Novel nucleolin-binding peptides and their applications

Abstract

The present invention relates to a novel peptide that specifically binds to nucleolin, and more specifically, to a peptide expressed by a specific amino acid sequence, a conjugate comprising the peptide and an anticancer drug, a fusion peptide comprising the peptide and a cell-penetrating peptide, a composition comprising the peptide for diagnosing cancer, and a composition comprising the peptide or the conjugate for preventing or treating cancer. In the present invention, the peptide ligand AGM peptide and its mutants, screened using the MAP synthesis method and the OBOC combination method, have been shown to specifically bind to cancer cells, and their conjugates with anticancer drugs inhibit cancer growth (in vitro and in vivo). Therefore, the AGM peptide targeting nucleolin can be effectively used for diagnosis and targeted drug delivery in cancer treatment.

Description

Technical Field

[0001] The present invention relates to a novel peptide that specifically binds to nucleolin, and more particularly, to a peptide expressed by a specific amino acid sequence, a conjugate comprising the peptide and an anticancer agent, a fusion peptide comprising the peptide and a cell-penetrating peptide, a composition for diagnosing cancer comprising the peptide, and a composition for preventing or treating cancer comprising the peptide or the conjugate. Background Art

[0002] Compared with traditional drugs, the use of cancer-specific ligands as drug carriers can deliver higher payloads of chemotherapy drugs specifically for tissues or cells, thereby reducing systemic toxicity (Allen TM. Nat Rev Cancer. 2002; 2: 750-63). Among cancer-specific ligands, nanoparticles and antibodies have been widely studied in clinical cancer diagnosis and treatment (Yao VJ et al., J Control Release. 2016; 240: 267-86). Therapeutic nanoparticles and antibodies have shown great promise in the emerging field of personalized medicine because they can detect and monitor cancer in individual patients at an early stage and provide anticancer drugs over a longer period of time to enhance therapeutic effects (Palmieri D et al., Proc Natl Acad Sci U SA. 2015; 112: 9418-23). ​​Although nanoparticles are promising drug carrier systems, their instability in circulation, insufficient tissue distribution and cytotoxicity have unresolved limitations in practical applications (Sukhanova A et al., Nanoscale Res Lett. 2018; 13: 44). Furthermore, limitations of therapeutic antibodies include slow delivery and diffusion into tumor tissue due to their large size (Epenetos AA et al., Cancer Res. 1986; 46: 3183-91).

[0003] As an alternative to classical diagnostic and therapeutic methods, cancer-specific peptides can be used to improve therapeutic efficiency and reduce the side effects associated with nanoparticle and antibody cancer treatments (Mori T. Curr Pharm Des. 2004; 10: 2335-43). Peptide ligands have the advantages of being easy to synthesize in large quantities, having low immunogenicity, generating non-toxic metabolites, and having high in vivo biocompatibility (McGregor DP. Curr Opin Pharmacol. 2008; 8: 616-9). Among the many methods for discovering peptides, the single-bead single-compound (OBOC) combinatorial method is a powerful tool for screening peptide ligands (Lam KS, et al. Chem Rev. 1997; 97: 411-48). Peptide screening methods based on OBOC combinatorial libraries have promoted the discovery of novel peptide ligands for cell targeting of cancer and other diseases (Mikawa M, et al. Mol Cancer Ther. 2004; 3: 1329-34). Although many cancer-specific peptides have been isolated using in vitro OBOC combinatorial screening or other methods, some challenges still exist. In particular, a major drawback of using peptides as drugs is their extremely short half-life due to rapid cleavage by various peptidases (Borchardt TR, et al. Adv Drug Deliv Rev. 1997; 27: 235-56). The inventors of the present application aimed to overcome this problem by developing a dedicated method for synthesizing bioactive peptides in the form of multiantigenic peptides (MAPs) dendrimers. Synthesis of monomeric peptides in a dendrimer format results in increased stability due to acquired resistance to protease and peptidase activity (McGuire MJ, et al. Sci Rep. 2014; 4: 4480).

[0004] Based on this, the inventors of the present application combined OBOC combinatorial screening and MAP synthesis to discover a series of peptide ligands that specifically bind to human breast cancer and colon cancer cells, named AGM or AGM peptides. In vivo fluorescence imaging showed that the AGM series of peptides were more specifically distributed in tumors than in normal tissues. In addition, in vitro, compared with treatment with paclitaxel (PTX) alone, treatment with PTX-coupled AGM improved the accumulation of PTX in cancer cells and more effectively inhibited breast cancer and colon cancer cells. In addition, treatment with PTX-coupled AGM promoted the specific localization of PTX in tumor tissue, thereby increasing cytotoxicity, enhancing drug accumulation, and improving anti-cancer efficacy in breast cancer xenograft models. In addition, pull-down assays and LC-MS / MS showed that nucleolin (NCL) is the target protein of AGM. NCL is the most abundant protein in the nucleolus. In the present invention, the overexpression of NCL in cancer cell membranes and the neutralization of cell membrane NCL were confirmed by using anti-NCL antibodies to inhibit cancer cell proliferation and increase cell apoptosis rate in vitro. Due to their oncogenic role and expression on cancer cell membranes, NCL represents an attractive target for cancer therapy. Taken together, these results indicate that the AGM series of peptides are novel tumor-targeting peptides for the diagnosis and treatment of cancer.

[0005] The information disclosed in the background technology is only for enhancement of understanding of the background of the invention and may not include information that constitutes the prior art that is already known in the art to which the invention belongs. Summary of the Invention

[0006] An object of the present invention is to provide a peptide that specifically binds to nucleolin (NCL).

[0007] Another object of the present invention is to provide a conjugate comprising the peptide and an anticancer agent.

[0008] Another object of the present invention is to provide a multimer comprising two or more peptides.

[0009] Yet another object of the present invention is to provide a conjugate comprising the multimer and an anticancer agent.

[0010] Another object of the present invention is to provide a fusion peptide in which the peptide is fused with a cell-penetrating peptide (CPP), and a fusion peptide in which the multimer is fused with a cell-penetrating peptide.

[0011] Another object of the present invention is to provide a composition for diagnosing cancer comprising the peptide or the multimer, a method for diagnosing cancer, the use of the peptide or the multimer in diagnosing cancer, and the use of the peptide or the multimer in preparing a drug for diagnosing cancer.

[0012] Another object of the present invention is to provide a composition for preventing or treating cancer comprising the peptide, the conjugate or the multimer, a method for preventing or treating cancer, use of the peptide, the conjugate or the multimer in preventing or treating cancer, and use of the peptide, the conjugate or the multimer in preparing a medicament for preventing or treating cancer.

[0013] To achieve the above object, the present invention provides a peptide that specifically binds to nucleolin (NCL), the peptide comprising an amino acid sequence selected from the group consisting of:

[0014] (a) the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 8; and

[0015] (b) an amino acid sequence comprising at least one amino acid mutation selected from the group consisting of:

[0016] (i) substitution of the methionine residue at position 5 from the N-terminus;

[0017] (ii) substituting the tyrosine residue at position 7 from the N-terminus; and

[0018] (iii) Insertion of a leucine or lysine residue at the C-terminus.

[0019] The present invention also provides a conjugate comprising the peptide and an anticancer agent.

[0020] The present invention also provides a multimer comprising the peptide.

[0021] The present invention also provides a conjugate comprising the multimer and an anticancer agent.

[0022] The present invention also provides a fusion peptide, wherein the peptide is fused with a cell penetrating peptide (CPP).

[0023] The present invention also provides a fusion peptide, wherein the multimer and the cell-penetrating peptide are fused together.

[0024] The present invention also provides a composition for diagnosing cancer comprising the peptide or the multimer, a method for diagnosing cancer, use of the peptide or the multimer in diagnosing cancer, and use of the peptide or the multimer in preparing a drug for diagnosing cancer.

[0025] The present invention also provides a composition for preventing or treating cancer comprising the peptide, the conjugate or the multimer, a method for preventing or treating cancer, use of the peptide, the conjugate or the multimer in preventing or treating cancer, and use of the peptide, the conjugate or the multimer in preparing a medicament for preventing or treating cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Shown are the structures of monomers (AGM-330m), dimers (AGM-330d) and tetramers (AGM-330t) of conjugates in which AGM-330 according to the present invention is conjugated to PEG;

[0027] Figure 2 The structure of the AGM-330-CPP fusion peptide according to the present invention is shown, wherein the AGM-330-PEG conjugate is coupled to a cell penetrating peptide (CPP);

[0028] Figure 3 Schematic diagram of the peptide library synthesis and screening steps: 1. Construct a combinatorial OBOC library using a split-mix synthesis method; 2. Synthesize approximately 2,600,000 libraries; 3. Incubate the OBOC library and cancer cells in a CO2 incubator; 4. Beads carrying ligands with affinity for cell surface molecules are covered with cells; 5. Positive beads are picked with a pipette under an inverted microscope; 6. The peptide sequence of the positive beads is determined by Edman microsequencing; 7. Candidate cancer-specific peptide ligands are identified by screening the OBOC combinatorial peptide library.

[0029] Figure 4 Shown are the OBOC library screening and MAP synthesis for cancer-specific ligands.

[0030] Figure 4 A shows the binding specificity of the peptides for cancer cells and normal cells. Figure 4 B shows the results of a whole cell binding assay showing the cell binding specificity of 8 selected beads. 6 Cells were resuspended at 100 cells / ml and incubated with beads. All experiments were repeated 3 times, and the scale bar is 200 μm. Figure 4 C shows the binding specificity determined by immunofluorescence confocal imaging of FITC-labeled AGM-330, AGM-331, and AGM-332, wherein the cell nuclei are stained with DAPI (blue), and the scale bar is 50 μm. Figure 4 D shows the binding specificity of AGM-330. Whole-cell binding assays were performed to determine the cellular binding of AGM-330. Scale bar: 200 μm. Figure 4Figure E shows the synthesis of AGM-330, with noteworthy reagents and conditions: (i) Fmoc-Lys-(Fmoc)-OH, piperidine, DMF; (ii) Fmoc-Lys-(Fmoc)-OH, piperidine, DMF; (iii) RHGAMVYLK-OH, piperidine; (iv) piperidine, DMF. Fmoc = 9-fluorenylmethyloxycarbonyl; DMF = dimethylformamide. Figure 4 F shows fluorescence activated cell sorting (FACS) analysis showing the specificity of AGM-330 for cancer cells in a variety of breast cancer and colon cancer cells and normal breast and colon cells. Wherein, the bar graph represents the mean ± standard deviation (SD), and statistical analysis was performed by one-way analysis of variance (ANOVA) and Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0031] Figure 5 The results of the in vivo stability evaluation of AGM-330 peptides (AGM-330m, AGM-330d, AGM-330t) are shown. After 2 mg / kg of AGM-330 was injected into the mouse tail vein, blood samples were collected from one eye at 0, 0.167, 1, 2, 4, 8, 12, 24 and 48 hours using a heparinized capillary tube. After the blood was coagulated at 4 ° C, serum was collected by centrifugation at 5,000 rpm for 10 minutes at 4 ° C. The remaining peptide portion in the serum was immediately fixed on an ELISA plate using an AGM-330 antibody. Absorbance was measured at a wavelength of 450 nm using a VersaMax ELISA microplate reader (Molecular Devices, Inc.), and pharmacokinetics were analyzed using Phoenix WinNonlin 8.1 (Pharsight, Inc., Mountain View, California, USA) program.

[0032] Figure 6 The results of cell viability analysis after treatment with AGM-330t or AGM-330d are shown. 4 Cells were plated in 96-well plates (100 cells / well). After incubation for 24 hours, the cells were treated with increasing concentrations of AGM-330t or AGM-330d at different serum concentrations for 48 hours. The activity of the cells was assessed by CellVia WST-1 assay (Young In Frontier) according to the manufacturer's instructions. The number of viable cells was measured at a wavelength of 450 nm using a VersaMax ELISA microplate reader (Molecular Devices).

[0033] Figure 7Characterization and identification of the molecular target of AGM-330 are shown.

[0034] Figure 7 A shows a schematic diagram of biotin pull-down experiment, mass spectrometry analysis and Western blotting. Figure 7 B shows Coomassie blue staining of proteins eluted from the affinity column after separation by 10% SDS-PAGE. Lane 1: Protein marker; Lane 2: Total lysate before biotin pull-down assay; Lane 3: Flowthrough after incubation with AGM-330-biotin; Lanes 4-6: Wash fractions of beads; Lanes 7-8: Elution of AGM-330-bound proteins. *Red stars indicate protein bands excised for in-gel digestion followed by LC-MS / MS analysis. Figure 7 C shows a protein database search of the peptides detected by MS, identifying NCL as a binding partner of AGM-330. Figure 7 D shows the gene list obtained from LC-MS / MS analysis, where the confidence scores represent the Mascot scores of the identified proteins. Figure 7 E shows the results of immunoblotting analysis of proteins eluted from the biotin pull-down experiment using anti-NCL antibody, wherein the arrow indicates the presence of NCL. Figure 7 Figure F shows the analysis of the NCL domain bound to AGM-330. Different GFP-NCL constructs were transfected into HEK293T cells. AGM-330-biotin was added to residues 1-710, residues 1-322, or residues 323-710 of NCL bound to streptavidin beads. Proteins on the beads were analyzed by immunoblotting using an anti-GFP antibody.

[0035] Figure 8 The results of the affinity (Kd) of AGM-330 for recombinant NCL evaluated by SPR are shown. The illustrated SPR sensorgram is from a representative experiment, which represents a set of three independent and similar experiments using different sensor chips. Recombinant NCL was immobilized on a CM5 sensor chip. Various concentrations of AGM-330 (20nM to 2.5μM) were incubated with the immobilized NCL and analyzed on a Biacore T-200 instrument.

