OX40 targeting antibody and preparation method and application thereof

Abstract

The present invention discloses an OX40 targeting antibody and a preparation method and application thereof. The antibody comprises VH and / or VL, wherein the VH comprises the following CDRs: VH CDR1, VH CDR2 and VH CDR3 as shown in the amino acid sequences of SEQ ID NOs: 1, 2 and 3; and the VL comprises the following CDRs: VL CDR1, VL CDR2 and VL CDR3 as shown in the amino acid sequences of SEQ ID NOs: 4, 5 and 6. Compared with the prior art antibodies, the antibodies of the present invention have excellent ability to activate the OX40 signaling pathway while having comparable affinity and specificity, so that a balance between efficacy and side effects can be achieved when used in clinical practice in the later stage.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an OX40 targeting antibody and a preparation method and application thereof. Background Art

[0002] OX40 (CD134, TNFRSF4) was originally defined as a T cell activation marker, and was later found to be a member of the NGFR / TNFR superfamily with co-activation function. It is mainly expressed on activated effector T cells (Teffs) and regulatory T cells (Tregs), and is also expressed on NKT cells, NK cells and neutrophils (D.J. Paterson, et al., "Antigens of activated Rat T lymphocytes including a molecule of 50,000M (r) detected only on CD4 positive T blasts," Molecular Immunology. 1987; 24 (12): 1281–1290). OX40 binds to its ligand OX40L (CD252, TNFSF4) to transmit co-stimulatory signals. OX40L can be expressed on antigen presenting cells (APCs), such as B cells, dendritic cells, and macrophages; in addition, it can also be induced to express in other cell types such as Langerhans cells, endothelial cells, smooth muscle cells, mast cells, and NK cells (Flynn S, et al., CD4 T cell cytokine differentiation: the B cell activation molecule, OX40 ligand, instructs CD4 T cells to express interleukin 4 and upregulates expression of the chemokine receptor, Blr-1. J Exp Med. 1998; 188: 297–304.); (Ohshima Y, et al., Expression and function of OX40 ligand on human dendritic cells. J Immunol. 1997; 159: 3838–3848). It can be seen that the combination of OX40 and OX40L is involved in a variety of physiological reactions between T cells and lymphocytes and non-lymphocytes.When OX40 binds to its ligand OX40L, it increases the survival and expansion of effector T cells and memory T cells, increases the secretion of cytokines (such as IL-2, IL-4, IL-5, IFN-γ); reduces the immunosuppressive activity of Tregs, and further amplifies the T cell activation effect (Gramaglia I, et al., Ox-40ligand: a potent costimulatory molecule forsustaining primary CD4 T cell responses. J Immunol. 1998; 161: 6510–6517.); (Ohshima Y, et al. OX40 costimulation enhances interleukin-4 (IL-4) expression atpriming and promotes the differentiation of naive human CD4(+) T cells into high IL-4-producing effectors. Blood. 1998; 92: 3338–3345.); (Ruby CE, et al., IL-12 is required for anti-OX40-mediated CD4 T cell survival. J Immunol. 2008; 180: 2140–2148). In the tumor microenvironment, immune activation can lead to OX40 expression. It can enhance the activation and proliferation of effector T cells and inhibit Tregs, leading to a complex anti-tumor immune response (reviewed in Jensen SM, et al., Semin Oncol. 2010 Oct; 37(5): 524-32).

[0003] Some OX40 antibodies with activation function can mimic its ligand OX40L, activate the OX40 signaling pathway, and thus enhance the activation and proliferation of effector T cells. Currently, the field of tumor immunity compares the role of PD1 inhibitors to "releasing the brakes" on the immune system, while anti-OX40 agonist antibodies are compared to "stepping on the accelerator" on the immune system (Linch SN, et al., Front Oncol. 2015; 16; 5:34).

[0004] OX40 is a type I membrane protein. Almost all anti-OX40 antibodies in the prior art use the extracellular domain fusion protein of OX40 as an immune antigen to immunize animals. However, OX40 on the cell membrane binds to its ligand in the form of a trimer and activates the signaling pathway. Using the monomeric extracellular domain fusion protein as an immune antigen to immunize animals is obviously not the best solution. First, monomeric OX40 exposes a large number of immunogens that are shielded in the trimer state. The antibodies produced by these immunogens usually have the effect of hindering the formation of trimers, that is, the so-called antagonistic antibodies; secondly, monomeric OX40 lacks those special conformational immunogens that only exist in the trimer form. The antibodies produced by these immunogens usually have the effect of stabilizing the formation of trimers, that is, the so-called activating antibodies. Currently, a variety of anti-OX40 antibody drugs are being used in clinical trials for tumors and immune system diseases. The control is Roche's Vonlerolizumab, which is in the clinical research stage for this target. The antibody is currently in Phase II clinical trials, but many clinical trials were terminated in 2019 without announcing the reasons. It may be difficult to achieve a balance between efficacy and side effects due to the weak ability of Vonlerolizumab to activate the OX40 signaling pathway.

[0005] Therefore, there is still a need to develop new anti-OX40 antibodies that have the same affinity and specificity as the anti-OX40 antibodies known in the prior art, and also have the ability to moderately activate the OX40 signaling pathway so that they can achieve a better balance between efficacy and side effects when used in clinical practice in the future. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the defect of the prior art that there is a lack of OX40 targeting antibodies with higher affinity and higher endocytosis activity, and provide an OX40 (CD134 / TNFRSF4) targeting antibody or its antigen binding fragment and a preparation method and application thereof.

[0007] In the present invention, the OX40 targeting antibody or antigen-binding fragment thereof is obtained by immunizing an animal using cells expressing transiently transfected OX40 protein as an immunogen, rather than immunizing an animal using an extracellular domain fusion protein of OX40 as an immune antigen. Therefore, while obtaining strong affinity and specificity, the OX40 targeting antibody or antigen-binding fragment thereof also has excellent ability to activate the OX40 signaling pathway.

[0008] In order to solve the above technical problems, the present invention provides, in a first aspect, an OX40-targeting antibody or an antigen-binding fragment thereof, comprising a heavy chain variable region (VH) and / or a light chain variable region (VL),

[0009] The VH comprises the following complementarity determining regions (CDRs): VH CDR1 as shown in the amino acid sequence of SEQ ID NO: 1; and / or, VH CDR2 as shown in the amino acid sequence of SEQ ID NO: 2; and / or, VH CDR3 as shown in the amino acid sequence of SEQ ID NO: 3;

[0010] The VL comprises the following CDRs: VL CDR1 as shown in the amino acid sequence of SEQ ID NO: 4; and / or, VL CDR2 as shown in the amino acid sequence of SEQ ID NO: 5; and / or, VL CDR3 as shown in the amino acid sequence of SEQ ID NO: 6;

[0011] Alternatively, the VH has 3, 2 or 1 amino acid mutations in the amino acid sequences of the VH CDR1, VH CDR2, and VH CDR3, respectively, and / or the VL has 3, 2 or 1 amino acid mutations in the amino acid sequences of the VL CDR1, VL CDR2, and VL CDR3, respectively.

[0012] In the case of "having 3, 2 or 1 amino acid mutations", "amino acid mutation" means that the variant sequence has amino acid mutations compared to the original amino acid sequence, including insertion, deletion or substitution of amino acids on the basis of the original amino acid sequence. An exemplary explanation is that the mutation of CDRs may include 3, 2 or 1 amino acid mutations, and the same or different numbers of amino acid residues may be optionally selected for mutation between these CDRs, for example, 1 amino acid mutation may be performed on CDR1, and no amino acid mutation may be performed on CDR2 and CDR3.

[0013] In the present invention, the mutation may include mutations currently known to those skilled in the art, such as some mutations of antibodies during the production or application of antibodies, such as mutations of possible post-transcriptional modifications (PTMs) sites, especially CDR regions, including antibody aggregation, asparagine deamidation sensitive sites (NG, NS, NH, etc.), aspartate isomerization (DG, DP) sensitive sites, N-glycosylation (N-{P}S / T) sensitive sites and oxidation sensitive sites and other related mutations.

[0014] In the present application, the amino acid sequences of the CDRs listed above are all shown according to the IMGT definition rules (the sequences shown in the claims of the present invention are also shown according to the IMGT definition rules, which can be analyzed at http: / / www.imgt.org / 3Dstructure-DB / cgi / DomainGapAlign.cgi#opennewwindow). However, it is well known to those skilled in the art that the CDRs of antibodies can be defined in the art by a variety of methods, such as the Kabat definition rules based on sequence variability (see, Kabat et al., Protein Sequences in Immunology, Fifth Edition, National Institutes of Health, Bethesda, Maryland (1991)) and the Chothia definition rules based on the position of the structural loop region (see J Mol Biol 273:927-48, 1997). It should be understood by those skilled in the art that, unless otherwise specified, the terms "CDR" and "complementarity determining region" of a given antibody or a region thereof (e.g., a variable region) should be understood to cover the complementary determining region defined by any of the above-mentioned known schemes described in the present invention. Although the scope of protection requested in the claims of the present invention is based on the sequences shown in the IMGT definition rules, the amino acid sequences corresponding to the definition rules of other CDRs should also fall within the scope of protection of the present invention (these definition rules can also be found at https: / / qinqianshan.com / biology / antibody / antibody-numbering-description / ).

