24-well plate and add 600 μL of 4% paraformaldehyde, then place the chamber in and fix for 20 - 30 min.

[0083] (e) Cell staining and counting: Discard the fixative, stain with 0.1% - 0.2% crystal violet for 5 - 10 min, wash 3 times with PBS to remove the crystal violet not bound to the cells, gently wipe the upper side of the chamber with a cotton swab to wipe off the dye non-specifically bound to the upper surface of the chamber for subsequent microscopy. After appropriate air drying, select 5 fields of view under a high-power microscope to observe and count the cells.

[0084] The results showed that compared with the control interference treatment, interfering with TMOD3 significantly inhibited the invasion ability of non-small cell lung cancer cells ( Figure 5 ).

[0085] (2) Wound healing assay

[0086] Interfere with TMOD3 in A549 and SK-MES-1 cells, and use the wound healing assay to analyze the effect of TMOD3 on the invasion of non-small cell lung cancer cells. The results showed that compared with the control interference treatment, interfering with TMOD3 significantly inhibited the invasion ability of non-small cell lung cancer cells ( Figure 6 ).

[0087] The above experiments showed that interfering with TMOD3 significantly inhibited the invasion and migration of non-small cell lung cancer cells.

[0088] Example 3 Study on the effect of TMOD3 on ferroptosis of non-small cell lung cancer cells

[0089] In A549 and SK-MES-1 cells, TMOD3 was interfered with, and at the same time, the cells were treated with the ferroptosis activator Erastin. The MTT assay kit (Abnova, KA0814) was used in combination with a microplate reader (Biotek Epoch microplate reader, USA) for analysis. The results showed that Erastin alone could inhibit the activity of non-small cell lung cancer cells; compared with the control interference treatment, interfering with TMOD3 could further enhance the inhibitory effect of Erastin on the activity of non-small cell lung cancer cells( Figure 7 A and B).

[0090] In A549 and SK-MES-1 cells, TMOD3 was interfered with. Analysis using an iron detection kit found that, compared with the control interference treatment, interfering with TMOD3 could significantly increase the iron ion content in non-small cell lung cancer cells( Figure 7 C and D).

[0091] The above experiments indicate that interfering with TMOD3 can induce ferroptosis in non-small cell lung cancer cells.

[0092] Example 4 Molecular mechanism of TMOD3 regulating the malignant progression and ferroptosis of non-small cell lung cancer cells

[0093] In A549 and SK-MES-1 cells, TMOD3 was interfered with. Western blot experiments were used to analyze the expression of ERK, Akt, and p38 and the phosphorylation levels of ERK, Akt, and p38 in non-small cell lung cancer cells. The results showed that, compared with the control interference treatment, interfering with TMOD3 could not change the expression levels of ERK, Akt, and p38, but could significantly inhibit the phosphorylation levels of ERK, Akt, and p38( Figure 8 A and B), indicating that interfering with TMOD3 can inhibit the activity of the Akt signaling pathway.

[0094] Example 5 Study on the interacting proteins of TMOD3

[0095] A549&SK-MES-1 cells were transfected with the TMOD3-Flag exogenous expression plasmid, and then immunoprecipitation / IP-Anti-Flag experiments were performed to pull down the proteins interacting with TMOD3; proteins were screened by liquid chromatography-tandem mass spectrometry analysis / MS. It was found that the predicted amino acid sequence of the pulled-down interacting protein was highly similar to that of the ADSL protein, and it was suspected that ADSL was an interacting protein of TMOD3.

[0096] To verify whether the pulled-down protein was ADSL, the following experiments were conducted:

[0097] 1. To construct a cell line with stable knockdown of the shRNA-TMOD3 gene, the siRNA1 and 2 sequences were respectively constructed into an expression vector and transfected into the A549&SK-MES-1 cell line. RNA was extracted, and the gene transcriptional expression level of ADSL was detected by qPCR. The results are as Figure 9 shown, Figure 9 A - B confirmed the negative regulation of the ADSL gene transcription by TMOD3. The ADSL primers are as follows:

[0098] Homo-ADSL-F: TTACGACATGATGTGATGGCTC; SEQ ID No.4

[0099] Homo-ADSL-R: TCCAACATAGCAAGAAGTAGCAC, SEQ ID No.5.

[0100] 2. The A549&SK-MES-1 cell line with stable knockdown of the shRNA-TMOD3 gene was collected for Western blot experiment. The results are as Figure 10 shown. After knocking down TMOD3 in the A549&SK-MES-1 cells, the protein expression level of ADSL increased, indicating that TMOD3 inhibits the activity of ADSL, which is the same trend as the qPCR results.

[0101] 3. The A549&SK-MES-1 cell line with stable knockdown of the shRNA-TMOD3 gene was collected, and DMSO, 5 μM concentration of Erastin, and 10 μM concentration of Erastin were respectively added to the cell line. Subsequently, RNA was extracted, and the gene transcriptional expression level of the tumor ferroptosis-related factor GSH glutathione was detected by qPCR. The results are as Figure 11 shown. Compared with non-knockdown cells, after knocking down TMOD3 in the A549&SK-MES-1 cells, the expression level of GSH glutathione decreased. Adding the ferroptosis activator Erastin promoted cell ferroptosis, and the GSH expression level further decreased; the decrease in the GSH expression level under the stimulation of 10 μM concentration of Erastiin was more significant, indicating that knocking down TMOD3 and the ferroptosis activator Erastin have a positive correlation in promoting ferroptosis and show a synergistic effect.

[0102] 4. The A549&SK-MES-1 cell line with stable knockdown of the shRNA-TMOD3 gene was collected, and DMSO, 5 μM concentration of Erastin, and 10 μM concentration of Erastin were respectively added to the cell line. Subsequently, RNA was extracted, and the gene transcriptional expression level of ADSL was detected by qPCR. The results are as Figure 12As shown, compared with non-knockdown cells, after knocking down TMOD3 in A549 and SK-MES-1 cells, the expression level of ADSL increased. Adding the ferroptosis activator Erastin to promote ferroptosis in cells further increased the expression level of ADSL, indicating that knocking down TMOD3 and the ferroptosis activator Erastin have a positive correlation in promoting the expression of ADSL, and the two have a synergistic effect.

[0103] Conclusion: TMOD3 interacts with ADSL, thereby inhibiting the function of ADSL and enhancing the malignant progression of NSCLC. ADSL is a tumor suppressor gene for NSCLC, but it is negatively regulated by TMOD3, which inhibits the ferroptosis process of A549 and SK-MES-1, ultimately leading to malignant progression.

[0104] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed. SEQUENCE LISTING <110> Zhengzhou Yihe Hospital <120> Application of TMOD3 and / or ADSL in Non-Small Cell Carcinoma <130> P210251 <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> DNA <213> artificial sequence <400> 1 ggacagctgt agaattgga 19 <210> 2 <211> 19 <212> DNA <213> artificial sequence <400> 2 ggcactgatt gatgcgtta 19 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 ggcctgtagc tgatgcgtta 20 <210> 4 <211> 22 <212> DNA <213> Artificial sequence <400> 4 ttacgacatg atgtgatggc tc 22 <210> 5 <211> 23 <212> DNA <213> Artificial sequence <400> 5 tccaacatag caagaagtag cac 23

Claims

1. Use of a TMOD3 inhibitor in the preparation of a medicament for treating non-small cell lung cancer, characterized in that, the TMOD3 inhibitor is siRNA, and the sequence of the siRNA is as shown in SEQ ID No. 1.

Images