[0036] Figure 9Shown are the results of a biotin pull-down assay analyzing the direct interaction between AGM-330 and purified NCL. Eluted proteins were immunoblotted using an anti-NCL antibody to form a biotin pull-down. Lane 1: protein marker; Lane 2: purified NCL input control; Lane 3: flow-through after incubation with AGM-330-biotin; Lanes 4-6: bead wash fractions; Lanes 7-8: elution of AGM-330-bound proteins. Arrows indicate the presence of NCL.

[0037] Figure 10 The ELISA results of the affinity of AGM-330 and its variants are shown. 4 Cells were seeded in 96-well plates (100 cells / well) and cultured for 24 hours. The cells were then treated with 13 biotin-coupled peptides at increasing concentrations for 2 hours. Avidin-horseradish peroxidase (HRP) was then attached via a high-affinity avidin-biotin interaction, and the TMB substrate was converted to a blue color by the HRP enzyme. The reaction was then terminated by adding acid, and the affinities of the 13 peptides were assessed by ELISA at 450 nm.

[0038] Figure 11 The binding specificity of AGM-330 in vitro and in vivo is shown.

[0039] Figure 11 A and Figure 11 B shows the results of fluorescence confocal microscopy of various cancer cells and normal cells. Figure 11 A) or CCD-18Co, HT-29 and HCT-116( Figure 11 B) Cells were treated with 5 μmol / l of AGM-330-FITC at 37°C for 30 minutes. NCL was stained with a primary anti-NCL antibody, and the complex of AGM-330 and NCL was visualized using a secondary anti-mouse antibody conjugated to AlexaFluor 594 dye. The cells were then fixed with 4% paraformaldehyde and the nuclei were stained with DAPI. The merged image shows nuclear staining of AGM-330-FITC, NCL, and DAPI. AGM-330-FITC shows AGM-330 conjugated to FITC. Scale bar is 20 μm. Figure 11 C shows the results of analysis of the distribution of NCL in various subcellular fractions of MCF-10A, MCF-7, and MDA-MB-231 cells, wherein plasma membrane, cytosol, and nuclear NCL were immunoblotted using anti-NCL antibodies. Figure 11D shows that knocking down NCL using siRNA inhibited the binding of AGM-330 to the cell membrane. Among them, MDA-MB-231 cells were transfected for 48 hours. Then, 5 μmol / l of AGM-330-FITC was added and waited for 2 hours. The cells were washed twice with PBS and fixed with 4% paraformaldehyde. Fluorescence was observed using a fluorescence confocal microscope. AGM-330-FITC is AGM-330 coupled to FITC, and the scale bar is 20 μm. Figure 11 E shows the results of analysis of NCL distribution in various subcellular fractions of MCF-10A, MCF-7, and MDA-MB-231 cells after siNCL1 treatment. Anti-NCL antibodies were used to immunoblot for plasma membrane, cytosol, and nuclear NCL. Figure 11 F shows a schematic diagram of the experimental protocol. In this protocol, the glandular fat pads of anesthetized 6-week-old male NPGTM mice were inoculated with Matrigel and 1×10 6 A 1:1 mixture of MDA-MB-231-luc cells. After tumor cell inoculation, when the tumor volume reached approximately 100 mm 3 Free Alexa680 or AGM-330-Alexa680 was injected into the tail vein at 4 ℃. Figure 11 G and Figure 11 H shows that 10 nmol of free Alexa680 ( Figure 11 G) or 10 nmol AGM-330-Alexa680 ( Figure 11 (H) In vivo fluorescence images of mice 30 minutes, 1 hour, 6 hours, and 24 hours after treatment. Here, fluorescence images of major organs, including the heart, spleen, lungs, brain, liver, kidneys, and tumors, were removed from mice treated with different methods. AGM-330-FITC is AGM-330 conjugated to FITC. Figure 11 I and Figure 11 J shows the tumors from three animals ( Figure 11 I) and different organs ( Figure 11 J) Average radiant efficiency of Alexa 680-related fluorescence from real-time imaging. The bar graph represents mean ± standard deviation, and statistical analysis was performed using one-way analysis of variance (ANOVA) with Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0040] Figure 12The results of the analysis of NCL expression in membrane and cytosol extracts are shown. MDA-MB-231 cells were transfected with non-targeted scrambled siRNA (Scr) or NCL-targeted siNCL1, siNCL2, or siNCL3. After 24 hours, the efficiency of gene silencing was determined by real-time PCR. Based on the observed mRNA levels, siNCL1 was selected for further experiments because it showed significant efficiency in knocking down the target gene. The bar graph represents the mean ± standard deviation, and statistical analysis was performed using one-way ANOVA and Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0041] Figure 13 Shown are the results of expression profiling and functional studies of NCL in breast and colon cancer.

[0042] Figure 13 A shows a significant correlation between tumorigenesis in patients with breast or colorectal adenocarcinoma and NCL mRNA expression levels, derived from a pooled review of Curtis and Alon data obtained through the Oncomine dataset repository (www.oncomine.org). Figure 13 B shows the results of Kaplan-Meier survival analysis of patients with breast and colon cancer according to NCL expression in two independent cohorts (Bertucci and Sveen). Figure 13 C and Figure 13 D shows the difference between normal breast tissue and breast cancer tissue ( Figure 13 C) and normal colon tissue and colon cancer tissue ( Figure 13 D) Immunohistochemistry (IHC) results of NCL. Scale bar: 100 μm. Figure 13 E to Figure 13 H shows the activity of cells treated with the indicated amount of anti-NCL antibody or IgG for 24 hours in serum-free medium. Figure 13 E), MDA-MB-231( Figure 13 F)、CCD-18Co( Figure 13 G) and HCT-116( Figure 13 H) cell viability. Apoptotic cells were visualized by staining Annexin V+ cells. Cells were neutralized with anti-NCL antibody and incubated in serum-free medium for 24 hours. Apoptotic cells were measured by FACS analysis ( Figure 13I). The bar graphs represent mean ± SD, and statistical analysis was performed by one-way analysis of variance (ANOVA) and Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0043] Figure 14 The in vivo tumor inhibitory efficacy of AGM-330t-PTX was shown.

[0044] Figure 14 A shows the results of cell proliferation inhibition determined by WST assay using AGM-330-PTX treatment for 48 hours in various breast cancer and colon cancer cells and normal cells. Figure 14 B is a schematic diagram of the experimental protocol. In this protocol, Matrigel and 1×10 6 A 1:1 mixture of MDA-MB-231-luc cells was added. When the volume of the primary tumor reached approximately 100 mm 3 Tumor-bearing mice were treated with vehicle (PBS), AGM-330t (16.68 mg / kg), PTX (2 mg / kg or 10 mg / kg, respectively), or AGM-330-PTX (19.05 mg / kg (n = 6 / group)). Figure 14 C to Figure 14 E shows the therapeutic effect of AGM-330-PTX evaluated in a breast cancer xenograft model. Figure 14 As shown in C, the primary tumor volume was measured twice a week until the day of sacrifice, and the primary tumor volume was calculated using the following formula: volume (mm 3 ) = (length (mm)) × (width (mm)) 2 ×0.5. Figure 14 In D, all primary tumors were isolated on the day of sacrifice. Figure 14 E shows the measurement of primary tumor weight. Figure 14 F to Figure 14 I shows the expression of Ki-67 ( Figure 14 F and Figure 14 H) and TUNEL ( Figure 14 G and Figure 14 I) Immunohistochemistry (IHC) sections of representative tumors stained. Cell nuclei were stained with DAPI (blue), and the scale bar is 50 μm. The bar graphs represent mean ± standard deviation, and statistical analysis was performed by one-way analysis of variance (ANOVA) and Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0045] Figure 15The results of the confirmation of the specific improvement of PTX efficacy by AGM-330t for cancer are shown. Blood was collected from xenograft mice by cardiac puncture under deep anesthesia induced by isoflurane. After blood coagulation at 4 ° C, serum was collected by centrifugation at 3,000 rpm for 10 minutes at 4 ° C. ALB ( Figure 15 A) GOT( Figure 15 B) GPT( Figure 15 C)TP-PS( Figure 15 D) and UA( Figure 15 E) ALB: albumin; GOT: aspartate aminotransferase; GTP: alanine aminotransferase; TP-PS: total protein / protein scan; UA: uric acid. Figure 15 F shows the body weight changes of xenografted mice after 3 weeks of treatment with different treatments. The bar graph represents the mean ± standard deviation, and statistical analysis was performed using one-way analysis of variance (ANOVA) with Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0046] Figure 16 Shown are the results of evaluating the anticancer effect of AGM-330d-PTX. Figure 16 A shows the structure of AGM-330d-PTX. Figure 16 B is a schematic diagram of the experimental protocol. In this protocol, the mammary fat pads of anesthetized 6-week-old male NPG mice were inoculated with Matrigel and 1×10 6 MDA-MB-231-luc tumor-bearing mice were treated with a 1:1 mixture of MDA-MB-231-luc cells, vehicle (PBS), AGM-330d (8.34 mg / kg), PTX (2 or 10 mg / kg, respectively), or AGM-330d-PTX (10.71 mg / kg) (n=6 / group). Figure 16 C and Figure 16 D shows the results of tumor growth monitored by whole-body bioluminescence imaging. In which, growing MDA-MB-231 cells expressing firefly luciferase were injected into the mammary fat pad of mice. By bioluminescence imaging ( Figure 16 C) to evaluate the therapeutic effect of AGM-330d-PTX, Figure 16 D shows the bioluminescence intensity every 5 days in 5 different mouse groups. Figure 16 E to Figure 16G shows the results of the evaluation of the therapeutic effect of AGM-330d-PTX in a breast cancer xenograft model. On the day of sacrifice, all primary tumors were isolated and their volumes were assessed ( Figure 16 E and Figure 16 F), and the weight of primary tumors was measured twice a week until the day of sacrifice ( Figure 16 G). Calculate primary tumor volume using the following formula: Volume (mm 3 ) = (length (mm)) × (width (mm)) 2 X0.5. Figure 16 H shows changes in body weight of xenografted mice after 3 weeks of treatment as indicated. Bars represent mean ± standard deviation, and statistical analysis was performed using one-way analysis of variance (ANOVA) with Dunnett's multiple comparisons. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0047] Figure 17 The synthesis process of AGM-330t-mCPP fusion peptide is shown.

[0048] Figure 18 Shown are the results of HPLC and MS analyses of AGM-330t-mCPP fusion peptide, AGM-330t, and maleimide-CPP.

[0049] Figure 19 The graphs show the cytotoxic effects of AGM-330t, mCPP, and AGM-330t-mCPP fusion peptide.

[0050] Figure 20 The apoptotic effects of AGM-330t, mCPP, and AGM-330t-mCPP fusion peptides are shown. Apoptotic cells were measured by FACS analysis. The bar graphs represent mean ± SD, and statistical analysis was performed using one-way analysis of variance (ANOVA) and Dunnett's multiple comparisons. *** indicates P < 0.001, and NS indicates not significant.

[0051] Figure 21 The concentration-dependent apoptosis-inducing effect of the AGM-330t-mCPP fusion peptide is shown.

[0052] Figure 22 The graph shows the concentration-dependent cytotoxic effects of AGM-330m-mCPP, AGM-330d-dCPP, and AGM-330t-tCPP fusion peptides.

[0053] Figure 23The graph shows the concentration-dependent cytotoxic effects of the combination of AGM-330m and AGM-330m-mCPP, the combination of AGM-330d and AGM-330d-dCPP, and the combination of AGM-330t and AGM-330t-tCPP. DETAILED DESCRIPTION

[0054] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Generally, the nomenclature used in this specification is well known and conventional in the art.

[0055] In one aspect, the present invention relates to a peptide that specifically binds to nucleolin (NCL), the peptide comprising an amino acid sequence selected from the group consisting of:

[0056] (a) the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 8; and

[0057] (b) an amino acid sequence comprising at least one amino acid mutation selected from the following groups in the amino acid sequence shown in SEQ ID NO: 1,

[0058] (i) the methionine residue at position 5 from the N-terminus is substituted;

[0059] (ii) the tyrosine residue at position 7 from the N-terminus is substituted; and

[0060] (iii) Insertion of a leucine or lysine residue at the C-terminus.

[0061] The discovery of peptide ligands that can functionally and specifically target tumors offers new opportunities for cancer diagnosis and treatment. However, the use of peptide ligands is largely limited by their short biological half-lives.

[0062] In the present invention, a peptide library of approximately 2,600,000 peptides was synthesized using a one-bead-one-compound (OBOC) combination approach combined with a multiple-antigen-peptide (MAP) synthesis method. Novel cancer-specific peptide ligands AGM-330, AGM-331, AGM-332, AGM-333, AGM-334, AGM-335, AGM-336, and AGM-337 were identified from the peptide library. Their amino acid sequences are shown in Table 1 below (see Figure 3 Using cell-binding assays, flow cytometry, and fluorescence confocal microscopy, we confirmed that the peptide ligands specifically bound to cancer cells in vitro and in vivo.

[0063] Furthermore, pull-down experiments and LC-MS / MS analysis confirmed that nucleolin (NCL) is the target protein of AGM-330, AGM-331, AGM-332, AGM-333, AGM-334, AGM-335, AGM-336, or AGM-337. Furthermore, treatment with a conjugate of paclitaxel (PTX) and AGM-330 significantly inhibited cancer cell growth compared to treatment with PTX alone.