[0015] Table 1-1 Antibody CDR definition method in this application

[0016]

[0017]

[0018] Among them, Laa-Lbb may refer to the amino acid sequence from the N-terminus of the antibody light chain, from the aa position to the bb position; Haa-Hbb may refer to the amino acid sequence from the N-terminus of the antibody heavy chain, from the aa position to the bb position. For example, L27-L32 may refer to the amino acid sequence from the 27th to the 32nd position according to the IMGT coding rules starting from the N-terminus of the antibody light chain; H26-H33 may refer to the amino acid sequence from the 26th to the 33rd position according to the IMGT coding rules starting from the N-terminus of the antibody heavy chain. It is well known to those skilled in the art that when encoding CDRs using the above coding rules, some positions may have insertion sites.

[0019] Preferably, the OX40 targeting antibody or antigen-binding fragment thereof is a murine antibody or antigen-binding fragment thereof.

[0020] More preferably, the VH of the murine antibody further comprises a heavy chain variable region framework region (VH FWR), and / or the VL of the murine antibody further comprises a light chain variable region framework region (VL FWR). The VH FWR is selected from 1) the FR1, FR2 and FR3 regions in germline IGHV1S81*02, IGHV1-53*01, IGHV1-69*02, IGHV1-64*01, IGHV1-74*04, and 2) the FR4 region in germline IGHJ2*01, or a back mutation thereof; and / or, the VL FWR is selected from 1) the FR1, FR2 and FR3 regions in germline IGKV10-96*01, IGKV10-96*02, IGKV10-96*03, IGKV10-96*04, IGKV10-96*05, and 2) the FR4 region in germline IGKJ5*01, or a back mutation thereof.

[0021] Further more preferably, the VH FWR includes VH FWR1 as shown in SEQ ID NO: 11, 29 or mutations thereof, VH FWR2 as shown in SEQ ID NO: 12, 30 or mutations thereof, VHFWR3 as shown in SEQ ID NO: 13, 31 or mutations thereof, and VH FWR4 as shown in SEQ ID NO: 14, 32 or mutations thereof; and / or, the VL FWR includes VL FWR1 as shown in SEQ ID NO: 15, 33 or mutations thereof, VL FWR2 as shown in SEQ ID NO: 16, 34 or mutations thereof, VL FWR3 as shown in SEQ ID NO: 17, 35 or mutations thereof, and VL FWR4 as shown in SEQ ID NO: 18, 36 or mutations thereof.

[0022] Further more preferably, the amino acid sequence of VH of the murine antibody is the amino acid sequence shown in SEQ ID NO:7 or a mutation thereof; and / or the amino acid sequence of VL is the amino acid sequence shown in SEQ ID NO:8 or a mutation thereof; the mutation is a deletion, substitution or addition of one or more amino acid residues in the amino acid sequence of the VH and / or the VL, and the mutated amino acid sequence has at least 85% sequence identity with the amino acid sequence of SEQ ID NO:7 and / or the SEQ ID NO:8, and maintains or improves the binding of the antibody to OX40; the at least 85% sequence identity is preferably at least 90% sequence identity, more preferably at least 95% sequence identity, and most preferably at least 99% sequence identity.

[0023] Further more preferably, the nucleotide sequence of VH of the murine antibody is the amino acid sequence shown in SEQ ID NO:9; and / or, the nucleotide sequence of VL is the amino acid sequence shown in SEQ ID NO:10.

[0024] Preferably, the OX40 targeting antibody or antigen-binding fragment thereof further comprises a mouse antibody constant region or a human antibody constant region; the mouse antibody constant region comprises a heavy chain constant region of mouse IgG1, IgG2a, IgG2b3 or IgG3 or a mutation thereof and a κ or λ type light chain constant region or a mutation thereof, and the human antibody constant region comprises a heavy chain constant region of human IgG1, IgG2, IgG3 or IgG4 or a mutation thereof and a κ or λ type light chain constant region or a mutation thereof.

[0025] Preferably, the OX40 targeting antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof;

[0026] More preferably, the framework region of the variable region of the humanized antibody includes the framework region of the human antibody heavy chain variable region and the framework region of the human antibody light chain variable region; the framework region of the human antibody light chain variable region is selected from 1) FR1, FR2 and FR3 regions in the germline IGHV1-46*01, IGHV1-46*02, IGHV1-46*03, IGHV1-46*04, IGHV1-2*06, and 2) germline IGHJ4*01, IGHJ4*02, IGHJ4*03, IGHJ4*04, IGHJ4*06. 1, or its back mutation; and / or, the framework region of the human antibody heavy chain variable region is selected from 1) FR1, FR2 and FR3 regions in germline IGKV1-33*01, IGKV1D-33*01, IGKV1-39*01, IGKV1D-39*01, IGKV1-27*01, and 2) FR4 region in germline IGKJ2*01, IGKJ2*02, or its back mutation; the number of amino acid positions of the back mutation is 0-10;

[0027] Preferably, the light chain of the antibody comprises a human antibody κ or λ type light chain constant region or a mutation thereof; and / or, the heavy chain of the antibody comprises a human IgG1, IgG2, IgG3 and IgG4 heavy chain constant region or a mutation thereof.

[0028] Preferably, the OX40 targeting antibody or antigen-binding fragment thereof includes full-length antibody, Fab, Fab', F(ab')2, Fv, scFv, VHH, HCAb, bispecific antibody, multispecific antibody, or monoclonal antibody or polyclonal antibody prepared from the above antibodies.

[0029] In the present invention, "Fab fragment" consists of one light chain and CH1 and variable region of one heavy chain. The heavy chain of the Fab molecule cannot form a disulfide bond with another heavy chain molecule. The "Fc" region contains two heavy chain fragments including the CH1 and CH2 domains of the antibody. The two heavy chain fragments are held together by two or more disulfide bonds and by the hydrophobic interaction of the CH3 domain. "Fab' fragment" contains one light chain and a portion of one heavy chain including the VH domain and the CH1 domain and the region between the CH1 and CH2 domains, thereby forming an interchain disulfide bond between the two heavy chains of the two Fab' fragments to form a F(ab')2 molecule. "F(ab')2 fragment" contains two light chains and two heavy chains including a portion of the constant region between the CH1 and CH2 domains, thereby forming an interchain disulfide bond between the two heavy chains. Therefore, the F(ab')2 fragment consists of two Fab' fragments held together by a disulfide bond between the two heavy chains. The term "Fv" means an antibody fragment consisting of the VL and VH domains of a single arm of an antibody, but lacking a constant region.

[0030] In the present invention, the scFv (single chain antibody fragment) may be a conventional single chain antibody in the art, which includes a heavy chain variable region, a light chain variable region and a short peptide of 15 to 20 amino acids. The VL and VH domains are paired to form a monovalent molecule by enabling them to be produced as a linker for a single polypeptide chain [see, for example, Bird et al., Science 242: 423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879-5883 (1988)]. Such scFv molecules may have a general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH. Suitable prior art linkers are composed of repeated G4S amino acid sequences or variants thereof. For example, a linker having an amino acid sequence (G4S)4 or (G4S)3 may be used, but variants thereof may also be used.

[0031] The term "multispecific antibody" is used in its broadest sense to cover antibodies with multiple epitope specificities. These multispecific antibodies include, but are not limited to: antibodies comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH-VL unit has multiple epitope specificities; antibodies having two or more VL and VH regions, each VH-VL unit binding to a different target or a different epitope of the same target; antibodies having two or more single variable regions, each single variable region binding to a different target or a different epitope of the same target; full-length antibodies, antibody fragments, bispecific antibodies (diabodies), and triabodies, antibody fragments covalently or non-covalently linked together, etc.

[0032] The antibodies of the present invention include monoclonal antibodies. The monoclonal antibodies or mAbs or Abs of the present invention refer to antibodies obtained from a single cloned cell line, and the cell line is not limited to eukaryotic, prokaryotic or phage cloned cell lines. The monoclonal antibodies can be prepared by a variety of approaches and techniques, including hybridoma technology, phage display technology, single lymphocyte gene cloning technology, etc. The mainstream is to prepare monoclonal antibodies from wild-type or transgenic mice by hybridoma technology.

[0033] In the present application, the "heavy chain antibody" refers to an antibody comprising only one heavy chain variable region (VHH) and two conventional CH2 and CH3 regions, also known as HCAb.

[0034] "Single-domain antibody", also known as "nanoantibody", refers to the VHH structure cloned from the heavy chain antibody and is the smallest unit known to bind to the target antigen.

[0035] In order to solve the above technical problems, the second aspect of the present invention provides a bispecific antibody, which includes a first protein functional region and a second protein functional region, wherein the first protein functional region is an antibody targeting OX40 or an antigen-binding fragment thereof as described in the first aspect of the present invention; and the second protein functional region is an antibody targeting a non-OX40 antigen.