[0064]

Table 1

[0065]

[0066]

[0067] Three of the eight peptides (AGM-330, AGM-331, and AGM-332) showed strong specificity and preferential binding to a breast cancer cell line (MDA-MB-231), with no or only weak binding to a human normal breast cell line (MCF-10A) (see Figure 4 A and Figure 4 B).

[0068] Furthermore, it was confirmed that AGM-330 having the amino acid sequence of SEQ ID NO: 1 still exhibited strong specific binding properties to nucleolin even if there were mutations in certain amino acid residues.

[0069] Specifically, in the present invention, the amino acid mutation in the amino acid sequence shown in SEQ ID NO: 1 may be, but is not limited to, at least one mutation selected from the group consisting of:

[0070] (i) the methionine residue at position 5 from the N-terminus is substituted;

[0071] (ii) the tyrosine residue at position 7 from the N-terminus is substituted; and

[0072] (iii) Insertion of a leucine or lysine residue at the C-terminus.

[0073] Preferably, the amino acid mutation may be at least one mutation selected from the group consisting of:

[0074] (i) the methionine residue at position 5 of the N-terminus is substituted with leucine or norleucine;

[0075] (ii) the tyrosine residue at position 7 of the N-terminus is substituted with phenylalanine; and

[0076] (iii) Insertion of a leucine or lysine residue at the C-terminus.

[0077] In the present invention, the amino acid sequence comprising a mutation may be selected from, but not limited to, the group consisting of SEQ ID NO: 9 to SEQ ID NO: 15 and SEQ ID NO: 20 (see Table 2).

[0078]

Table 2

[0079]

[0080]

[0081] In the amino acid sequence of SEQ ID NO: 13, "Nle" represents norleucine.

[0082] In the present invention, "AGM", "AGM peptide" or "AGM peptide ligand" refers to a peptide having an amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 20, or at least one peptide among peptides having an amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 20.

[0083] In the present invention, the AGM peptide can specifically bind to nucleolin (NCL).

[0084] Although NCL is primarily located in the nucleus of normal cells, previous studies have shown that overexpression of membrane NCL is enhanced in many different types of cancer cells (Shen N et al., Oncotarget. 2014; 5: 5494-509). Consistent with these studies, the present invention demonstrates that NCL is overexpressed on the membrane of actively proliferating cancer cells, but not in normal cells. Therefore, the use of molecules targeting NCL may be an effective method for selectively delivering drugs to tumors while minimizing side effects (Li F et al., Nat Commun. 2017; 8: 1390). In addition, the present invention demonstrates the effect of membrane NCL on cancer cells by neutralization with specific antibodies. As expected, the rate of cell apoptosis increased, followed by antibody-mediated neutralization of NCL. In general, NCL is an ideal therapeutic marker for cancer treatment, and AGM-330 targeting NCL has great potential as a tool for diagnosing and treating a variety of human cancers.

[0085] In one example of the present invention, AGM peptides, specifically AGM-330, specifically bind to cancer cells but bind weakly or not at all to normal breast and colorectal cells. These results demonstrate the cancer-specific nature of AGM-330, making it a prime candidate for the development of cancer-targeting peptides. In particular, in mouse xenograft studies, AGM-330 treatment resulted in greater accumulation in tumors than in the heart, spleen, lungs, or brain. AGM-330's ability to specifically target cancer cells provides a potential molecular tool for cancer diagnosis.

[0086] The present invention also relates to an AGM peptide-PEG conjugate, wherein the AGM peptide is conjugated to a polyethylene glycol (PEG) chain comprising at least two ethylene glycol groups, each of which has a -[CH2-CH2-O]- structure.

[0087] In the present invention, the concept of polyethylene glycol chain includes not only ordinary polyethylene glycol chains having the structure of Formula 1, but also derivatives thereof. Examples of derivatives of polyethylene glycol chains include, but are not limited to, aminopolyethylene glycol carboxylic acids having the structure of Formula 2.

[0088]

[0089] Formula 1 (polyethylene glycol)

[0090]

[0091] Formula 2 (aminopolyethylene glycol carboxylic acid)

[0092] Coupling with polyethylene glycol (PEG), also known as polyethylene glycolation (PEGylation), has been widely used to improve the pharmacological properties of therapeutic proteins (Gupta V et al., J Cell Commun Signal. 2019; 13: 319-30). In the present invention, polyethylene glycol is used to reduce steric hindrance and increase hydrophilicity. However, polyethylene glycol has always been affected by immunogenicity and has negative clinical effects on therapeutic molecules (Moreno A et al., Cell Chem. Biol. 2019; 26: 634-44.e3). An earlier study showed that the anti-PEG immune response to PEGylated molecules depends on the immunogenicity of the degree of PEGylation and the molecular weight of polyethylene glycol (Wan X et al., Process Biochem. 2017; 52: 183-91).

[0093] In the present invention, the polyethylene glycol chain may have 2 to 24 ethylene glycol units, preferably 4 to 20, more preferably 6 to 18, most preferably 6 to 12 ethylene glycol units, but is not limited thereto.

[0094] The polyethylene glycol chain can be connected to the AGM peptide via a linker. Thus, the AGM peptide-PEG conjugate can have, but is not limited to, a structure represented by the following structural formula 1.

[0095] AGM-L1-PEG (Structure 1)

[0096] In structural formula 1, PEG represents a polyethylene glycol chain, and L1 represents a linker.

[0097] Linker L1 is preferably selected from but not limited to single bond (direct bond), C1-C 20 Alkyl, C1-C 20 The present invention may include a group consisting of -alkylene, -S-, -NH- and -O-, and may include a peptide bond forming -CONH- with the carboxyl group of the C-terminal amino acid of the AGM peptide, but is not limited thereto.

[0098] In addition, in the AGM peptide-PEG conjugate of structural formula 1, a functional group for coupling with another substance, preferably a drug, can be introduced at the other end of the PEG coupled to AGM. Examples of functional groups include, but are not limited to, carboxyl (COOH), amino (NH2), and thiol groups.

[0099] For example, as shown in Structural Formulas 2 to 4, the AGM peptide-PEG conjugate can be in the form of, but not limited to, lysine (K) having an amino group (NH2) and / or cysteine ​​(C) having a thiol group coupled to the other end of the PEG coupled to the AGM peptide.

[0100] AGM-L1-PEG-K (Structure 2)

[0101] AGM-L1-PEG-C (Structure 3)

[0102] AGM-L1-PEG-KC (Structure 4)

[0103] For illustrative purposes, in one embodiment of the present invention, an AGM-330 monomer (AGMm) may have a structure as shown in Structural Formula 5, wherein lysine and tyrosine are introduced at the other end of the PEG coupled to AGM in the AGM-330-PEG conjugate.

[0104] RHGAMVYLK-L1-PEG-KC (Structure 5)

[0105] In the above structural formula 5, PEG can be connected to the C-terminus of AGM-330 through a linker (L1) including a peptide bond as shown in structural formula 6 through a condensation reaction between the carboxyl group and the amino group of the C-terminal lysine, but is not limited thereto.

[0106]

[0107] In another aspect, the present invention relates to an AGM peptide-drug conjugate or an AGM peptide-PEG-drug conjugate comprising an AGM peptide or an AGM peptide-PEG conjugate, and a drug.

[0108] In the present invention, the drug is an agent that exhibits a pharmacological effect, specifically, a chemotherapeutic agent, a toxin, a microRNA (miRNA), a siRNA, a shRNA or a radioisotope. The chemotherapeutic agent can be, for example, a cytotoxic agent or an immunosuppressant. Specifically, it can include chemotherapeutic agents that can be used as microtubule inhibitors, mitotic inhibitors, topoisomerase inhibitors or DNA intercalators. In addition, examples of chemotherapeutic agents include immunomodulatory compounds, anticancer agents and antiviral agents or combinations thereof.

[0109] Preferably, the drug can be an anticancer agent. The anticancer agent can be at least one selected from the group consisting of: taxanes (axols) and taxanes such as paclitaxel or docetaxel, maytansinoids, auristatins, aminopterin, actinomycin, bleomycin, thalidomide, camptothecin, N8-acetyl spermidine, 1-(2-chloroethyl)-1,2-dimethylsulfonyl hydrazide, esperamicin, etoposide, 6-mercaptopurine, caudastatin, trichothecenes, calicheamicin, methotrexate, vincristine, vinblastine, doxorubicin, melphalan, mitomycin A, mitomycin C, chlorambucil, duocarmycin, L-asparaginase, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosourea, cisplatin, carboplatin, mitomycin, dacarbazine, procarbazine, topotecan, nitrogen mustard mustard), Cytoxan, α-amanitin, etoposide, 5-fluorouracil, CNU (bischloroethyl nitrosourea), irinotecan, camptothecin, bleomycin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, asparaginase, vinorelbine ( vinorelbine), chlorambucil, melphalan, pyrrolobenzodiazepine, carmustine, lomustine, busulfan, treosulfan, dacarbazine, etoposide, teniposide, topotecan, 9-aminocamptothecin, cristatol, mitomycin CC), trimetrexate, mycophenolic acid, tiazofurin, ribavirin, 5-ethynyl-4-carbamoyl-1-β-furanosyl imidazole (EICAR), hydroxyurea, deferoxamine, floxuridine, doxifluridine, raltitrexed, cytarabine (ara C), cytosine arabinoside, fludarabine, tamoxifen, raloxifene, megestrol, goserelin, leuprolide acetate acetate), flutamide, bicalutamide, EB1089, CB1093, KH1060, berberine, verteporfin, curcumin, nab-paclitaxel (Abraxane), FOLFIRINOX, oxaliplatin, Xeloda, indolecarboxamide, phthalocyanine, tubulysin, photosensitizer Pe4, demethoxy-hypocrellin A, interferon-α, interferon-γ, tumor necrosis factor, gemcitabine, Velcade, Revlimid, thalidomide, lovastatin, 1-methyl-4-phenylpyridinium ion), staurosporine, actinomycin D, dactinomycin, bleomycin A2, bleomycin B2, peplomycin, epirubicin, pirarubicin, zorubicin, mitoxantrone, verapamil, thapsigargin, nucleases, and toxins of bacterial, animal, or plant origin.

[0110] In one example of the present invention, in a human breast cancer xenograft mouse model, treatment with AGM-330-PTX (a conjugate of AGM-330-PEG conjugate and PTX) resulted in a 60% and 46% reduction in tumor volume and weight, respectively, compared to that observed in the paclitaxel (PTX) treatment group (see Figure 14 C to Figure 14 E) The highly efficient targeting ability of AGM-330 to cancer cells and tissues provides a promising approach for anticancer drug delivery in cancer therapy.

[0111] Paclitaxel (PTX) is considered to be one of the most promising cancer chemotherapy drugs and has been tested for many different human malignancies (Ramalingam S, Belani CP.Expert Opin.Pharmacother.2004; 5: 1771-80). However, the high hydrophobicity of PTX and the related difficulties in its preparation process hinder the use of PTX for treatment. In addition, many side effects related to PTX treatment are also attributed to the diluent solvent used in the preparation process (Hennenfent KL, Govindan R.Ann Oncol.2006; 17: 735-49). However, unlike PTX, PTX coupled with AGM peptide, particularly AGM peptide-PEG conjugate, is highly hydrophilic. This hydrophilicity can improve its pharmacokinetic characteristics and make it possible to use less toxic dilution buffer, thereby further reducing the overall toxicity of the drug. The advantage of AGM peptide-mediated targeted delivery is that it can reduce side effects such as toxicity and significantly improve the therapeutic effect.

[0112] In the present invention, AGM peptide or AGM peptide-PEG conjugate can be directly or through a linker (L d ) is linked to a drug, preferably an anticancer agent.

[0113] Connector (L d ) can be cleavable. d ) allows the drug to be released from the antibody in a form that is cleavable under intracellular conditions (i.e., in the intracellular environment) by cleavage of the linker.

[0114] Connector (L d ) can be cleaved by a cleavage agent present in the intracellular environment (e.g., lysosome or endosome). For example, it can be a cleavable peptide linker that can be cleaved by, for example, an intracellular peptidase or protease (e.g., lysosomal or endosomal protease). Typically, the length of the peptide linker is at least two amino acids. The cleavage agent can include cathepsin B, cathepsin D, and plasmin, and hydrolyzes the peptide to allow the drug to be released into the target cell.

[0115] The peptide linker can be cleaved by cathepsin-B, a thiol-dependent protease overexpressed in cancer tissue. For example, a Phe-Leu or Gly-Phe-Leu-Gly linker can be used. In addition, the peptide linker can be, for example, a Val-Cit linker or a Phe-Lys linker, which can be cleaved by intracellular proteases.

[0116] In one embodiment, the cleavable linker is a pH-sensitive linker, which is sensitive to hydrolysis at certain pH values. Generally speaking, pH-sensitive linkers can be hydrolyzed under acidic conditions. Examples include acid-labile linkers that can be hydrolyzed in lysosomes, such as hydrazones, semicarbazones, thiosemicarbazones, cis-aconitamides, orthoesters, acetals, ketals, and the like.

[0117] In another embodiment, the linker can be a disulfide linker, for example, that can be cleaved under reducing conditions. Various disulfide bonds can be formed by SATA (N-succinimidyl-S-acetylthioacetate), SPDP (N-succinimidyl-3-(2-pyridyldithio)-propionate) propionate), SPDB (N-succinimidyl-3-(2-pyridyldithio) butyrate), and SMPT (N-succinimidyl-oxycarbonyl-α-methyl-α-(2-pyridyldithio) toluene).

[0118] In addition, the linker can be, for example, a non-cleavable linker. In this case, the drug is released in only one step (antibody hydrolysis), resulting in, for example, an amino acid-linker-drug conjugate. This type of linker can be a thioether group or a maleimidohexanoyl group, which can remain stable in blood.

[0119] In some cases, the AGM peptide or AGM peptide-PEG conjugate can be linked directly or through a non-covalent bond or a covalent bond to a drug, preferably an anticancer agent, but not limited thereto.

[0120] The non-covalent bond may, for example, be at least one selected from the group consisting of hydrogen bond, electrostatic interaction, hydrophobic interaction, van der Waals interaction, π-π interaction, and cation-π interaction.

[0121] In another aspect, the present invention relates to a multimer comprising two or more AGM peptides or AGM peptide-PEG conjugates.

[0122] In the present invention, the multimer may comprise, but is not limited to, 2 to 8, preferably 2 to 6, more preferably 2 to 4 AGM peptides or AGM peptide-PEG conjugates.

[0123] For example, in the present invention, the multimer may be a dimer in which two AGM peptides or two AGM peptide-PEG conjugates are connected via a linker (L2), or the multimer may be a tetramer in which dimers are connected via an additional linker (L3), but is not limited thereto. Furthermore, it will be apparent to those skilled in the art that multimers such as hexamers, octamers, and higher oligomers can be obtained by connections similar to those described above.

[0124] For example, the dimer and tetramer of the AGM peptide-PEG conjugate according to the present invention may have the structures

[0125] The structures represented by Formulas 7 and 8 are not limited thereto.

[0126]

[0127] Linkers L2 and L3 may be the same as or different from each other and may be independently cleavable or non-cleavable.

[0128] Linkers L2 and L3 can be independently selected from single bonds (direct bonds), amino acids or their derivatives, C1-C 20 Alkyl, C1-C 20 Preferably, the linker can be independently an amino acid or a derivative thereof, more preferably lysine (Lys, K) or arginine (Arg, R) having at least two amino groups, but is not limited thereto.

[0129] Most preferably, the linkers L2 and L3 can each independently be lysine (Lys, K), and in this case, the amino group (NH2) of lysine can be bound to PEG in a form similar to a peptide bond such as -C-CONH-, but is not limited thereto.

[0130] In addition, a functional group for coupling another substance, preferably a drug, can be introduced into one end of the linker of the AGM peptide or AGM peptide-PEG conjugate. For example, a functional group for coupling a drug can be introduced into L2 in Structural Formula 7 or L3 in Structural Formula 8.

[0131] Examples of functional groups include, but are not limited to, amino groups (NH2) and thiol groups. For example, lysine (K) having an amino group (NH2) and / or cysteine ​​(C) having a thiol group may be introduced as functional groups, but are not limited thereto.

[0132] For example, in one embodiment of the present invention, the AGM-330 dimer (AGM-330d) and the AGM-330 tetramer (AGM-330t) may have the structures shown in Table 3 below, but are not limited thereto.

[0133]

Table 3

[0134]

[0135] In one embodiment of the present invention, AGM-330d-PTX was used to test the anticancer efficacy ( Figure 16 A). The results showed that mice treated with AGM-330d-PTX displayed significantly reduced luciferase activity compared to that observed in PTX-treated mice ( Figure 16 C and Figure 16 D). Furthermore, treatment with AGM-330d-PTX resulted in a significant reduction in tumor volume and weight compared to that observed in the PTX-treated group ( Figure 16 E to Figure 16 G). Consistent with the results obtained with AGM-330t-PTX, the body weight of mice was not affected by AGM-330d-PTX administration compared to that observed in mice treated with vehicle (PBS) ( Figure 16 H) The cancer specificity of AGM-330d may enhance the efficacy of PTX and increase the concentration of therapeutic drugs in tumor tissues.

[0136] In another aspect, the present invention relates to a polymer-drug conjugate comprising: a polymer comprising two or more AGM peptide-PEG conjugates; and a drug, preferably an anticancer agent.

[0137] In the present invention, the description of AGM peptide-drug conjugates or AGM peptide-PEG-drug conjugates is equally applicable to polymer-drug conjugates, so each linker or drug is as described above in relation to AGM peptide-drug conjugates or AGM peptide-PEG-drug conjugates.

[0138] In another aspect, the present invention relates to an AGM peptide-PEG-CPP fusion peptide, wherein the AGM peptide-PEG conjugate is fused with a cell penetrating peptide (CPP).

[0139] As used herein, the term "cell penetrating peptide (CPP)" is a signal peptide, a combination of specific amino acids, used to deliver high molecular weight substances, such as proteins, DNA, RNA, etc., into cells. So far, cell penetrating peptides have been used to deliver various low molecular weight compounds or high molecular weight substances, such as proteins, peptides, RNA, and DNA into cells. Most cell penetrating peptides are derived from protein transduction domains or membrane translocation sequences. Unlike the general entry pathways for foreign substances to enter cells, cell penetrating peptides can enter cells without damaging the cell membrane and are expected to play an innovative role in delivering DNA or proteins that are known to be unable to cross the cell membrane.

[0140] The fusion peptide of the present invention uses a cell-penetrating peptide. There is no particular limitation on the cell-penetrating peptide, as long as it has the property of entering the cell through the endocytic mechanism. Preferably, the cell-penetrating peptide used in the present invention can be selected from the cell-penetrating peptides listed in Table 4 below or variants thereof.

[0141]

Table 4

[0142]

[0143]

[0144] More preferably, the cell-penetrating peptide may be selected from the group consisting of the cell-penetrating peptides listed in Table 5 below or variants thereof. For the synthesis methods and properties of the peptides shown in Table 5, reference may be made to Korean Patent No. 10-1169030. Most preferably, the cell-penetrating peptide may comprise the amino acid sequence of SEQ ID NO: 48.

[0145]

Table 5

[0146]

[0147]

[0148]

[0149] In one example of the present invention, the cell-penetrating peptide of SEQ ID NO: 48, which is represented as the DS4-3 peptide in Table 5, was selected for the experiment. However, it is obvious to those skilled in the art that even if a cell-penetrating peptide other than the actually used cell-penetrating peptide is fused to the peptide of the present invention, an effect similar to that of the present invention can be achieved.

[0150] In the present invention, the AGM peptide-PEG conjugate and the cell-penetrating peptide can be linked together via a linker. Preferably, they can be linked together via a maleimide-carboxyl bifunctional linker, but are not limited thereto.

[0151] On the other hand, the present invention relates to a polymer-CPP fusion peptide, wherein a polymer comprising two or more AGM peptide-PEG conjugates and a cell-penetrating peptide (CPP) are linked together.

[0152] In the present invention, the description of the AGM peptide-PEG-CPP fusion peptide can also be used to describe the polymer-CPP fusion peptide, so each linker or cell penetrating peptide is the same as previously defined in the AGM peptide-PEG-CPP fusion peptide.

[0153] On the other hand, the present invention relates to a composition for diagnosing cancer, which comprises an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM peptide-PEG-CPP fusion peptide or a polymer-CPP fusion peptide.

[0154] In another aspect, the present invention relates to a method for diagnosing cancer using an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM peptide-PEG-CPP fusion peptide, or a polymer-CPP fusion peptide.

[0155] On the other hand, the present invention relates to the use of AGM peptide, AGM peptide-PEG conjugate, AGM peptide-PEG-drug conjugate, polymer, polymer-drug conjugate, AGM peptide-PEG-CPP fusion peptide or polymer-CPP fusion peptide in diagnosing cancer.

[0156] On the other hand, the present invention relates to the use of AGM peptide, AGM peptide-PEG conjugate, AGM peptide-PEG-drug conjugate, polymer, polymer-drug conjugate, AGM peptide-PEG-CPP fusion peptide or polymer-CPP fusion peptide in the manufacture of a drug for diagnosing cancer.

[0157] Cancers whose onset or likelihood of onset can be predicted using the diagnostic composition of the present invention include, but are not limited to, leukemia, myeloproliferative disorders, lymphoma, breast cancer, liver cancer, gastric cancer, ovarian cancer, cervical cancer, glioma cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer, liver cancer, gastric adenocarcinoma, uterine cancer, bladder cancer, thyroid cancer, melanoma, squamous cell carcinoma, hematopoietic system cancer, kidney cancer, and head and neck cancer.

[0158] As used herein, the term "diagnosis" includes determining a subject's susceptibility to a particular disease or condition, determining whether a subject currently has a particular disease or condition, determining the prognosis of a subject with a particular disease or condition (e.g., identifying pre-metastatic or metastatic cancer conditions, determining the stage of a cancer, or determining the responsiveness of a cancer to a treatment), or therapeutics (e.g., monitoring a subject's status to provide information about the efficacy of a treatment). For the purposes of the present invention, diagnosis refers to determining the likelihood (risk) of developing or developing the aforementioned diseases.

[0159] On the other hand, the present invention relates to a composition for preventing or treating cancer, which comprises an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM peptide-PEG-CPP fusion peptide or a polymer-CPP fusion peptide.

[0160] On the other hand, the present invention relates to a method for preventing or treating cancer, comprising administering to a subject an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM peptide-PEG-CPP fusion peptide, or a polymer-CPP fusion peptide.

[0161] On the other hand, the present invention relates to the use of AGM peptide, AGM peptide-PEG conjugate, AGM peptide-PEG-drug conjugate, polymer, polymer-drug conjugate, AGM peptide-PEG-CPP fusion peptide or polymer-CPP fusion peptide in preventing or treating cancer.

[0162] On the other hand, the present invention relates to the use of AGM peptide, AGM peptide-PEG conjugate, AGM peptide-PEG-drug conjugate, polymer, polymer-drug conjugate, AGM peptide-PEG-CPP fusion peptide or polymer-CPP fusion peptide in the preparation of a medicament for preventing or treating cancer.

[0163] The cancer or carcinoma that can be treated with the composition of the present invention is not particularly limited and can be a cancer associated with nucleolin, such as a solid cancer or leukemia. Examples of such cancers include leukemia, myeloproliferative diseases, lymphoma, breast cancer, liver cancer, gastric cancer, ovarian cancer, cervical cancer, glioma cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer, liver cancer, gastric adenocarcinoma, uterine cancer, bladder cancer, thyroid cancer, melanoma, squamous cell carcinoma, hematopoietic cancer, kidney cancer and head and neck cancer, but are not limited thereto.

[0164]

[0014] As used herein, the terms "cancer" and "tumor" are used interchangeably to refer to or describe the physiological condition in mammals that is typically characterized by uncontrolled cell growth / proliferation.

[0165] As used herein, the term "prevention" refers to any procedure that inhibits or delays the progression of cancer by administering a composition comprising a peptide or conjugate. Furthermore, the term "treatment" refers to any procedure that alleviates or cures cancer symptoms by administering a composition comprising an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM-peptide PEG-CPP fusion peptide, or a polymer-CPP fusion peptide.

[0166] The composition for preventing or treating cancer according to the present invention may comprise a pharmaceutically effective amount of an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM peptide-PEG-CPP fusion peptide, or a polymer-CPP fusion peptide, either alone or together with at least one pharmaceutically acceptable carrier, excipient, or diluent. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to prevent, ameliorate, and treat cancer symptoms.

[0167] As used herein, " pharmaceutically acceptable " refers to physiologically acceptable additives, and when applied to the mankind, will not cause allergic reactions, such as gastrointestinal disturbances and dizziness, or similar reactions. The example of carrier, excipient and diluent includes lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, said composition can also include filler, anticoagulant, lubricant, wetting agent, flavoring, emulsifier and preservative. Suitable pharmaceutically acceptable carrier and reagent are as described in detail in Remington's Pharmaceutical Sciences (19th edition, 1995).

[0168] In addition, the composition of the present invention may contain at least one active ingredient known to have a cancer therapeutic effect, as well as an AGM peptide, an AGM peptide-PEG conjugate, an AGM peptide-PEG-drug conjugate, a polymer, a polymer-drug conjugate, an AGM peptide-PEG-CPP fusion peptide or a polymer-CPP fusion peptide.

[0169] The pharmaceutical composition of the present invention can be formulated using methods known in the art so as to release the active ingredient quickly, continuously or delayed after administration to mammals other than humans. The composition can be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injections or sterile powders.

[0170] The compositions of the present invention can be administered by a variety of routes, including oral, transdermal, subcutaneous, intravenous, or intramuscular routes. The dosage of the active ingredient can be appropriately selected based on various factors, including the route of administration, as well as the patient's age, sex, weight, and severity of the disease. The compositions for preventing or treating cancer according to the present invention can be administered in combination with known compounds that have the effect of preventing, ameliorating, or treating cancer symptoms.

[0171] Hereinafter, the present invention will be described in more detail with reference to examples. These examples are only for the purpose of illustrating the present invention, and it is obvious to those skilled in the art that the scope of the present invention should not be interpreted as being limited by these examples.

[0172] Example 1: Materials and Methods

[0173] Example 1-1: Synthesis of OBOC library

[0174] The OBOC library was synthesized on solid-phase TentaGel MB NH2 resin (Rapp Polymere, Tübingen, Germany). Combinatorial OBOC libraries were constructed using a "split-mix" synthesis method, with each library containing a random library of millions of beads / ligands. Approximately 2,600,000 OBOC libraries were synthesized using 5g of Tentagel MB NH2 resin (200μm, 520,000 beads / g). The ligands on the bead surface were synthesized using standard solid-phase peptide synthesis techniques, using 9-fluorenylmethyloxycarbonyl (Fmoc) chemistry and N-hydroxybenzotriazole (HOBt; Shanghai Jier Biochemical Co., Ltd., China) / N,N'-diisopropylcarbodiimide (DIC; Jier Biochemical Co., Ltd.). The coupling was confirmed to be complete by the ninhydrin test. The beads were stored in 70% ethanol at 4°C until use.