[0036] Preferably, the non-OX40 antigen is an immune checkpoint antigen or a tumor treatment target, and the immune checkpoint antigen preferably includes PD-1, PD-L1, PD-L2, 4-1BB, CD40, CD73, Tim3, LAG3 or CD47, and the tumor treatment target preferably includes OX40.

[0037] In order to solve the above technical problems, the third aspect of the present invention provides an isolated nucleic acid encoding the OX40 targeting antibody or antigen-binding fragment thereof as described in the first aspect of the present invention.

[0038] The method for preparing the nucleic acid is a conventional method in the art, and preferably comprises the following steps: obtaining a nucleic acid molecule encoding the above-mentioned antibody by gene cloning technology, or obtaining a nucleic acid molecule encoding the above-mentioned antibody by artificial full sequence synthesis.

[0039] Those skilled in the art will appreciate that the base sequence encoding the amino acid sequence of the above-mentioned antibody may be appropriately introduced with substitution, deletion, alteration, insertion or addition to provide a polynucleotide homologue. The polynucleotide homologue of the present invention may be prepared by replacing, deleting or adding one or more bases of the gene encoding the antibody sequence within the range of maintaining the antibody activity.

[0040] In order to solve the above technical problems, the fourth aspect of the present invention provides an expression vector comprising the isolated nucleic acid as described in the third aspect of the present invention.

[0041] Preferably, the expression vector is a plasmid, a cosmid, a phage or a viral vector, and the viral vector is preferably a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

[0042] In order to solve the above technical problems, the fifth aspect of the present invention provides a transformant, which contains the recombinant expression vector as described in the fourth aspect of the present invention in a host cell.

[0043] Preferably, the host cell is E. coli TG1, BL21 cell, or CHO-K1 cell.

[0044] In order to solve the above technical problems, the sixth aspect of the present invention provides a method for preparing an antibody targeting OX40 or an antigen-binding fragment thereof, which comprises culturing the transformant as described in the fifth aspect of the present invention, and obtaining the antibody targeting OX40 or an antigen-binding fragment thereof from the culture.

[0045] In order to solve the above technical problems, the seventh aspect of the present invention provides a chimeric antigen receptor, which comprises the OX40 targeting antibody or antigen-binding fragment thereof as described in the first aspect of the present invention.

[0046] In order to solve the above technical problems, the eighth aspect of the present invention provides a genetically modified cell, which comprises the OX40 targeting antibody or antigen-binding fragment thereof as described in the first aspect of the present invention, or the chimeric antigen receptor as described in the seventh aspect of the present invention.

[0047] Preferably, the genetically modified cells are eukaryotic cells, more preferably isolated human cells; further more preferably immune cells such as T cells, or NK cells such as NK92 cell lines.

[0048] In order to solve the above technical problems, the ninth aspect of the present invention provides an antibody-drug conjugate, which comprises a cytotoxic agent and the OX40 targeting antibody or antigen-binding fragment thereof as described in the first aspect of the present invention.

[0049] In order to solve the above technical problems, the tenth aspect of the present invention provides a drug combination (for example, it can be in the form of a kit such as an antibody combination, an antibody pair, etc., or it can be in the form of a pharmaceutical composition), which comprises the OX40 targeting antibody or its antigen-binding fragment as described in the first aspect of the present invention, the bispecific antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the seventh aspect of the present invention, the genetically modified cell as described in the eighth aspect of the present invention and / or the antibody-drug conjugate as described in the ninth aspect of the present invention.

[0050] When it exists in the form of a kit, it may include kit A and kit B, wherein kit A includes the OX40 targeting antibody or antigen binding fragment thereof as described in the first aspect of the present invention, the bispecific antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the seventh aspect of the present invention, the genetically modified cell as described in the eighth aspect of the present invention, the antibody-drug conjugate as described in the ninth aspect of the present invention, the drug combination as described in the tenth aspect of the present invention, and / or the kit as described in the eleventh aspect of the present invention. Kit B is other anti-tumor antibodies or a pharmaceutical composition comprising the other anti-tumor antibodies (e.g., the antibody 1G10-9-13-11 mentioned in the present invention). Kit A and kit B may be used simultaneously, or kit A may be used first and then kit B, or kit B may be used first and then kit A, depending on the actual needs of the specific application.

[0051] When present in the form of a pharmaceutical composition, it may also include a pharmaceutically acceptable solvent and / or carrier and / or excipient. The pharmaceutically acceptable carrier may be a conventional carrier in the art, and the carrier may be any suitable physiologically or pharmaceutically acceptable pharmaceutical excipient. The pharmaceutical excipient is a conventional pharmaceutical excipient in the art, preferably including a pharmaceutically acceptable excipient, filler or diluent, etc. More preferably, the pharmaceutical composition comprises 0.01 to 99.99% of the OX40 targeting antibody or its antigen-binding fragment, the above-mentioned bispecific antibody, chimeric antigen receptor, genetically modified cells, antibody drug conjugate, and 0.01 to 99.99% of a pharmaceutical carrier, and the percentage is the mass percentage of the pharmaceutical composition.

[0052] The pharmaceutical composition preferably further comprises other anti-tumor antibodies as active ingredients. Preferably, the pharmaceutical composition is an anti-tumor drug. More preferably, it is a drug for treating OX40-positive tumors, such as lung cancer, liver cancer, gastric cancer, breast cancer, head and neck cancer and / or colon cancer.

[0053] The administration route of the pharmaceutical composition of the present invention is preferably parenteral administration, injection or oral administration. The injection preferably includes intravenous injection, intramuscular injection, intraperitoneal injection, intradermal injection or subcutaneous injection. The pharmaceutical composition is a conventional dosage form in the art, preferably in the form of solid, semisolid or liquid, that is, it can be an aqueous solution, non-aqueous solution or suspension, and more preferably tablets, capsules, granules, injections or infusions. It is more preferably administered intravascularly, subcutaneously, intraperitoneally or intramuscularly. Preferably, the pharmaceutical composition can also be administered as an aerosol or a coarse spray, that is, nasally; or, intrathecally, intramedullary or intraventricularly. More preferably, the pharmaceutical composition can also be administered transdermally, percutaneously, topically, enterally, intravaginally, sublingually or rectally.

[0054] The dosage level of the pharmaceutical composition of the present invention can be adjusted according to the amount of the composition to reach the desired diagnosis or treatment result. The administration scheme can also be a single injection or multiple injections, or adjusted. The selected dosage level and scheme depend on various factors including the activity and stability (i.e., half-life) of the pharmaceutical composition, preparation, route of administration, combination with other drugs or treatment, disease or illness to be detected and / or treated, and the health status and previous medical history of the subject to be treated and are reasonably adjusted.

[0055] The therapeutically effective dose for the pharmaceutical composition of the present invention can be initially estimated in cell culture experiments or animal models such as rodents, rabbits, dogs, pigs and / or primates. Animal models can also be used to determine suitable concentration ranges and approaches for administration. Subsequently, it can be used to determine useful doses and approaches for administration in humans. Generally, the determination and adjustment of the administration of an effective amount or dosage and when and how to perform such an adjustment are known to those skilled in the art.

[0056] For combination therapy, the OX40 targeting antibody or antigen-binding fragment thereof, the above-mentioned bispecific antibody, chimeric antigen receptor, genetically modified cell, antibody drug conjugate, drug combination, kit and / or additional therapeutic or diagnostic agent can each be used as a single agent within any time frame suitable for performing the intended treatment or diagnosis. Thus, these single agents can be administered substantially simultaneously (i.e., as a single formulation or within minutes or hours) or in sequence. For example, these single agents can be administered within one year, or within 10, 8, 6, 4 or 2 months, or within 4, 3, 2, or 1 week, or within 5, 4, 3, 2 or 1 day.

[0057] For additional guidance on formulation, dosage, administration schedules, and measurable therapeutic outcomes, see Berkow et al. (2000) The Merck Manual of Medical Information and Merck & Co. Inc., Whitehouse Station, New Jersey; Ebadi (1998) CRC Desk Reference of Clinical Pharmacology, among others.

[0058] In order to solve the above technical problems, the eleventh aspect of the present invention provides a kit, which includes the OX40 targeting antibody or its antigen-binding fragment as described in the first aspect of the present invention, the bispecific antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the seventh aspect of the present invention, the genetically modified cell as described in the eighth aspect of the present invention, the antibody-drug conjugate as described in the ninth aspect of the present invention, and / or the drug combination as described in the tenth aspect of the present invention.

[0059] Preferably, the kit further comprises (i) a device for administering the antibody or antigen-binding fragment thereof or antibody-drug conjugate or pharmaceutical composition; and / or (ii) instructions for use.