[0175] Example 1-2: Ethics and cell culture

[0176] All work involving human tissue was pre-approved by the Institutional Review Board (IRB) of Gwangju Institute of Science and Technology (#20191008-BR-48-03-02). All animal experiments were performed in accordance with the Institutional Animal Care and Use Committee (IACUC) of Gwangju Institute of Science and Technology (GIST-2019-040). All cultures were grown in a humidified incubator maintained at 37°C with 95% air / 5% CO2. The MCF-10A normal human breast cell line was obtained from the American Type Culture Collection and propagated in MEGM complete medium (MEGM, Lonza, Walkersville, MD, USA) supplemented with bovine pituitary extract (Cambrex Bioscience, Walkersville, MD, USA). The normal human colorectal cell line CCD-18Co was obtained from the Korea Cell Line Bank (Seoul, South Korea). Human breast and colon cancer cell lines, including MCF-7, MDA-MB-231, HT-29, and HCT-116, were obtained from the Korean Cell Line Bank. Jurkat T cells were also obtained from the Korean Cell Line Bank. The luciferase-expressing MDA-MB-231 cancer cell line was obtained from PerkinElmer (Hopkinton, MA, USA). Each cancer cell line was grown in RPMI 1640 (Gibco, Waltham, MA, USA) and DMEM (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), 0.1 mg / ml streptomycin (Gibco), and 100 units / ml penicillin (Gibco).

[0177] Example 1-3: Screening of the OBOC library for cancer-specific ligands

[0178] Before screening, the beads were thoroughly washed with double distilled water and phosphate-buffered saline (PBS; Welgene Inc., Korea). Cancer cells and normal cells were separated from the culture dish using trypsin / EDTA (Gibco), washed with the corresponding culture medium, and then washed with 10 6Cells were resuspended at 100 cells / ml and incubated in a culture dish with OBOC beads in a humidified CO2 incubator at 37°C with shaking (60 rpm). Cell-bound beads appeared as rosettes under a microscope, with one or more layers of cells covering the central bead. Positive beads were picked with a pipette under an inverted microscope and treated with guanidine hydrochloride (8 M, 20 minutes) to remove cells and proteins from the bead surface. A second round of screening was performed using normal mammary epithelial cells to remove false positive binding. Only beads that showed cell binding in both rounds were subjected to peptide sequencing.

[0179] Examples 1-4: Chemical Synthesis of Peptides and 2'-Maleimide-PTX

[0180] All peptides and 2'-maleimide-PTX were synthesized by AnyGen (Gwangju, South Korea) using solid-phase peptide synthesis and Steglich esterification, respectively. The purity and molecular weight of the peptides and 2'-maleimide-PTX were determined using HPLC and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) (Shimadzu Corporation, Kyoto, Japan), respectively.

[0181] Examples 1-5: Synthesis of AGM-330-PTX

[0182] The peptide-branched thiol intermediate was dissolved in 500 μM dimethylformamide (DMF; Deoksan Chemical Co., Ltd., South Korea) and mixed with a DMF solution of 2'-maleimide-PTX (5 mM; 10 equivalents) and 0.1% by volume of N,N-diisopropylethylamine (DIPEA; Deoksan Chemical Co., Ltd.). The mixture was stirred at room temperature for 30 minutes and then purified by HPLC (Shimadzu Corporation). After HPLC purification, the molecular weight of AGM-330-PTX was determined using MALDI-TOF MS (Shimadzu Corporation).

[0183] Examples 1-6: Serum stability test

[0184] Peptide stock solutions (100 μM) were diluted 10-fold with preheated 100% human serum (Sigma-Aldrich) and incubated at 37°C for 0, 3, 6, 9, and 24 hours. Peptides in PBS served as controls. Incubation was stopped by denaturing serum proteins with urea at a final concentration of 3 M for 10 minutes at 4°C, followed by precipitation of serum proteins with trichloroacetic acid at a final concentration of 7% (volume ratio) (4°C, 10 minutes) followed by centrifugation (17,000 x g, 10 minutes). The supernatant of each sample was recovered and run on an analytical column with a linear gradient of 5-65% solvent B (90% (volume ratio) acetonitrile and 0.045% (volume ratio) TFA in water) in solvent A (0.05% (volume ratio) TFA in water) at a flow rate of 1 ml / min for 25 minutes and monitored at 215 nm. Starting at time 0, the elution profile of each peptide was identified by the PBS sample. The percentage of peptide remaining in the serum-treated samples was determined by comparing the height of the peptide peak obtained at each time point with the height of the peptide peak obtained at time point 0. Each experiment was performed three times.

[0185] Example 1-7: Flow cytometry analysis

[0186] Fluorescence activated cell sorting (FACS) analysis was used to examine the binding of FITC-labeled peptides (FITC-peptides). FITC peptide stock solutions (100 μM) were prepared by dissolving the peptides in PBS. MCF-10A, MCF-7, MDA-MB-231, CCD-18Co, HT-29, and HCT-116 cells were seeded into 6-well plates at 10 cells per well. 5 Cells were plated with 3 ml of culture medium per well and the plates were incubated overnight at 37°C. The next day, the culture medium was replaced with fresh FBS-free culture medium (1 ml) containing FITC peptide (1 μM) and incubated at 37°C for a further 30 minutes. Thereafter, the culture medium was removed and the cells were washed with cold PBS to remove any residual peptide. Thereafter, the culture medium was removed and the cells were washed with cold PBS to remove any residual peptide. Sufficient trypsin / EDTA was added to each well and then incubated at 37°C for 3 to 5 minutes. Culture medium was immediately added to neutralize trypsin / EDTA and the cell suspension was transferred to a centrifuge tube. The cells were separated and washed twice with PBS. The control cells were treated similarly but without the use of peptide. The prepared cells were analyzed using a FACScanto II (BD Biosciences, USA) flow cytometer. FACS data were analyzed using FlowJo (TreeStar).

[0187] Example 1-8: Biotin pull-down experiment

[0188] Cell lysates (500 μg / ml) were incubated with biotinylated AGM-330 (500 ng / ml) at 4°C for 12 hours, followed by a 1-hour pull-down assay using streptavidin beads (Thermo Fisher Scientific, Rockford, IL, USA) at room temperature. Following incubation, the beads were washed three times with wash buffer. Elution buffer was then added to the beads, and proteins were extracted from the beads and analyzed by SDS-PAGE. To identify and characterize the proteins obtained in the biotin pull-down assay, LC-coupled ESI-MS / MS analysis was performed at ProteomeTech (Seoul, South Korea).

[0189] Example 1-9: Identification of AGM-330 Binding Domain

[0190] NCL constructs, including GFP-NCL (residues 1-710), GFP-ΔN-NCL (residues 322-710), and GFP-ΔC-NCL (residues 1-321), were generated from a human NCL cDNA clone (Addgene) and subcloned into the XhoI and BamHI sites of the pEGFP-C2 vector (Addgene). These vectors were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's recommendations. Biotinylated AGM-330 peptide was added to streptavidin beads (Thermo Fisher Scientific), and the mixture was incubated with shaking at room temperature for 1 hour. The beads were washed three times with wash buffer. After washing, the beads were added to a lysate (300 μl) prepared from transfected cell lysates containing GFP-tagged NCL protein. The reaction mixture was incubated at 4°C for 12 hours to allow binding of AGM-330 and GFP-tagged NCL protein. The beads were then washed with wash buffer. An equal volume of 2X electrophoresis sample buffer was then added to the beads, and proteins were extracted from the beads by heating at 95°C for 5 minutes. Proteins were then analyzed by SDS-PAGE and immunoblotting.

[0191] Example 1-10: Purification of NCL from Jurkat cells

[0192] 1.0 x 10 cells were lysed by lysing in the following reagents at 4 °C for 1 hour 9NCL was prepared from 100 Jurkat cells using 25 ml of 20 mM Tris / HCl, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 5 mM β-mercaptoethanol, 0.5% (v / v) Triton X-100, 1 mM Marimastat (AdooQ Bioscience, Irvine, CA, USA), and a protease inhibitor cocktail (Millipore, Billerica, MA, USA). Nuclei were pelleted by centrifugation at 1200 x g for 5 minutes, and the supernatant was centrifuged at 12,000 x g for 30 minutes and stored at -80°C. NCL was purified from the nucleus-free extract using a rapid two-step chromatography method. All steps were performed at 4°C using ice-cold buffers and columns containing 1 mM Marimastat and complete protease inhibitor cocktail. The cytosol extract (25 ml) of Jurkat cells was diluted 10-fold with 20 mM sodium phosphate (pH 7.0) and passed through a 5 ml Mono Q 5 / 50 GL column (Sigma-Aldrich). After washing the column with 150 ml of 20 mM sodium phosphate, pH 7.0, the adsorbed protein was eluted with 10 ml of the same buffer containing 1 M NaCl. The eluate was diluted 10-fold with 50 mM Tris / HCl, pH 7.9, 5 mM MgCl2, 0.1 mM EDTA, 1 mM β-mercaptoethanol (buffer A) and loaded onto a 1 ml HiFiQ heparin HP column (Protein Ark, UK) equilibrated with the same buffer. The gel was washed with 20 ml of buffer A containing 0.2 M ammonium sulfate, and the protein was eluted into 50 μl fractions with 2 ml of buffer A containing 0.6 M ammonium sulfate. NCL was collected and dialyzed against PBS containing 1 mM marimastat at 4°C for 2 hours and then stored at -80°C. A further control on a 10% SDS acrylamide gel stained with Coomassie blue confirmed the presence of purified NCL as a single 105 kDa protein band. Two 70 and 50 kDa protein bands were observed, corresponding to partial degradation products of NCL, whose content was less than 10% of the total protein.

[0193] Example 1-11: Binding affinity

[0194] Binding affinity was tested by SPR (surface plasmon resonance) spectroscopy (Biacore T-200). Recombinant nucleolar protein was immobilized on a CM5 sensor chip and treated with various concentrations of AGM-330 (20 nM to 2.5 μM). The sensorgrams of each sample were analyzed to determine the KD value.

[0195] Examples 1-12: Protein separation and Western blot analysis

[0196] Cells were lysed in RIPA buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, and 0.5% Triton X-100) containing a protease inhibitor cocktail (Millipore). Protein concentration was measured using a protein assay kit (Bio-Rad) according to the manufacturer's protocol. Total protein was subjected to SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The blot was detected with primary antibodies against NCL (Abcam) and GFP (Abcam). As loading controls, anti-β-actin antibodies (Santa Cruz Biotechnology), anti-P-cadherin (Abcam), and lamin A / C antibodies (Abcam) were used. Subsequently, the blot was washed in TBST buffer (10 mM Tris-HCl, 50 mM NaCl, and 0.25% Tween-20) and incubated with a horseradish peroxidase-coupled secondary antibody. The presence of target proteins was detected using enhanced chemiluminescence reagent (Thermo Fisher Scientific).

[0197] Example 1-13: Immunofluorescence staining

[0198] MDA-MB-231-luc xenograft tissue was formalin fixed and paraffin embedded for immunofluorescence staining. Cells were seeded on coverslips coated with poly-L-lysine and type I collagen and fixed with 4% formalin. Tissue slides and cells were permeabilized with 0.1% Triton X-100 and blocked with 2% BSA (Sigma-Aldrich). Anti-NCL (1:200), anti-TUNEL (1:200) and anti-Ki-67 (1:500) primary antibodies were used for staining as described above. All cell nuclei were counterstained with DAPI. Immunofluorescence images were matched with H&E staining images.

[0199] Example 1-14: Small interfering RNA (siRNA)-mediated knockdown

[0200] siRNA targeting NCL (NM_005381.3 in the NCBI database) and scrambled siRNA (scr) were purchased from Bioneer (Daejeon, South Korea). For efficient NCL transfection, siRNA transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Three different siRNA sequences were used, and their efficiency was evaluated by real-time PCR.

[0201] siNCL1: (sense strand) 5'-GAGCUAACCCUUAUCUGUA(dTdT)-3' (SEQ ID NO: 21)

[0202] (Antisense strand) 5'-UACAGAUAAGGGUUAGCUC(dTdT)-3' (SEQ ID NO: 22)

[0203] siNCL2: (sense strand) 5'-CACAAGGAAAGAAGACGAA(dTdT)-3' (SEQ ID NO: 23)

[0204] (Antisense strand) 5'-UUCGUCUUCUUUCCUUGUG(dTdT)-3' (SEQ ID NO: 24)

[0205] siNCL3: (sense strand) 5'-GACGAAGUUUGAAUAGCUU(dTdT)-3' (SEQ ID NO: 25)

[0206] (Antisense strand) 5'-AAGCUAUUCAAACUUC GUC(dTdT)-3' (SEQ ID NO: 26)

[0207] The most potent siRNAs were selected based on mRNA levels determined by RT-qPCR analysis, and the resulting protein levels were verified by western blot analysis.

[0208] Example 1-15: Real-time PCR

[0209] Total RNA was extracted using RNAiso (Takara, Shiga, Japan), and RNA purity was verified by measuring the absorbance ratio at 260 / 280. TM The first-strand cDNA was synthesized using the First-Strand cDNA Synthesis Kit (Takara, Shiga, Japan). Each PCR mixture consisted of one-tenth of the cDNA and Power Green PCR Master Mix (Applied Biosystems, USA) was mixed to form a mixture. Real-time PCR was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems, USA). Relative mRNA expression of selected genes was normalized to that of β-actin and quantified using the ddCt method. The sequences of the PCR primers are shown in Table 6 below.

[0210]

Table 6

[0211] Primers sequence SEQ ID NO. NCL(Forward) AAAGTGCCCCAGAACCCACA 27 NCL (reverse) TGGCTGACTTCTCGCATTAGG 28 β-actin (positive) GAGCAATGATCTTGATCTTCA 29 β-actin (reverse) AGATGAGTATGCCTGCCGTG 30

[0212] Example 1-16: Antibody Neutralization Assay

[0213] Cancer cell lines and normal cell lines were cultured at a concentration of 1×10 4 Cells / well were seeded in 96-well plates containing 100 μl of culture medium, and the plates were incubated overnight at 37°C. After overnight incubation, cells were incubated overnight at 37°C for 24 hours in the absence or presence of anti-NCL antibody (Cell Signaling Technology, Beverly, MA, USA). After incubation, cell viability was assessed by the CellVia WST-1 assay (Young In Frontier, Seoul, South Korea) according to the manufacturer's instructions.

[0214] Example 1-17: Cell apoptosis assay (Annexin V)

[0215] The apoptotic cells were quantitatively assessed using the Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit I (BD Biosciences). The cells were collected and washed twice with cold PBS and then resuspended in binding buffer (1 × 10 6 Cells were plated at 4% 4% RI / ml. Next, 100 μl of the suspension was transferred to a tube and mixed with 5 μl of FITC Annexin V and propidium iodide (PI). After gentle vortexing, the mixture was incubated at room temperature in the dark for 15 minutes. Following incubation, 400 μl of 1× binding buffer was added, and the cells were analyzed using a flow cytometer.

[0216] Example 1-18: Cell proliferation assay

[0217] Cancer cells and normal cells (1×10 4 Cells / well) were seeded in 96-well plates. After incubation for 24 hours, cells were treated with increasing concentrations of AGM-330, PTX, and AGM-330-PTX for 48 hours. Cell viability was assessed by CellVia WST-1 assay (Young In Frontier Company) according to the manufacturer's instructions. The number of viable cells was measured at a wavelength of 450 nm using a VersaMax ELISA microplate reader (Molecular Devices Company).

[0218] Example 1-19: Tumorigenesis Experiment

[0219] All animal experiments were performed in accordance with IACUC guidelines (GIST-2019-040). For tumorigenesis experiments, anesthetized 6-week-old female NOD-scidIl2rg - / - Mouse (NPG TM , VITALSTAR Co., Ltd.) were inoculated into the mammary fat pad with 1×10 6MDA-MB-231-luc cells, volume 100 μl (n = 5-6 per group). After inoculation of tumor cells, when the tumor volume reached about 100 mm 3 Mice were randomly divided into the following five groups: (i) control group, (ii) low-dose paclitaxel (2 mg / kg), (iii) high-dose paclitaxel (10 mg / kg), (iv) AGM-330 (16.68 mg / kg or 8.34 mg / kg), and (v) AGM-330-PTX (19.05 mg / kg or 10.71 mg / kg). Tumor size was measured twice a week, and tumor volume was calculated as follows:

[0220] Volume (mm 3 ) = (length (mm)) × (width (mm)) 2 x 0.5.

[0221] For bioluminescence imaging experiments, D-luciferin (150 mg / kg; PerkinElmer) was injected intraperitoneally into each mouse and bioluminescence was monitored using an IVIS100 imaging system (Xenogen, Alameda, California, USA). Mice were anesthetized with vaporized isoflurane (BK Pharm, Ilsan, South Korea) and placed in an imaging chamber. After 10 minutes, each animal was imaged with an exposure time of 1 minute. All bioluminescence image data were provided by Living Image software (version 4.5.2, PerkinElmer). Photons detected from the tumor were converted to average radiation values ​​(photons / second / cm 2 / sr), and the average radiance value is the quantitative data obtained from the intensity region (ROI), including the photons emitted from the luminescent cells within the specified rectangular area of ​​the whole body of each mouse.

[0222] Example 1-20: Bioinformatics

[0223] The Oncomine Cancer Microarray database (http: / / www.oncomine.org / ) was used to analyze the expression levels of NCLs in normal breast and colon tissues, as well as breast and colon adenocarcinoma tissues. These gene expression data were log2-transformed and median-centered. All graphs and statistical values ​​were analyzed using GraphPad Prism 5.0, and P values ​​(P < 0.05) were calculated using a two-tailed Student's t-test. Kaplan-Meier plots were generated using the R2 platform, and patients were grouped according to NCL expression levels in breast and colon tumors.

[0224] Example 1-21: Statistical Analysis

[0225] All statistical data are expressed as mean ± SD (n = 3). Statistical comparisons between two groups were determined by Student's t-test, and comparisons between multiple groups were determined by one-way analysis of variance with Dunnett's multiple comparisons. For in vivo experiments, the number of mice is indicated in each figure legend. Kaplan-Meier analysis was performed using the log-rank test. *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively.

[0226] Example 2: Identification and characterization of cancer-targeting peptide ligands by OBOC combined screening and MAP synthesis

[0227] To identify novel cancer-specific peptide ligands, the present inventors used 5 g of Tentagel MB NH2 resin (200 μm, 520,000 beads / g; Figure 3 ) synthesized a library of approximately 2,600,000 peptides. The peptide library on beads (50,000 to 100,000 beads were used at a time) was mixed with a human breast cancer cell line (MDA-MB-231). A total of approximately 1,000,000 beads were screened, and 8 positive beads were detected and isolated for microsequencing. Three of these 8 peptides (AGM-330, AGM-331, and AGM-332) showed strong preferential binding to MDA-MB-231 and showed no or only weak binding to the human normal breast cell line MCF-10A ( Figure 4 A and Figure 4 B). Then, the three peptides were labeled with fluorescein isothiocyanate (FITC) and their ability to bind to MDA-MB-231 cells was determined. Compared with AGM-331 and AGM-332, AGM-330 detected the strongest fluorescence signal ( Figure 4 C). To confirm the screening results from the on-bead cell growth assay and fluorescence imaging, AGM-330 was resynthesized on Tentagel MB NH2 resin. The on-bead cell growth assay showed that AGM-330 beads were completely covered by human breast cancer cell lines (MCF7 and MDA-MB-231) and human colon cancer cell lines (HT-29 and HCT-116) within 15 minutes ( Figure 4 D) In ​​contrast, AGM-331 and AGM-332 were relatively nonspecific, binding to the human normal breast cell line MCF-10A and the human normal colon cell line CCD-18Co. Furthermore, AGM-330 bound very weakly or not at all to MCF-10A or CCD-18Co cells, making them excellent candidates for imaging and therapeutic targeting agents.

[0228] To date, the use of peptides as therapeutic drugs has been largely limited by their low stability: peptides are primarily degraded in vivo by proteases and peptidases (Bottger R et al., PLoS One. 2017;12:e0178943). In the present invention, in order to improve the stability of peptide ligands, AGM-330 was synthesized in the form of a MAP dendrimer, which exhibits enhanced stability due to acquired resistance to protease and peptidase activity. Synthesis of AGM-330 ( Figure 4 E) Starting from Fmoc-Cys(Trt) Wang resin (1) and Fmoc-Lys(Fmoc)-OH in the presence of 20% piperidine and DMF, lysine core coupled Wang resins (2, 3) were provided. Fmoc and Trt protected AGM-330 (4) was then generated by treatment with RHGAMVYLK-PEG12-OH in the presence of 20% piperidine. The Fmoc and Trt protecting groups in AGM-330 (4) were rapidly removed using piperidine in DMF to generate AGM-330 (5).

[0229] To enhance the in vivo stability and binding affinity of the selected peptide ligand AGM-330, it was synthesized into dimer and tetramer forms by MAP (multiple antigenic peptide) synthesis method.

[0230] In order to evaluate whether the stability of the peptide is enhanced, the in vivo half-life of the peptide was analyzed. 2 mg / kg of AGM-330m, AGM-330d or AGM-330t was injected into the tail vein of C57BL / 6 mice, and the remaining peptide portion in the serum was immediately fixed on the ELISA plate with anti-AGM-330 antibody. The absorbance was measured at a wavelength of 450 nm using a VersaMax ELISA microplate reader (Molecular Devices), and the pharmacokinetics were analyzed using the phoenix WinNonlin 8.1 (Pharsight, Mountain View, California, USA) program. The analysis results showed that the half-life (T 1 / 2 ) were 0.42±0.33 hours, 1.82±0.36 hours and 9.43±1.21 hours, respectively, and the maximum concentration time (T max ) are both 0.167 hours. Maximum blood concentration (C max ) were 1.27±0.12μg / mL, 1.71±0.11μg / mL and 1.875±0.67μg / mL, and the area under the curve (AUC) were 0.64±0.09μg / h / mL, 1.77±0.12μg / h / mL and 21.42±0.81μg / h / mL ( Figure 5The results confirmed that the tetrameric AGM-330 (AGM-330t) has higher stability than the monomeric or dimeric peptides.

[0231] Subsequently, to examine whether MAP ligands can selectively bind to cancer cells, cancer cells treated with FITC-labeled AGM-330 (AGM-330-FITC) were compared with untreated cells. 5 ) were incubated in serum-free medium at 37°C for 2 hours to keep the conjugate intact. The intrinsic fluorescence of the peptide-treated cells was then compared and measured based on the change in mean fluorescence intensity (MFI) value compared to untreated cells. Figure 4 F). The results show that AGM-330-FITC exhibits significant cancer cell binding to MCF-7, MDA-MB-231, HT-29, and HCT-116, as evidenced by an increase in MFI in treated cells relative to untreated cells. In contrast, after 2 hours of incubation, the binding of the conjugate to normal cells (including MCF-10A and CCD-18Co) was significantly reduced compared to the binding of the conjugate to cancer cells.

[0232] To examine whether AGM-330 has cytotoxicity, the present inventors evaluated the IC 50 IC values ​​for AGM-330t and AGM-330d 50 The values ​​were greater than 100 μM in all cell lines ( Figure 6 ). This suggests that AGM-330 does not significantly affect the cellular viability of cancer and normal cell lines. In summary, these data suggest that AGM-330 can be used to target cancer cells without affecting the viability of target cells.

[0233] Example 3: NCL - a potent regulator of cancer cell growth - is a potential target for AGM-330

[0234] To identify unknown target proteins of AGM-330, affinity column chromatography and mass spectrometry-based proteomics were used to identify AGM-330 interacting proteins from cell lysates of MDA-MB-231 cells ( Figure 7 A). After affinity column chromatography, SDS-PAGE analysis revealed several distinct protein bands (ranging from 55 to 100 kDa) that were present only in the elution fractions ( Figure 7Six proteins were identified using LC-MS / MS analysis, and peptide identification of these excised bands revealed that one of the major protein bands at 100 kDa was characterized as nucleolin (NCL). NCL is composed of 710 amino acids, and 22 different peptide fragments identified by LC-MS / MS analysis matched the amino acid sequence of NCL (total score 881, 24% sequence coverage of human NCL in the NCBI database (accession number: gi189306; Figure 7 C and Figure 7 D). In addition, immunoblotting analysis using anti-NCL antibody further confirmed the enrichment of NCL in the eluate of AGM-330 affinity column ( Figure 7 E). Therefore, the proteomic results indicate that NCL is an interacting protein of AGM-330.

[0235] In order to examine the binding affinity of AGM-330 to NCL, SPR (surface plasmon resonance) assay was performed using AGM-330. Figure 8 As shown, the Kd value was confirmed to be approximately 57.7 nM, indicating that AGM-330 has a very high binding affinity for NCL.

[0236] To investigate the domains involved in the interaction between AGM-330 and NCL, the present inventors used a biotin pull-down assay. Biotinylated AGM-330 (AGM-330-biotin) was used as bait to pull down NCL mutants. Several deletion mutants of NCL were generated. Cell extracts were prepared from HEK293T cells transfected with expression vectors encoding wild-type NCL and various NCL mutants, including NCL1 (1-710), NCL2 (323-710), and NCL3 (1-322), all fused to GFP. AGM-330-biotin pulled down wild-type NCL1 (1-710) and NCL3 (1-322) but not NCL3 (323-710) ( Figure 7 F). These results indicate that the N-terminal region (1-322) of NCL is important for its binding to AGM-330. To further confirm the direct interaction between AGM-330 and NCL, a biotin pull-down experiment was performed using purified NCL and AGM-330-biotin. Immunoblot analysis using anti-NCL antibody showed that NCL was enriched in the elution fraction ( Figure 9 ).

[0237] Taken together, these results indicate that AGM-330 directly interacts with NCL.

[0238] Example 4: Identification of amino acid residues necessary for the interaction between AGM-330 and NCL

[0239] Cancer cells (1×10 4 Cells were cultured in 96-well plates for 24 hours. AGM-330 and the 12 polyethylene glycol (PEGylated) peptides shown in Table 2 were biotin-coupled, and the cells were treated with increasing concentrations of the 13 peptides for 2 hours.

[0240] Next, avidin-HRP is attached via a high-affinity avidin-biotin interaction, and the TMB substrate is converted to blue by the HRP enzyme. The reaction is then stopped by adding acid, and the affinity of the 13 peptides is assessed by ELISA by reading the wells at 450 nm.

[0241] Figure 10 The absorbance of 13 PEGylated peptides is shown. Four peptides, SEQ ID NOs: 9, 10, 11, and 14, exhibited absorbance similar to that of AGM-330. Furthermore, four peptides, SEQ ID NOs: 12, 13, 15, and 20, exhibited higher absorbance than AGM-330. Substitution of the methionine residue at position (M5) with leucine or norleucine, substitution of the tyrosine residue at position 7 (Y7) with phenylalanine, and insertion of repeated leucine (L) and lysine (K) residues at the C-terminus increased binding affinity. This suggests that substitution of the M5 and Y7 residues with hydrophobic amino acids or insertion of L and K at the C-terminus can increase binding affinity.