[0060] In order to solve the above technical problems, the twelfth aspect of the present invention provides the use of the OX40 targeting antibody or its antigen-binding fragment as described in the first aspect of the present invention, the bispecific antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the seventh aspect of the present invention, the genetically modified cell as described in the eighth aspect of the present invention, the antibody-drug conjugate as described in the ninth aspect of the present invention, the drug combination as described in the tenth aspect of the present invention, and / or the kit as described in the eleventh aspect of the present invention in the preparation of drugs for diagnosing, preventing and / or treating tumors.

[0061] Preferably, the tumor is an OX40 positive tumor; for example, lung cancer, liver cancer, gastric cancer, breast cancer, head and neck cancer and / or colon cancer.

[0062] To solve the above technical problems, the present invention also provides the use of the OX40 targeting antibody or antigen binding fragment thereof as described in the first aspect of the present invention, the bispecific antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the seventh aspect of the present invention, the genetically modified cell as described in the eighth aspect of the present invention, the antibody-drug conjugate as described in the ninth aspect of the present invention, the drug combination as described in the tenth aspect of the present invention, and / or the kit as described in the eleventh aspect of the present invention in diagnosing, preventing and / or treating tumors. The tumor is preferably as described above.

[0063] In one aspect, the present invention further provides a method for detecting whether OX40 protein is expressed in a sample to be tested, comprising the following steps: contacting the OX40 targeting antibody or antigen-binding fragment thereof as described in the first aspect of the present invention with the sample to be tested in vitro, and detecting the binding of the OX40 targeting antibody or antigen-binding fragment thereof as described in the first aspect of the present invention with the sample to be tested.

[0064] In the present invention, unless otherwise specified, the scientific and technical terms used in the present invention have the meanings commonly understood by those skilled in the art. In addition, the cell culture, molecular genetics, nucleic acid chemistry, and immunology laboratory operation steps used in the present invention are all conventional steps widely used in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0065] In the present invention, OX40, OX-40 and Ox-40 represent the same meaning.

[0066] The three-letter codes and one-letter codes for amino acids used in the present invention are known to those skilled in the art, or are described in J. Biol. Chem, 243, p3558 (1968).

[0067] As used herein, the terms “comprise” or “comprising” are intended to indicate that the compositions and methods include the stated elements but do not exclude other elements, but according to the context, also include the case of “consisting of…”

[0068] In the present invention, the term "variable" generally refers to the fact that some parts of the sequence of the variable domain of an antibody vary strongly, which forms the binding and specificity of various specific antibodies to their specific antigens. However, variability is not evenly distributed in the entire variable region of an antibody. It is concentrated in three segments in the light chain and heavy chain variable regions, which are called complementary determining regions (CDRs) or hypervariable regions (HVRs). The more highly conserved parts in the variable domains are called frameworks (FWRs). The variable domains of natural heavy and light chains each contain four FWR regions, most of which adopt a β-folded configuration, are connected by three CDRs, form loop connections, and form a part of the β-folded structure in some cases. The CDRs in each chain are closely together through the FWR region, and together with the CDRs from another chain, form the antigen binding site of the antibody, and the constant region does not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in the antibody's cytotoxicity that depends on the antibody.

[0069] The term "epitope" refers to the portion of an antigen (e.g., OX40) that specifically interacts with an antibody molecule. The term "competition" in the present invention refers to the ability of an antibody molecule to interfere with the binding of an anti-OX40 antibody molecule to a target (e.g., OX40). Interference with binding may be direct or indirect (e.g., by allosteric modulation of the antibody molecule or target). Competition binding assays (e.g., FACS assays, ELISA, or BIACORE assays) may be used to determine the extent to which an antibody molecule is able to interfere with the binding of another antibody molecule to its target.

[0070] The term "antibody" described in the present invention includes immunoglobulins, which are tetrapeptide chains formed by two identical heavy chains and two identical light chains connected by interchain disulfide bonds. The amino acid composition and arrangement order of the constant region of the immunoglobulin heavy chain are different, so their antigenicity is also different. Based on this, immunoglobulins can be divided into five categories, or isotypes of immunoglobulins, namely IgM, IgD, IgG, IgA and IgE, and their corresponding heavy chains are μ chain, δ chain, γ chain, α chain and ε chain respectively. The same class of Ig can be divided into different subclasses according to the difference in the amino acid composition of its hinge region and the number and position of the heavy chain disulfide bonds, such as IgG can be divided into IgG1, IgG2, IgG3 and IgG4. The light chain is divided into κ chain or λ chain by the difference in the constant region. Each of the five types of Ig can have κ chain or λ chain.

[0071] As used in the present invention, the term "isolated" refers to something obtained from a natural state by artificial means. If a certain "isolated" substance or component appears in nature, it may be that the natural environment in which it is located has changed, or the substance has been separated from the natural environment, or both. For example, a certain unisolated polynucleotide or polypeptide naturally exists in a living animal, and the same polynucleotide or polypeptide with high purity separated from this natural state is called "isolated". The term "isolated" does not exclude the presence of artificial or synthetic substances, nor does it exclude the presence of other impure substances that do not affect the activity of the substance.

[0072] As used in the present invention, the term "host cell" refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli, fungal cells such as yeast cells, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells or human cells.

[0073] The term "murine antibody" in the present invention refers to a monoclonal antibody against OX40 prepared according to the knowledge and skills in the art. During preparation, the test subject is injected with the OX40 antigen, and then a hybridoma expressing an antibody with the desired sequence or functional properties is isolated. In a preferred embodiment of the present invention, the murine OX40 antibody or antigen-binding fragment thereof may further comprise a light chain constant region of a murine κ, λ chain or a variant thereof, or further comprise a heavy chain constant region of a murine IgG1, IgG2, IgG3 or IgG4 or a variant thereof.

[0074] The term "humanized antibody" includes antibodies with variable and constant regions of human germline immunoglobulin sequences. The human antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (such as mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutations in vivo). However, the term "human antibody" does not include antibodies in which CDR sequences derived from the germline of another mammalian species (such as a mouse) have been transplanted onto human framework sequences (i.e., "humanized antibodies").

[0075] As used in the present invention, the term "specificity" about antibodies means antibodies that recognize specific antigens but do not substantially recognize or bind other molecules in the sample. For example, an antibody that specifically binds to an antigen from one species may also bind to the antigen from one or more species. However, this interspecies cross-reactivity itself does not change the classification of antibodies according to specificity. In another example, an antibody that specifically binds to an antigen may also bind to different allele forms of the antigen. However, this cross-reactivity itself does not change the classification of antibodies according to specificity. In some cases, the term "specificity" can be used to refer to the interaction of an antibody, protein or peptide with a second chemical substance, meaning that the interaction depends on the presence of a specific structure (e.g., antigenic determinant or epitope) on the chemical substance; for example, antibodies generally recognize and bind to specific protein structures, not proteins. If the antibody is specific to epitope "A", then in a reaction containing labeled "A" and an antibody, the presence of a molecule containing epitope A (or free, unlabeled A) will reduce the amount of labeled A bound to the antibody.

[0076] "Identity" and "mutation" refer to sequence similarity between two polynucleotide sequences or between two polypeptides. When the positions in the two compared sequences are occupied by the same base or amino acid monomer subunit, for example, if every position of the two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percentage of identity between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared × 100. For example, when the sequences are optimally aligned, if 6 out of 10 positions in the two sequences are matched or homologous, then the two sequences are 60% homologous. In general, comparison is made when the two sequences are aligned to obtain the maximum percentage of identity. "Optimization" refers to mutations that maintain or improve the binding of the antibody to the antigen. In the present invention, it refers to mutations that maintain, maintain or improve the binding to CLDN18.2.

[0077] The terms "polypeptide", "peptide" and "protein" (if single-chain) are used interchangeably in the present invention. The terms "nucleic acid", "nucleic acid sequence", "nucleotide sequence" or "polynucleotide sequence" and "polynucleotide" are used interchangeably.

[0078] The term "mutation" includes substitutions, additions and / or deletions of amino acids or nucleotides, and "amino acid substitutions" and "conservative amino acid substitutions" are those in which an amino acid residue is replaced with another amino acid residue and with an amino acid residue having a similar side chain, respectively.

[0079] As used herein, "lentivirus" refers to the genus of the Retroviridae family. Lentiviruses are unique among retroviruses in that they are able to infect non-dividing cells; they can deliver significant amounts of genetic information into the DNA of host cells, and therefore they are one of the most effective methods of gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Vectors from lentiviruses provide a means of achieving significant levels of gene transfer in vivo.

[0080] The term "vector" used in the present invention is a composition that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphipathic compounds, plasmids and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted as including non-plasmids and non-viral compounds that promote nucleic acid transfer into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to adenoviral vectors, adeno-associated viral vectors, retroviral vectors, etc.

[0081] As used herein, the expressions "cell" and "cell line" are used interchangeably, and all such names include progeny. The term "host cell" refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as E. coli, fungal cells such as yeast cells, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells or human cells.

[0082] The term "transfection" refers to the introduction of exogenous nucleic acid into eukaryotic cells. Transfection can be achieved by various means known in the art, including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection and biolistics.

[0083] The term "immune cell" refers to a cell that can trigger an immune response, and "immune cell" and its grammatical other forms can refer to immune cells of any origin. "Immune cells" include, for example, white blood cells (leukocytes) derived from hematopoietic stem cells (HSC) produced in the bone marrow, lymphocytes (T cells, B cells, natural killer (NK) cells, and bone marrow-derived cells (neutrophils, eosinophils, basophils, monocytes, macrophages, dendritic cells). The term "immune cell" can also be human or non-human.

[0084] As used herein, the term EC 50 It refers to the concentration for 50% of maximal effect, that is, the concentration that can cause 50% of the maximum effect.

[0085] The pharmaceutical composition of the present invention can be prepared into various dosage forms as required, and the physician can determine the dosage that is beneficial to the patient according to factors such as the patient type, age, weight, general disease condition, and administration method. The administration method can be, for example, injection or other treatment methods.

[0086] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0087] The reagents and raw materials used in the present invention are commercially available.

[0088] The positive and progressive effect of the present invention is that compared with the prior art antibodies, the antibodies of the present invention have excellent ability to activate the OX40 signaling pathway while having comparable affinity and specificity, so that a balance between efficacy and side effects can be achieved when used in clinical practice in the later stage. In a preferred embodiment of the present invention, the antibody activation of the present invention can strongly activate the OX40 signaling pathway, and its half effective concentration (EC50) is 633ng / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 These are the binding activities of the anti-OX40 antibody in Example 4 with OX40 and 4-1BB fusion protein, respectively.

[0090] Figure 2 The binding activity of the anti-OX40 antibody in Example 4 with the cell surface OX40 protein.

[0091] Figure 3 This is the NF-κB transcription activity of different positive cell lines in Example 4.

[0092] Figure 4 This is the concentration-stimulatory activity effect curve of the antibody in Example 4. DETAILED DESCRIPTION

[0093] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0094] Example 1 Antigen preparation, mouse immunization and hybridoma preparation

[0095] a. Antigen (transiently transfected OX40 expressing cells) preparation

[0096] 293F cells were used as transfected cells. The commercial OX40 plasmid (Sino Biological, HG0481-UT) was transiently transfected into 293F cells. After culturing for 48 hours, the cells were taken as immunogens. The specific steps are as follows: Prepare 293F cells. On the day of transfection, the cell density reached 1.0-1.2×10 6 / ml; count the cells and add 1.0×10 6cells / ml, 2ml / well, 4 wells in total; prepare DNA transfection system. Take 640μL Opti-MEM, add 8ug DNA plasmid, mix gently; then add 16μl PEI, mix gently, and let stand at room temperature for 20 minutes; add DNA-293PEI mixture to 293F cells, put into Infors shaker, 115rpm, 37℃, 5% CO2 culture environment, culture for 2 days; sample collection. Collect all samples, centrifuge at 1500rpm for 3 minutes; take cells, resuspend in PBS, and wash twice at 1500rpm for 3 minutes. Finally resuspend to 5×10 6 / ml, and the antigen (i.e., transiently transfected OX40-expressing cells or OX40-293F cells) is obtained for immunization.

[0097] b. Immunity

[0098] The transiently transfected OX40-expressing cells prepared above were used as immunogens to immunize animals (mice and rabbits).

[0099] After the cells were collected, they were used for cell immunization of six-week-old mice (Animal Center of Hangzhou Normal University). Animal immunization was performed by the Animal Center of Hangzhou Normal University. The immunization site was subcutaneous multi-point immunization, and 5×10 6 cells / mouse; a total of 4 immunizations (after the first immunization, the second immunization was performed 21 days later, and then a booster immunization was performed every 14 days). After the 4 immunizations, the serum titer was tested by ELISA (similar to the ELISA steps described below). Mice with qualified serum titers were boosted and their spleens were removed for storage or fusion.

[0100] c. Fusion

[0101] First, take thymocytes from 4-week-old mice (Animal Center of Hangzhou Normal University), resuspend the thymocytes in IMDM medium as feeder cells; resuspend the SP2 / 0 in good growth state in IMDM medium as fusion cells. Then prepare spleen cells as follows: take the spleen of the mouse after the above booster immunization, put the spleen into a sterile 10cm dish, cut off the excess adhesion tissue, place the spleen in a cell filter, and grind the spleen with the core of a sterile 2mL syringe. Collect the separated spleen cells and wash them twice with IMDM medium as fusion cells. When preparing for cell fusion, mix SP2 / 0 cells and spleen cells in a 1:1 ratio of the volume of the cell pellet, add IMDM medium, make the liquid in the tube 30mL, centrifuge at 1500rpm for 5 minutes, and discard the supernatant. Carefully knock the cell pellet apart and place the cells in the centrifuge tube in a beaker containing 37℃ warm water. Add 1mL PEG dropwise to the cells at a uniform speed within 1min, and let stand in a 37℃ water bath for 30s; add 10mL IMDM medium to the fused cells, and then add medium in time to make the total volume 30mL. Centrifuge at 1200rpm for 3 minutes and discard the supernatant; tap the cell pellet gently, slowly transfer it to the hybridoma selection medium, add feeder cells to the selection medium, and gently mix the fused cells and feeder cells. Plate at 200μL / well, a total of 20 plates; culture at 37℃, 5% CO2 for 7 days, and take the hybridoma supernatant for detection and screening.

[0102] Example 2 Antibody Screening and Sequencing

[0103] 1. Antibody Screening

[0104] ELISA screening: First, the antigen OX40 fusion protein (OX40 fusion protein purchased from Hangzhou Huaan Biotechnology Co., Ltd.) was diluted to 1 μg / ml with the coating solution, and 50 μl was added to each well of the 96-well ELISA plate. After the ELISA plate was covered, it was placed in a 4-degree refrigerator overnight; after sealing, the hybridoma supernatant obtained in Example 1 was added to the ELISA plate with a pipette at 50 μl per well, and after shaking, it was placed in a constant temperature incubator and allowed to stand for 1 hour; after washing with TBST 3 times, the diluted secondary antibody (sheep anti-mouse IgG-HRP, Pierce, 31430) was added to the ELISA plate with a pipette at 50 μl per well, and placed in a constant temperature incubator and allowed to stand for 30 minutes; after washing with TBST 3 times, HRP color developing solution was used for color development. After color development, the reaction was terminated with H2SO4 (TMB), the plate was read and the data was analyzed. Positive clones were screened according to the OD value of the positive wells.

[0105] The ELISA-positive clones were screened by flow cytometry (FACS) using the OX40-293F cells obtained in Example 1, thereby screening double-positive clones: transiently transfected OX40-293F cells were collected, and 50,000 cells were added to each well of a 96-well V-shaped plate, blocked with 1% BSA / PBS, and placed at 4 degrees for 30 minutes; 50 μl of ELISA-positive hybridoma supernatant was added to each well of the cells and placed in a 4-degree refrigerator for 1 hour; after washing, diluted anti-mouse-FITC (sheep anti-mouse IgG-FITC, Jackson, 115-095-003) was added to the cells, 50 μl per well, and placed in a 4-degree refrigerator for 30 minutes; the incubated cells were washed and resuspended, and detected and MFI was recorded on a flow sorter. Positive clones were selected and subcloned.

[0106] Subcloning: Subclone the double-positive clones screened, and select single clones through testing for later research and development. This example uses two methods for subcloning: limiting dilution method and counting plating. Both can be performed using routine operations in the field.

[0107] Subclone screening: The subclone screening method is the same as the hybridoma supernatant screening method mentioned above, both of which use ELISA and FACS methods for detection, and finally select double-positive monoclones as the final clones for antibody recombination to obtain sequences.

[0108] 2. Sequencing

[0109] After the above positive hybridoma cells were lysed, the sequences were obtained by RT (reverse transcription) and PCR of heavy and light chains and then sequenced for verification.

[0110] The conditions of RT are shown in Table 1 below.

[0111] Table 1

[0112]

[0113]

[0114] The reaction system and reaction procedure of heavy chain PCR are shown in Tables 2 and 3 below.

[0115] Table 2 PCR reaction system

[0116] Reagents 10μl reaction system Final concentration 1×MAX Mixture 9.6μl 1× Forward Primer 1, 10 μM 0.1μl 0.1μM Reverse Primer(M12H-R / M2A-R), 10μM 0.1μl 0.1μM cDNA 0.2μl

[0117] Table 3 PCR reaction program

[0118]

[0119] The reaction system and reaction procedure of light chain PCR are shown in Tables 4 and 5 below.

[0120] Table 4 PCR reaction system

[0121]

[0122] Table 5 PCR reaction program

[0123]

[0124]

[0125] The obtained PCR product was sent for sequencing, and the sequencing company was Hangzhou Youkang Biotechnology Co., Ltd.

[0126] 3. Antibody sequence information

[0127] Commonly used antibody numbering systems include Kabat, Chothia and IMGT. The IMGT numbering system is used in this embodiment. The amino acid sequence of the antibody CDR of the present invention is shown in Table 6 below.