[0242] However, the peptides of SEQ ID NOs: 16 to 19 showed lower absorbance than AGM-330. Deletion of the arginine at position 1 (R1) and the histidine at position 2 (H2), insertion of repeated arginine (R) and histidine (H) residues at the N-terminus, and inverted sequences reduced binding affinity. This suggests that the directionality of the sequence, including R1 and H2, should be retained.

[0243] Example 5: AGM-330 specifically binds to cancer cells in vitro and in vivo

[0244] The present inventors evaluated the specificity of AGM-330 for NCL by cell binding assays for different cell lines using fluorescence microscopy. The experiment was performed using a variety of cancer cell lines (MCF-7, MDA-MB-231, HT-29, and HCT-116) as well as normal cell lines (MCF-10A and CCD-18Co). After incubating the cells with 5 μmol / l AGM-330-FITC for 1 hour, the binding specificity was determined by confocal imaging. The cells were incubated with DAPI to counterstain the nuclei (blue fluorescence). Double immunofluorescence staining with an anti-NCL antibody that binds to the N-terminal domain of NCL and AGM-330-FITC revealed an overlap between NCL and AGM-330-FITC, indicating that AGM-330 binds to NCL ( Figure 11 A and Figure 11 B).

[0245] Next, the relative amount and intracellular localization of NCL in MCF-7, MDA-MB-231, and MCF-10A cells were determined to determine whether differences in NCL expression levels or localization were associated with the sensitivity of cancer cells to AGM-330. The present inventors isolated subcellular fractions of the cells and analyzed the expression of NCL in cytoplasmic, nuclear, and cell membrane extracts, as well as total NCL in the cells, by Western blotting. The results of this analysis showed that NCL expression in cell membrane and cytoplasmic extracts of MCF-7, MDA-MB-231, HT-29, and HCT-116 cells was elevated compared to that observed in MCF-10A and CCD-18Co cells ( Figure 11 C and Figure 12 A) No significant differences in the nuclear levels of NCL were observed in all cell lines.

[0246] To investigate whether membrane-expressed NCL is essential for AGM-330 binding to cancer cells, we used specific targeted siRNAs to knock down NCL. Three siRNAs targeting NCL (siNCL1, siNCL2, and siNCL3) demonstrated different efficacy in NCL knockdown cells. Because siNCL1 exhibited the highest knockdown efficacy in MDA-MB-231 cells, it was selected for further use. Figure 12 B). Next, to confirm whether NCL expression at the cancer cell membrane was reduced after siNCL1 treatment, the present inventors isolated subcellular fractions of siNCL1-treated cells and analyzed NCL expression in cytoplasmic, nuclear, and cell membrane extracts by immunoblotting. The results showed that siNCL1 treatment effectively inhibited the basal expression of NCL in the cytoplasmic and cell membrane fractions ( Figure 11 D). After studying the expression levels of NCL, the present inventors confirmed that reduced expression of membrane NCL affects AGM-330 binding. The results showed that cells treated with scrambled siRNA showed a fluorescence signal similar to that of the control group. However, due to reduced AGM-330 binding, little or no fluorescence signal was detected in the group treated with siNCL1 ( Figure 11 E). Fluorescence imaging results showed that anti-NCL antibody bound to cancer cell membranes and AGM-330-FITC co-localized with anti-NCL antibody fluorescence ( Figure 11 A and Figure 11 B). In addition, mutant analysis revealed that the N-terminal domain of NCL is responsible for the interaction between NCL and AGM-330 ( Figure 7 F) These results indicate that AGM-330 directly interacts with NCL expressed in cancer cell membranes.

[0247] Next, a human breast cancer xenograft model was used to evaluate the cancer targeting properties of AGM-330 by in vivo imaging ( Figure 11 F). To examine whether AGM-330 can selectively target cancer cells in vivo, tumor-bearing mice treated with Alexa680-labeled AGM-330 (AGM-330-Alexa680) were compared with mice treated with Aleax680 alone. The near-infrared fluorescence (NIRF) intensity of tumors 1 hour after AGM-330-Alexa680 treatment was significantly higher than that observed in tumors from the control group: 3.04×10 7 ±1.38 10 6 Compared with 1.19×10 9 ±1.90 10 7 (photons / second / cm 2 / sr) / (μW / cm 2 ), corresponding to the control group and AGM-330-Alexa680-treated tumors, respectively; n=3, P<0.001 ( Figure 11 G to Figure 11 I). In addition, the percentage of the injected dose of AGM-330-Alexa680 and Alexa680 alone in the tumor and other major internal organs after 2 hours was analyzed to quantitatively examine the effect of AGM-330 on the distribution of conjugate fluorescence. The total NIRF photon counts per gram per organ from tumor tissue (except kidney and liver) were significantly higher than those observed in other organs, providing clear evidence that the tumor targeting properties of AGM-330 are far greater than those of the control group. Figure 11 J). In summary, NIRF images showed that AGM-330 accumulated primarily throughout tumor tissues in vivo, rather than in normal organs.

[0248] Example 6: Confirmation of the positive correlation between NCL and cancer progression, and the effect of anti-NCL antibodies on inhibiting cell proliferation through membrane NCL neutralization

[0249] Based on the above examples, the expression pattern of NCL in cancer cell lines was confirmed. Next, to examine the expression of NCL in human cancer tissues, the inventors analyzed available breast and colon cancer datasets using the Oncomine dataset repository (www.oncomine.org). The relative expression of NCL in 144 primary breast tissues and 67 breast cancer tumors was analyzed in the Curtis dataset. Compared with normal breast tissue, NCL mRNA expression was significantly upregulated in breast cancer tumors (P < 0.001, Figure 13A). In addition, in the Alon dataset, the expression of NCL mRNA in colon cancer was significantly higher than that in normal tissues (P<0.01, Figure 13 A). Next, the present inventors confirmed that, in patients with breast cancer and colon cancer, high NCL expression is associated with poor prognosis, such as low disease-free survival (Bertucci and Sveen dataset from "R2: Genomics Analysis and Visualization platform (http: / / r2.amc.nl)") Figure 13 B), which is consistent with previous reports showing high NCL expression as a poor prognostic marker for patients with breast and colon cancer (van Long FN et al., Cancers. 2018; 10:390). To determine the distribution of NCL expression in human cancer and normal tissues, the present inventors analyzed NCL expression by immunohistochemistry (IHC) analysis. Figure 11 A and Figure 11 B) and Western blot ( Figure 11 C), IHC results showed that NCL levels were also increased in the cell membrane and cytoplasmic regions of human breast and colon cancer tissues compared with those observed in normal breast and colon tissues ( Figure 13 C and Figure 13 D). In addition, previous reports have shown that elevated membrane NCL interacts as a receptor for ligands involved in cancer proliferation and inhibition of apoptosis (Chen SC et al., Oncotarget. 2015; 6: 16253-70). Therefore, in order to examine whether membrane-expressed NCL is crucial for regulating the function of cancer cells, the present inventors used monoclonal anti-NCL antibodies to neutralize membrane-expressed NCL in MDA-MB-231 and HCT-116 cells as well as MCF-10A and CCD-18Co cells in vitro. First, cell viability was assessed in normal cells and cancer cells treated with different concentrations of antibodies for 24 hours. Compared with the control group and IgG-treated group, treatment with NCL antibody (50 μg / ml) resulted in a 35% and 32% decrease in cell viability of MDA-MB-231 and HCT-116 cells, respectively, but no significant decrease was observed in normal cells (MCF-10a and CCD-18Co) ( Figure 13 E to Figure 13 H). In addition, apoptosis assays were performed to investigate the cause of the cytotoxic effects of anti-NCL antibodies on cancer cells. MDA-MB-231 and HCT-116 cells were treated with different concentrations of antibodies and stained with Annexin V and PI 24 hours later. Flow cytometry results showed that the increase in the percentage of cancer cells in the early and late apoptotic stages was dose-dependent ( Figure 13I).

[0250] The present inventors have demonstrated that NCL is overexpressed in the cell membrane and cytoplasm of various cancer types, and that NCL overexpression is associated with poor survival outcomes in cancer patients. These results demonstrate the important role of the membrane portion of NCL in cancer cells, particularly in controlling cancer cell proliferation and apoptosis. Taken together, these results suggest that NCL plays a crucial role in cancer growth and that targeting membrane NCL may be a promising biomarker for cancer treatment with chemotherapeutic agents.

[0251] Example 7: Confirmation of the effect of paclitaxel-conjugated AGM-330 on inhibiting cancer growth in vitro and in mouse xenograft models

[0252] Paclitaxel (PTX) was coupled to AGM-330 (AGM-330-PTX) to obtain a cancer targeting ligand linked to a recognized chemotherapeutic agent. PTX is suitable for orthogonal conjugation with a maleimide-carboxyl bifunctional linker. To examine whether AGM-330-PTX inhibits cancer cell proliferation, the present inventors evaluated its IC in various cancer cell lines (including MCF-7, MDA-MB-231, HT-29 and HCT-116 cells). 50 value( Figure 14 A) IC of PTX alone and AGM-330t-PTX in MDA-MB-231 cells. 50 The values ​​were 6.8 and 3.6 μM, respectively.

[0253] After performing in vitro proliferation analysis on cancer cell lines, the inventors investigated whether AGM-330t-PTX could be used as a potential in vivo therapeutic agent. MDA-MB-231-luc cells were inoculated into the mammary fat pad of NPG mice. When subcutaneous tumors grew to 100 mm 3 Afterwards, the animals were divided into five groups (n=5 / group) for comparative efficacy study, and the animals were injected with vehicle (PBS), AGM-330t (16.68 mg / kg), PTX (2 or 10 mg / kg), or AGM-330t-PTX (19.05 mg / kg) via tail vein twice a week ( Figure 14 B). Tumor growth was monitored by measuring tumor volume twice weekly using a caliper over the course of 3 weeks. Consistent with the in vitro experiments, there was no significant difference in mean tumor volume between mice treated with vehicle (PBS) and mice treated with AGM-330. However, compared to the tumor volume of animals treated with the same dose of PTX (1671 ± 199 mm for 2 mg / kg), the mean tumor volume was significantly higher in the control group (PTX = 0.05). 3, n = 5, P < 0.001), the average tumor volume of mice treated with AGM-330t-PTX was reduced by about 52% (807 ± 90 mm2 for 19.05 mg / kg). 3 In addition, on day 21, mice treated with PTX at a 5-fold increased dose (988 ± 78 mm 3 , 10 mg / kg, n=5, P<0.05), mice treated with AGM-330t-PTX showed enhanced efficacy ( Figure 14 C and Figure 14 D). Consistent with the above results, the average tumor weight of mice injected with AGM-330t-PTX was significantly reduced (1.3±0.1 g for 19.05 mg / kg, n=5) compared with the average tumor weight of mice injected with PTX (2.1±0.4 and 1.5±0.1 g for 2 mg / kg and 10 mg / kg treatment groups, respectively; n=5) ( Figure 14 E).

[0254] The present inventors also performed histological staining on the resected tumors and had the slides evaluated by an independent pathologist. The median tumors resected from AGM-330t-PTX-treated mice showed a decrease in the number of cancer cells and an increase in apoptotic nuclei as demonstrated by H&E staining, Ki-67, and TUNEL assays, respectively. Figure 14 F to Figure 14 1). In contrast, tumors treated with vehicle (PBS) and AGM-330t contained more tumor cells and showed little evidence of apoptosis. In addition, mouse body weight was not affected by AGM-330t-PTX administration compared to vehicle (PBS) administration, and blood chemistry analysis showed no signs of adverse toxicity in AGM-330t-PTX-treated mice ( Figure 15 A to Figure 15 F). Therefore, these findings indicate that the tumor-specificity of AGM-330 can enhance the efficacy of PTX without detectable side effects. The results indicate that AGM-330 according to the present invention can be used as a potential therapeutic drug carrier for cancer treatment.

[0255] In addition, to reduce the impact of PEGylation immunogenicity, the present inventors tested the anticancer efficacy using AGM-330d-PTX, which has a lower degree of PEGylation than AGM-330t ( Figure 16 A). The results showed that mice treated with AGM-330d-PTX exhibited significantly reduced luciferase activity compared to that observed in PTX-treated mice ( Figure 16 C and Figure 16D). In addition, AGM-330d-PTX treatment resulted in a significant reduction in tumor volume and weight compared to that observed in the PTX-treated group ( Figure 16 E to Figure 16 G). Consistent with the results obtained with AGM-330-PTX, mouse body weight was not affected by AGM-330d-PTX administration compared to that observed in vehicle (PBS)-treated mice ( Figure 16 H) The cancer specificity of AGM-330d may enhance the efficacy of PTX and increase the concentration of therapeutic drugs in tumor tissues.

[0256] Example 8: Synthesis of AGM-330 and CPP fusion peptide

[0257] In order to increase the cell-penetrating ability of AGM-330, a fusion protein was generated by fusing it with a cell-penetrating peptide (CPP).

[0258] When AGM-330t reacts with maleimide-coupled CPP (RIMRILRILKLAR; SEQ ID NO: 48) at pH 7.0 to 7.5, the functional group of AGM-330t, the thiol group, is coupled to AGM-330t via the thiol-maleimide reaction, thereby synthesizing the AGM-330t-mCPP fusion peptide ( Figure 17 ).

[0259] HPLC and MS analyses of the produced AGM-330t-mCPP fusion peptide confirmed that the fusion protein had a retention time (RT) of 23.2 minutes and a molecular weight of 7,876 Da. Figure 18 The results of the analysis of the fusion peptide are shown, as well as the results of the analysis of AGM-330t and maleimide-mCPP.