[0128] Table 6 Amino acid sequences of CDRs of antibodies of the present invention

[0129]

[0130] Table 7 shows one of the preferred framework region sequence combinations.

[0131] Table 7 Framework region sequence combinations

[0132]

[0133]

[0134] The light chain variable regions and heavy chain variable regions of the antibodies obtained by the present invention and the control antibodies may be as shown in Table 8 below.

[0135] Table 8 Amino acid sequences of light chain variable region and heavy chain variable region

[0136]

[0137] The nucleotide sequence of VH of the above antibody 5A3-6-15 may preferably be (SEQ ID NO: 9):

[0138] CAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGGTAAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTAGCTATATTATGCACTGGGTGAAGCAGAAGCCTGAGCAGGGCCTTGAGTGGATTGGATATATTAATCCTTACAATGATGGTTCTAAGTACAATGAGAACTTCAAAGGCAAGGCCACACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTTTTACTGTGCAAGGGGGGCCTACGGTTCTAGTTACAACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA

[0139] The nucleotide sequence of the VL of the above-mentioned antibody 5A3-6-15 can preferably be (SEQ ID NO:10):

[0140] GATATCCAGATGACACAGACTACTTCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGTGCAAGTCAGGGCATTAGCAATTATTTAAACTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTATTACACATCAAGTTTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGGACAGATTATTCTCTCACCATCAGCAACCTGGAACCTGAAGATATTGCCACTTATTATTGTCAGCAGTATAGTAAGCTTCCGTACACGTTCGGAGGGGGGACCAAGCTGAAATAAAAC

[0141] The nucleotide sequence of the VH of the above-mentioned antibody 1G10-9-13-11 can preferably be (SEQ ID NO:27):

[0142] GAGGTTCAGCTGCAGCAGTCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAACTACTGGATACACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTAATCCTAGCAACGGTCGTACTAA CTCCAATGAGAAGTTCAAGAACAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAGAGGCGGTGCCGTACTACTTTGTCTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA;

[0143] The nucleotide sequence of VL of the above antibody 1G10-9-13-11 may preferably be (SEQ ID NO: 28):

[0144] GATATTGTGATGACGCAGGCTGCATCCTCCCTGTCTGCCTCTCTGGGAGACAGGGTCACCATCAGTTGTAGGGCAAGTCAGGACATTAACAATTATTTAAACTGGTATCAGCAGAAACCTGATGGAACTGTTAAACTCCTGATCTACTTCACATCAGGAT TACGCTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACGCTTCCTTCCACGTTCGGTGCTGGGACCAAGCTTGGAGCTAAAC

[0145] Selection of antibody light chain constant region and heavy chain constant region: The light chain constant region and heavy chain constant region of the antibody OX40 of the present invention can be of mouse, rabbit, human, etc. For example, the heavy chain constant region and light chain constant region are mouse constant regions.

[0146] Example 3 Antibody Production and Purification

[0147] The antibody of the present invention is purified from mouse ascites. The operation steps are all routine in the art, mainly after the hybridoma cells are cultured and expanded, they are directly inoculated into the abdominal cavity of pre-sensitized mice. After 10 days, the ascites is collected and purified by proG, and the purified antibodies are quantified and stained by SDS-pAGE.

[0148] Example 4 Effect Identification

[0149] 1. Identification of OX40 binding affinity and specificity

[0150] 1.1 Construction of OX40 and specific control (4-1BB) fusion protein

[0151] The OX40 gene fragment was purchased from Sino Biological, and the purchased gene fragment was used as a template to obtain the OX40 extracellular region fragment by PCR method, and constructed into the pTT5 vector for protein expression. The restriction sites of OX40-rFc fusion protein (prepared by conventional methods in the art) are EcoRI and XhoI, and the restriction sites of OX40-His fusion protein (prepared by conventional methods in the art) are EcoRI and NheI. After successful construction, the plasmid was transfected into 293F cells for expression, and purified to obtain OX40-rFc fusion protein and OX40-His fusion protein.

[0152] The 4-1BB gene (4-1BB is another molecule in the same gene family as OX40, but the sequence is completely different, so it is used as an experimental control for binding specificity) fragment was purchased from Sino Biological. The purchased gene fragment was used as a template to obtain the 4-1BB extracellular region fragment by PCR method and constructed into the pTT5 vector for protein expression. The restriction sites of 4-1BB-rFc fusion protein are EcoRI and XhoI, and the restriction sites of 4-1BB-His fusion protein are EcoRI and NheI. After successful construction, the plasmid was transfected into 293F cells for expression and purified to obtain 4-1BB-rFc fusion protein and 4-1BB-His fusion protein.

[0153] 1.2 Binding affinity and specificity identification

[0154] The binding affinity and specificity were determined by ELISA and FACS, respectively.

[0155] First, the binding affinity of the positive antibody (ie, Vonlerolizumab) to OX40-rFc fusion protein and OX40-His fusion protein was identified by ELISA, and the binding specificity of the antibody was identified by using 4-1BB-rFc fusion protein and 4-1BB-His fusion protein as controls.

[0156] Dilute the antigen OX40 fusion protein or 4-1BB fusion protein to 1μg / ml with coating solution, and add 50μl per well to the 96-well ELISA plate. After covering the ELISA plate, put it in a 4℃ refrigerator overnight; after blocking, add the above-mentioned purified antibody (1μg / mL) to the ELISA plate, shake it evenly, put it in a constant temperature incubator, and let it stand for 1 hour; after washing with TBST 3 times, add the diluted secondary antibody to the ELISA plate with a pipette at 50μl per well, put it in a constant temperature incubator, and let it stand for 30 minutes; wash it with TBST 3 times and use HRP color development solution for color development. After the color development is completed, stop the reaction with H2SO4 (TMB), read the plate and analyze the data.

[0157] The experimental results are as follows Figure 1 As shown. As can be seen from the figure, both 1G0-9-13-11 and 5A3-6-15 antibodies can specifically recognize OX40 fusion protein, but not 4-1BB fusion protein. Among them, the OX40 positive control antibody is an anti-OX40 antibody synthesized and expressed according to the sequence of Vonlerolizumab in Roche's clinical trial; the 4-1BB positive control antibody is an anti-4-1BB antibody synthesized and expressed according to the sequence of Utomilumab in Pfizer's clinical trial (purchased from Crown Biotechnology Co., Ltd.). It can be seen that the anti-OX40 antibody of the present invention can specifically recognize OX40 fusion protein, but not 4-1BB fusion protein, and its binding ability is comparable to that of the positive control antibody Vonlerolizumab.

[0158] 2. Identification of binding affinity and specificity for cells expressing OX40

[0159] 2.1 Construction of OX40-expressing cells and specific control (4-1BB) cells

[0160] The OX40 / 4-1BB expression vector was purchased from Sino Biological (OX-40: HG10481-UT). The expression vector can be directly transfected (the transfection steps are routine in the art, as follows: Prepare CHO-K1 cells, and on the day of transfection, the cell density reaches 1.0-1.2×10 6 Count the cells and add 1.0×10 6cells / mL, 2mL / well, 4 wells in total; prepare DNA transfection system. Take 640μL Opti-MEM, add 8μg DNA plasmid, mix gently; then add 16μL PEI, mix gently, and stand at room temperature for 20 minutes; add DNA-PEI mixture to CHO-K1 cells, put into Infors shaker, 115rpm, 37℃, 5% CO2 culture environment, culture for 2 days; sample collection. Collect all samples, centrifuge at 1500rpm for 3 minutes; take cells, resuspend in PBS, wash twice at 1500rpm for 3 minutes, and prepare FACS experiment). After CHO-K1 cell transfection identification, it was confirmed that the vector can correctly express OX40 and 4-1BB molecules on the surface of CHO-K1 cells, that is, OX40-CHO-K1 cells and 4-1BB-CHO-K1 cells were successfully obtained.

[0161] 2.2 Binding affinity and specificity identification

[0162] The anti-OX40 antibody of the present invention was further identified by flow cytometry (FACS) using the OX40-CHO-K1 cells obtained above: transiently transfected OX40-CHO-K1 cells were collected, and 50,000 cells were added to a 96-well V-shaped plate per well, blocked with 1% BSA / PBS, and placed at 4°C for 30 minutes; the ELISA positive antibody was diluted 3 times from 10 μg / mL, and 50 μl of the diluted antibody was added to the cell wells per well, and placed in a 4-degree refrigerator for 1 hour; after washing, the diluted anti-mouse-FITC was added to the cells, 50 μl per well, and placed in a 4°C refrigerator for 30 minutes; the incubated cells were washed and resuspended, detected on a flow cytometer, and the MFI was recorded and the data analyzed.

[0163] The experimental results are as follows Figure 2 As shown in the figure, it can be seen that both 1G10-9-13-11 and 5A3-6-15 antibodies can recognize OX40-CHO-K1 cells. Since the positive control antibody is a humanized antibody (i.e., Roche Vonlerolizumab), and the anti-OX40 antibody of the present invention is a mouse antibody, the secondary antibody used in the detection is completely different (sheep anti-human IgG-HRP, Abcam, ab98595; sheep anti-human IgG-R-PE, Southern Biotech, 204009), therefore, the final MFI reading is also quite different.

[0164] 3. Specific activation of OX40 signaling pathway

[0165] 3.1 Construction of OX40 signaling pathway reporter cell line

[0166] The reporter gene vector pGL4.32[luc2P / NF-κB-RE / Hygro] was purchased from Promega. HEK293 cells (Shanghai Guandao Biotechnology #C028) were transfected with the reporter gene vector and screened with hygromycin (conventional screening steps were sufficient). Positive cell lines with strong drug resistance were selected, and positive cells were stimulated with TNFα to activate the NF-κB signaling pathway. The samples were treated with a single luciferase reporter gene detection kit (Beijing Yuanpinghao Biology #LF102-01). The transcriptional activity of luciferase was detected by measuring RLU with a multifunctional microplate reader. Finally, the three positive cell lines with the highest transcriptional activity, 1C2-2, 1C6-3, and 1B1-2, were selected (Table 9).

[0167] The OX40 expression vector was purchased from Sino Biological, and the three positive cell lines mentioned above were transfected with the OX40 expression plasmid, and hygromycin plus G418 were used for screening to select positive cell lines with strong drug resistance. The expression of OX40 on the surface of the cell lines was detected by FACS (the specific experimental steps were the same as 2.2 above except for the different samples tested); the ability of anti-OX40 antibodies to activate the NF-κB signaling pathway after binding to OX40 on the surface of different positive cells was detected by a multifunctional microplate reader. FACS showed that there was no significant difference in the expression level of OX40 in each positive cell line, among which the 19B3 cell line had the strongest NF-κB transcription activity ( Figure 3 ). Therefore, the positive cell line 19B3 was selected as the OX40 signaling pathway reporter cell line.

[0168] Table 9 NF-κB transcriptional activity in different positive cell lines

[0169]

[0170]

[0171] 3.2 Identification of specific activation of OX40 signaling pathway

[0172] The positive cell line 19B3 cells obtained above were inoculated into 96-well plates and incubated overnight in a CO2 incubator. OX40 antibodies 1G10-9-13-11 and 5A3-6-15 were diluted in gradients and added to the corresponding wells, incubated in a CO2 incubator for 5 hours, and then treated with a single luciferase reporter gene detection kit, and the relative luminescence unit (RLU) was read by a multifunctional microplate reader, and the concentration-stimulation activity effect curve of the antibody was fitted by a four-parameter logistic equation using the analysis software.

[0173] like Figure 4As shown in the figure, both 1G10-9-13-11 and 5A3-6-15 antibodies can effectively activate the OX40 signaling pathway, and their half effective concentrations (EC50) are 833.9 ng / mL and 633.0 ng / mL, respectively. Moreover, with the increase of antibody concentration, at the same concentration, the activation ability of 5A3-6-15 antibody is much greater than that of 1G10-9-13-11 antibody; in contrast, under the same conditions, the positive control antibody only shows relatively weak activation ability so that EC50 cannot be effectively fitted. SEQUENCE LISTING <110> Bioscan Biopharmaceuticals (Hangzhou) Co., Ltd. <120> OX40 targeting antibody and preparation method and application thereof <130> P20017287C <160> 36 <170> PatentIn version 3.5 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH CDR1 <400> 1 Gly Tyr Thr Phe Thr Ser Tyr 1 5 <210> 2 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH CDR2 <400> 2 Asn Pro Tyr Asn Asp Gly 1 5 <210> 3 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH CDR3 <400> 3 Gly Ala Tyr Gly Ser Ser Tyr Asn Phe Asp Tyr 1 5 10 <210> 4 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL CDR1 <400> 4 Ser Ala Ser Gln Gly Ile Ser Asn Tyr Leu Asn 1 5 10 <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL CDR2 <400> 5 Tyr Thr Ser Ser Leu His Ser 1 5 <210> 6 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL CDR3 <400> 6 Gln Gln Tyr Ser Lys Leu Pro Tyr Thr 1 5 <210> 7 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH amino acid <400> 7 Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Ile Met His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Ser Lys Tyr Asn Glu Asn Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Phe Tyr Cys 85 90 95 Ala Arg Gly Ala Tyr Gly Ser Ser Tyr Asn Phe Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Thr Leu Thr Val Ser Ser 115 120 <210> 8 <211> 106 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL amino acids <400> 8 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Ser Ala Ser Gln Gly Ile Ser Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr Tyr Thr Ser Ser Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Pro 65 70 75 80 Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Lys Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Lys Asn 100 105 <210> 9 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> 5A3-6-15 VH nucleotide <400> 9 cagatccagt tggtgcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg 60 tcctgcaagg cttctggata cacattcact agctatatta tgcactgggt gaagcagaag 120 cctgagcagg gccttgagtg gattggatat attaatcctt acaatgatgg ttctaagtac 180 aatgagaact tcaaaggcaa ggccacactg acttcagaca aatcctccag cacagcctac 240 atggagctca gcagcctgac ctctgaggac tctgcggtct tttactgtgc aaggggggcc 300 tacggttcta gttacaactt tgactactgg ggccaaggca ccactctcac agtctcctca 360 <210> 10 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> 5A3-6-15 VL nucleotide <400> 10 gatatccaga tgacacagac tacttcctcc ctgtctgcct ctctgggaga cagagtcacc 60 atcagttgca gtgcaagtca gggcattagc aattatttaa actggtatca gcagaaacca 120 gatggaactg ttaaactcct gatctattac acatcaagtt tacactcagg agtcccatca 180 aggttcagtg gcagtgggtc tgggacagat tattctctca ccatcagcaa cctggaacct 240 gaagatattg ccacttatta ttgtcagcag tatagtaagc ttccgtacac gttcggaggg 300 gggaccaagc tgaaataaaa c 321 <210> 11 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH FWR1 <400> 11 Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser 20 25 <210> 12 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH FWR2 <400> 12 Ile Met His Trp Val Lys Gln Lys Pro Glu Gln Gly Leu Glu Trp Ile 1 5 10 15 Gly Tyr Ile <210> 13 <211> 41 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH FWR3 <400> 13 Ser Lys Tyr Asn Glu Asn Phe Lys Gly Lys Ala Thr Leu Thr Ser Asp 1 5 10 15 Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu 20 25 30 Asp Ser Ala Val Phe Tyr Cys Ala Arg 35 40 <210> 14 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VH FWR4 <400> 14 Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 1 5 10 <210> 15 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL FWR1 <400> 15 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys 20 <210> 16 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL FWR2 <400> 16 Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr 1 5 10 15 <210> 17 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL FWR3 <400> 17 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser 1 5 10 15 Leu Thr Ile Ser Asn Leu Glu Pro Glu Asp Ile Ala Thr Tyr Tyr Cys 20 25 30 <210> 18 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 5A3-6-15 VL FWR4 <400> 18 Phe Gly Gly Gly Thr Lys Leu Lys Asn 1 5 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH CDR1 <400> 19 Gly Tyr Thr Phe Thr Asn Tyr Trp 1 5 <210> 20 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH CDR2 <400> 20 Ile Asn Pro Ser Asn Gly Arg Thr 1 5 <210> 21 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH CDR3 <400> 21 Glu Ala Val Pro Tyr Tyr Phe Val Tyr 1 5 <210> 22 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL CDR1 <400> 22 Gln Asp Ile Asn Asn Tyr 1 5 <210> 23 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL CDR2 <400> 23 Phe Thr Ser 1 <210> 24 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL CDR3 <400> 24 Gln Gln Gly Asn Thr Leu Pro Leu Thr 1 5 <210> 25 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH amino acid <400> 25 Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30 Trp Ile His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Ser Asn Gly Arg Thr Asn Ser Asn Glu Lys Phe 50 55 60 Lys Asn Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Glu Ala Val Pro Tyr Tyr Phe Val Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 <210> 26 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL Amino Acids <400> 26 Asp Ile Val Met Thr Gln Ala Ala Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Asn Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr Phe Thr Ser Gly Leu Arg Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Asn 100 105 <210> 27 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH nucleotide <400> 27 gaggttcagc tgcagcagtc tggggctgaa ctggtgaagc ctggggcttc agtgaagctg 60 tcctgcaagg cttctggcta caccttcacc aactactgga tacactgggt gaagcagagg 120 cctggacaag gccttgagtg gattggagag attaatccta gcaacggtcg tactaactcc 180 aatgagaagt tcaagaacaa ggccacactg actgtagaca aatcctccag cacagcctac 240 atgcaactca gcagcctgac atctgaggac tctgcggtct attactgtgc agaggcggtg 300 ccgtactact ttgtctactg gggccaaggc accactctca cagtctcctc a 351 <210> 28 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL nucleotide <400> 28 gatattgtga tgacgcaggc tgcatcctcc ctgtctgcct ctctgggaga cagggtcacc 60 atcagttgta gggcaagtca ggacattaac aattatttaa actggtatca gcagaaacct 120 gatggaactg ttaaactcct gatctacttc acatcaggat tacgctcagg agtcccatca 180 aggttcagtg gcagtgggtc tggaacagat tattctctca ccattagcaa cctggagcaa 240 gaagatattg ccacttactt ttgccaacag ggtaatacgc ttcctctcac gttcggtgct 300 gggaccaagc tggagctaaa c 321 <210> 29 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH FWR1 <400> 29 Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser 20 25 <210> 30 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH FWR2 <400> 30 Ile His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly 1 5 10 15 Glu <210> 31 <211> 39 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH FWR3 <400> 31 Asn Ser Asn Glu Lys Phe Lys Asn Lys Ala Thr Leu Thr Val Asp Lys 1 5 10 15 Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp 20 25 30 Ser Ala Val Tyr Tyr Cys Ala 35 <210> 32 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VH FWR4 <400> 32 Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 1 5 10 <210> 33 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL FWR1 <400> 33 Asp Ile Val Met Thr Gln Ala Ala Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser 20 25 <210> 34 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL FWR2 <400> 34 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 1 5 10 15 Tyr <210> 35 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL FWR3 <400> 35 Gly Leu Arg Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 1 5 10 15 Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala 20 25 30 Thr Tyr Phe Cys 35 <210> 36 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 1G10-9-13-11 VL FWR4 <400> 36 Phe Gly Ala Gly Thr Lys Leu Glu Leu Asn 1 5 10

Claims

1. An OX40 targeting antibody or an antigen-binding fragment thereof, characterized in that: It comprises a heavy chain variable region VH and a light chain variable region VL, The VH comprises the following complementarity determining regions CDR: VH CDR1 as shown in the amino acid sequence of SEQ ID NO: 1, VH CDR2 as shown in the amino acid sequence of SEQ ID NO: 2, and VH CDR3 as shown in the amino acid sequence of SEQ ID NO: 3; The VL comprises the following CDRs: VL CDR1 as shown in the amino acid sequence of SEQ ID NO:4, VL CDR2 as shown in the amino acid sequence of SEQ ID NO:5, and VL CDR3 as shown in the amino acid sequence of SEQ ID NO:

6.

2. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody is a mouse antibody.

3. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 2, characterized in that: The VH of the murine antibody further comprises a heavy chain variable region framework region VH FWR, and / or, the VL of the murine antibody further comprises a light chain variable region framework region VL FWR; the VH FWR is selected from 1) FR1, FR2 and FR3 regions in germline IGHV1S81*02, IGHV1-53*01, IGHV1-69*02, IGHV1-64*01, IGHV1-74*04, and 2) FR4 region in germline IGHJ2*01; and / or, the VL FWR is selected from 1) FR1, FR2 and FR3 regions in germline IGKV10-96*01, IGKV10-96*02, IGKV10-96*03, IGKV10-96*04, IGKV10-96*05, and 2) FR4 region in germline IGKJ5*01.

4. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 3, characterized in that: The amino acid sequence of VH of the murine antibody is the amino acid sequence shown in SEQ ID NO:7; and / or, the amino acid sequence of VL is the amino acid sequence shown in SEQ ID NO:

8.

5. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 4, characterized in that: The nucleotide sequence of VH of the murine antibody is the nucleotide sequence shown in SEQ ID NO:9; and / or the nucleotide sequence of VL is the nucleotide sequence shown in SEQ ID NO:

10.

6. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody is a humanized antibody.

7. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The framework region of the variable region of the humanized antibody includes the framework region of the human antibody heavy chain variable region and the framework region of the human antibody light chain variable region; the framework region of the human antibody light chain variable region is selected from 1) FR1, FR2 and FR3 regions in the germline IGHV1-46*01, IGHV1-46*02, IGHV1-46*03, IGHV1-46*04, IGHV1-2*06, and 2) germline IGHJ4*01, IGHJ4*02, IGHV1-46*03, IGHV1-46*04, IGHV1-2*06. GHJ4*01, FR4 region in IGHJ4*01; and / or, the framework region of the human antibody heavy chain variable region is selected from 1) FR1, FR2 and FR3 regions in germline IGKV1-33*01, IGKV1D-33*01, IGKV1-39*01, IGKV1D-39*01, IGKV1-27*01, and 2) FR4 region in germline IGKJ2*01, IGKJ2*02.

8. The OX40 targeting antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, characterized in that: It includes full-length antibodies, Fab, Fab', F(ab')2, Fv, scFv, VHH, HCAb, bispecific antibodies, multispecific antibodies, or monoclonal antibodies or polyclonal antibodies prepared from the above antibodies.

9. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 8, characterized in that: The antibody also includes a mouse antibody constant region or a human antibody constant region; the mouse antibody constant region includes a heavy chain constant region of mouse IgG1, IgG2a, IgG2b3 or IgG3, and / or a light chain constant region of the κ or λ type; the human antibody constant region includes a heavy chain constant region of human IgG1, IgG2, IgG3 or IgG4, and / or a light chain constant region of the κ or λ type.

10. The OX40 targeting antibody or antigen-binding fragment thereof according to claim 9, characterized in that: The heavy chain constant region is hIgG1, and the light chain constant region is the κ chain of a human antibody.

11. A bispecific antibody comprising a first protein functional region and a second protein functional region, characterized in that: The first protein functional region is an antibody targeting OX40 or an antigen-binding fragment thereof as claimed in any one of claims 1 to 10; the second protein functional region is an antibody targeting a non-OX40 antigen.

12. The bispecific antibody according to claim 11, characterized in that The non-OX40 antigen is an immune checkpoint antigen or a tumor treatment target.

13. The bispecific antibody according to claim 12, characterized in that The immune checkpoint antigens include PD-1, PD-L1, PD-L2, 4-1bb, CD40, CD73, Tim3, LAG3 or CD47.

14. An isolated nucleic acid encoding an antibody or antigen-binding fragment thereof targeting OX40 according to any one of claims 1 to 10.

15. An expression vector comprising the isolated nucleic acid of claim 14.

16. The expression vector according to claim 15, characterized in that The expression vector is a plasmid, cosmid, phage or virus vector.

17. The expression vector according to claim 16, wherein The viral vector is a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

18. A transformant comprising the expression vector according to any one of claims 15 to 17 in a host cell.

19. The transformant according to claim 18, wherein The host cell is E. coli TG1, BL21 cell, or CHO-K1 cell.

20. A method for preparing an antibody or an antigen-binding fragment thereof targeting OX40, comprising culturing the transformant according to claim 18 or 19, and obtaining the antibody or the antigen-binding fragment thereof targeting OX40 from the culture.

21. A chimeric antigen receptor comprising the OX40 targeting antibody or antigen-binding fragment thereof according to any one of claims 1 to 10.

22. A genetically modified cell, characterized in that It comprises the chimeric antigen receptor according to claim 21.

23. The genetically modified cell of claim 22, wherein The genetically modified cells are eukaryotic cells.

24. The genetically modified cell of claim 23, wherein The genetically modified cells are isolated human cells.

25. The genetically modified cell of claim 24, wherein The gene-modified cells are immune cells, or NK cells.

26. The genetically modified cell of claim 25, wherein The gene-modified cells are T cells or NK92 cell lines.

27. An antibody-drug conjugate comprising a cytotoxic agent and the OX40 targeting antibody or antigen-binding fragment thereof according to any one of claims 1 to 10.

28. A drug combination comprising the OX40 targeting antibody or antigen-binding fragment thereof as described in any one of claims 1 to 10, the bispecific antibody as described in any one of claims 11 to 13, the chimeric antigen receptor as described in claim 21, the genetically modified cell as described in any one of claims 22 to 26, and / or the antibody-drug conjugate as described in claim 27.

29. A kit comprising the OX40 targeting antibody or antigen-binding fragment thereof as claimed in any one of claims 1 to 10, the bispecific antibody as claimed in any one of claims 11 to 13, the chimeric antigen receptor as claimed in claim 21, the genetically modified cell as claimed in any one of claims 22 to 26, the antibody-drug conjugate as claimed in claim 27 and / or the drug combination as claimed in claim 28.

30. The kit according to claim 29, wherein The kit may also include (i) a device for administering the antibody or antigen-binding fragment thereof or antibody-drug conjugate or pharmaceutical composition; and / or (ii) instructions for use.

31. Use of the OX40 targeting antibody or antigen-binding fragment thereof as described in any one of claims 1 to 10, the bispecific antibody as described in any one of claims 11 to 13, the chimeric antigen receptor as described in claim 21, the genetically modified cell as described in any one of claims 22 to 26, the antibody-drug conjugate as described in claim 27, the drug combination as described in claim 28 and / or the kit as described in claim 29 in the preparation of a product for diagnosing, preventing and / or treating tumors.

32. The use according to claim 31, characterized in that The tumor is lung cancer, liver cancer, stomach cancer, breast cancer, head and neck cancer and / or colon cancer.

Images