[0260] Example 9: Cytotoxicity Evaluation of Fusion Peptides Combining AGM-330 and CPP

[0261] To test the cytotoxicity of the AGM-330t-mCPP fusion peptide produced in Example 8, the present inventors evaluated its IC in various cancer cell lines (including MCF-7, MDA-MB-231, HT-29, HCT-116 and PANC-1) and a normal cell line (CCD-18Co). 50 Values ​​(Table 7).

[0262]

Table 7

[0263] Cell type cell lines <![CDATA[IC 50 (μM)]]> Human breast cancer cell lines MCF-7 7.173 Human breast cancer cell lines MDA-MB-231 >20 Human colon cancer cell lines HT-29 7.829 Human colon cancer cell lines HCT-116 4.714 Human pancreatic cancer cell lines PANC-1 >20 Normal human colon cell line CCD-18Co >20

[0264] IC of AGM-330t-mCPP fusion peptide against colon cancer cell lines HT-29 and HCT-11650 The IC values ​​were 7.829 and 4.714 μM, respectively, for breast cancer cell lines MCF-7 and MDA-MB-231. 50 The values ​​were 7.173 and more than 20 μM ( Figure 19 ). This means that the AGM-330t-mCPP fusion peptide has a cancer cell-specific inhibitory effect.

[0265] Example 10: In vitro evaluation of the apoptosis-inducing effect of a fusion peptide of AGM-330 and CPP on cancer cells

[0266] In order to study the apoptosis-inducing effect of the AGM-330t-mCPP fusion peptide produced in Example 8, HCT-116, HT-29, and CCD-18Co cells were used and treated with CPP, AGM-330t, and AGM-330t-CPP for 48 hours, and stained with Annexin V and PI, respectively. The results confirmed its cancer cell-specific apoptosis-inducing effect ( Figure 20 Experiments conducted at different concentrations of AGM-330t-mCPP confirmed the concentration-dependency of the growth of apoptosis-promoting proteins ( Figure 21 ).

[0267] Example 11: Evaluation of the combined use of AGM-330 and AGM-330-CPP

[0268] To investigate the cytotoxicity of the AGM-330m-mCPP, AGM-330d-dCPP, and AGM-330t-tCPP fusion peptides produced in Example 8, and their combinations, the present inventors evaluated their IC values ​​in HCT-116, HT-29, MCF-7, and MDA-MB-231 cell lines. 50 value.

[0269] IC values ​​of AGM-330m-mCPP, AGM-330d-dCPP and AGM-330t-tCPP fusion peptides for colon cancer cell line HCT-116 50 The values ​​for HT-29 were 23.3, 5.47 and 3.79 μM, respectively, and for HT-29 were 20.67, 3.75 and 3.3 μM, respectively. In addition, the IC values ​​for the breast cancer cell line MCF-7 were 50 The values ​​were >20, 4.208, and 3.802 μM, respectively, and the IC values ​​for MDA-MB-231 were 50 The values ​​were >20, 3.843 and 3.497 μM ( Figure 22 ). Therefore, it can be confirmed that the AGM-330-CPP fusion peptide has a cancer cell-specific inhibitory effect.

[0270] IC values ​​of the combination of AGM-330m and AGM-330m-mCPP fusion peptide, the combination of AGM-330d and AGM-330d-dCPP fusion peptide, and the combination of AGM-330t and AGM-330t-tCPP fusion peptide against the colon cancer cell line HCT-116 50 The values ​​for HT-29 were 14.3, 4.25 and 3.15 μM, respectively, and for HT-29 were 14.2, 4.76 and 3.05 μM, respectively. In addition, their IC values ​​for the breast cancer cell line MCF-7 were 50 The values ​​were 18.7, 3.416, and 3.309 μM, respectively, and the IC values ​​for MDA-MB-231 were 50 The values ​​were 14.7, 3.662 and 3.258 μM ( Figure 23 ). Therefore, it was confirmed that the combination of AGM-330 and AGM-330-CPP also exhibited a cancer cell-specific inhibitory effect.

[0271] Industrial Applicability

[0272] In the present invention, we have demonstrated that AGM peptide ligands and their variants, screened using the MAP synthesis method and the OBOC combination method, specifically bind to cancer cells, and their conjugates with anticancer agents inhibit cancer growth (in vitro and in vivo). Therefore, NCL-targeting AGM can be effectively used for targeted drug delivery in cancer diagnosis and cancer treatment.

[0273] Although the present invention has been described in detail with reference to specific features, it is obvious to those skilled in the art that this description is only a description of its preferred embodiments and does not limit the scope of the invention. Therefore, the true scope of the present invention will be defined by the appended claims and their equivalents. <110> ANYGEN CO., LTD. <120> Novel nucleolin-binding peptides and their applications <130> PZS2219726-1-GJ <150> KR 2020-0059487 <151> 2020-05-19 <160> 80 <170> KoPatentIn 3.0 <210> 1 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 1 Arg His Gly Ala Met Val Tyr Leu Lys 1 5 <210> 2 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-331 <400> 2 Ala Asp His Arg His Arg Arg Ser Gly 1 5 <210> 3 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-332 <400> 3 Ala Val Ala Arg Ala Arg Arg Arg Arg 1 5 <210> 4 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-333 <400> 4 Arg Phe Leu Lys Asn Lys Lys Ala Arg 1 5 <210> 5 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-334 <400> 5 Arg Trp Leu Lys Asn Lys Lys Ala Arg 1 5 <210> 6 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-335 <400> 6 Phe Gly Arg Leu Lys Lys Pro Leu Lys 1 5 <210> 7 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-336 <400> 7 Lys Arg Arg Arg Arg Glu Arg Ala Gly 1 5 <210> 8 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-337 <400> 8 Lys Arg Arg Arg Lys Ala Pro Thr Asp 1 5 <210> 9 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 9 Lys His Gly Ala Met Val Tyr Leu Lys 1 5 <210> 10 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 10 Arg Arg Gly Ala Met Val Tyr Leu Lys 1 5 <210> 11 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 11 Arg His Gly Leu Met Val Tyr Leu Lys 1 5 <210> 12 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 12 Arg His Gly Ala Leu Val Tyr Leu Lys 1 5 <210> 13 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 13 Arg His Gly Ala Xaa Val Tyr Leu Lys 1 5 <210> 14 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 14 Arg His Gly Ala Met Ala Tyr Leu Lys 1 5 <210> 15 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 15 Arg His Gly Ala Met Val Phe Leu Lys 1 5 <210> 16 <211> 7 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 16 Gly Ala Met Val Tyr Leu Lys 1 5 <210> 17 <211> 11 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 17 Arg His Arg His Gly Ala Met Val Tyr Leu Lys 1 5 10 <210> 18 <211> 13 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 18 Arg His Arg His Arg His Gly Ala Met Val Tyr Leu Lys 1 5 10 <210> 19 <211> 9 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 19 Lys Leu Tyr Val Met Ala Gly His Arg 1 5 <210> 20 <211> 13 <212> PRT <213> Artificial sequence <220> <223> AGM-330 <400> 20 Arg His Gly Ala Met Val Tyr Leu Lys Leu Lys Leu Lys 1 5 10 <210> twenty one <211> 19 <212> RNA <213> Artificial sequence <220> <223> siNCL1 <400> twenty one gagcuaaccc uuaucugua 19 <210> twenty two <211> 19 <212> RNA <213> Artificial sequence <220> <223> siNCL1 <400> twenty two uacagauaag gguuagcuc 19 <210> twenty three <211> 19 <212> RNA <213> Artificial sequence <220> <223> siNCL2 <400> twenty three cacaaggaaa gaagacgaa 19 <210> twenty four <211> 19 <212> RNA <213> Artificial sequence <220> <223> siNCL2 <400> twenty four uucgucuucu uuccuugug 19 <210> 25 <211> 19 <212> RNA <213> Artificial sequence <220> <223> siNCL3 <400> 25 gacgaaguuu gaauagcuu 19 <210> 26 <211> 19 <212> RNA <213> Artificial sequence <220> <223> siNCL3 <400> 26 aagcuauuca aacuucguc 19 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 aaagtgcccc agaacccaca 20 <210> 28 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 tggctgactt ctcgcattag g 21 <210> 29 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 29 gagcaatgat cttgatcttc a 21 <210> 30 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 30 agatgagtat gcctgccgtg 20 <210> 31 <211> 11 <212> PRT <213> Artificial sequence <220> <223> TAT <400> 31 Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 32 <211> 13 <212> PRT <213> Artificial sequence <220> <223> TAT(48-60) <400> 32 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln 1 5 10 <210> 33 <211> 9 <212> PRT <213> Artificial sequence <220> <223> TAT(49-57) <400> 33 Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 <210> 34 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Penetratin <400> 34 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys 1 5 10 15 <210> 35 <211> 8 <212> PRT <213> Artificial sequence <220> <223> R8 <400> 35 Arg Arg Arg Arg Arg Arg Arg Arg 1 5 <210> 36 <211> 13 <212> PRT <213> Artificial sequence <220> <223> R9-TAT <400> 36 Gly Arg Arg Arg Arg Arg Arg Arg Arg Arg Pro Pro Gln 1 5 10 <210> 37 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Pep-1 <400> 37 Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr Glu Trp Ser Gln Pro Lys 1 5 10 15 Lys Lys Arg Lys Val 20 <210> 38 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Hph-1 <400> 38 Tyr Ala Arg Val Arg Arg Arg Gly Pro Arg Arg 1 5 10 <210> 39 <211> 18 <212> PRT <213> Artificial sequence <220> <223> MAP <400> 39 Lys Leu Ala Leu Lys Leu Ala Leu Lys Ala Leu Lys Ala Ala Leu Lys 1 5 10 15 Leu Ala <210> 40 <211> 18 <212> PRT <213> Artificial sequence <220> <223> pVEC <400> 40 Leu Leu Ile Ile Leu Arg Arg Arg Ile Arg Lys Gln Ala His Ala His 1 5 10 15 Ser Lys <210> 41 <211> 27 <212> PRT <213> Artificial sequence <220> <223> MPG <400> 41 Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly 1 5 10 15 Ala Trp Ser Gln Pro Lys Lys Lys Arg Lys Val 20 25 <210> 42 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Transportan <400> 42 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Lys Ile Asn Leu 1 5 10 15 Lys Ala Leu Ala Ala Leu Ala Lys Lys Ile Leu 20 25 <210> 43 <211> 20 <212> PRT <213> artificial sequence <220> <223> gH625 <400> 43 His Gly Leu Ala Ser Thr Leu Thr Arg Trp Ala His Tyr Asn Ala Leu 1 5 10 15 Ile Arg Ala Phe 20 <210> 44 <211> 17 <212> PRT <213> artificial sequence <220> <223> VP22 <400> 44 Asn Ala Lys Thr Arg Arg His Glu Arg Arg Arg Lys Leu Ala Ile Glu 1 5 10 15 Silver <210> 45 <211> 20 <212> PRT <213> artificial sequence <220> <223> DS4 <400> 45 Val Gln Ile Phe Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Leu Ala 1 5 10 15 Arg His Ser Thr 20 <210> 46 <211> 16 <212> PRT <213> artificial sequence <220> <223> DS4-1 <400> 46 Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Leu Ala Arg His Ser Thr 1 5 10 15 <210> 47 <211> 17 <212> PRT <213> artificial sequence <220> <223> DS4-2 <400> 47 Val Gln Ile Phe Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Leu Ala 1 5 10 15 Silver <210> 48 <211> 13 <212> PRT <213> artificial sequence <220> <223> DS4-3 <400> 48 Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 49 <211> 17 <212> PRT <213> artificial sequence <220> <223> KS4 <400> 49 Phe Arg Leu Val Arg Leu Leu Arg Phe Leu Arg Ile Leu Leu Ile Ile 1 5 10 15 Ser <210> 50 <211> 14 <212> PRT <213> Artificial sequence <220> <223> KS4-1 <400> 50 Phe Arg Leu Val Arg Leu Leu Arg Phe Leu Arg Ile Leu Leu 1 5 10 <210> 51 <211> 10 <212> PRT <213> Artificial sequence <220> <223> KS4-2 <400> 51 Arg Leu Val Arg Leu Leu Arg Phe Leu Arg 1 5 10 <210> 52 <211> 3 <212> PRT <213> Artificial sequence <220> <223> N1 <400> 52 Arg Ile Leu 1 <210> 53 <211> 9 <212> PRT <213> Artificial sequence <220> <223> N3 <400> 53 Arg Ile Leu Arg Ile Leu Arg Ile Leu 1 5 <210> 54 <211> 15 <212> PRT <213> Artificial sequence <220> <223> N5 <400> 54 Arg Ile Leu Arg Ile Leu Arg Ile Leu Arg Ile Leu Arg Ile Leu 1 5 10 15 <210> 55 <211> 21 <212> PRT <213> artificial sequence <220> <223> N7 <400> 55 Arg Ile Leu Arg Ile Leu Arg Ile Leu Arg Ile Leu Arg Ile Leu 1 5 10 15 Leo Island Arg Leo Island 20 <210> 56 <211> 13 <212> PRT <213> artificial sequence <220> <223> K3 <400> 56 Arg Ile Phe Trp Val Ile Lys Leu Ala Arg His Phe Ile 1 5 10 <210> 57 <211> 16 <212> PRT <213> artificial sequence <220> <223> 3 <400> 57 Lys Ser Leu Arg Val Leu Arg Val Leu Arg Pro Leu Lys Thr Ile Lys 1 5 10 15 <210> 58 <211> 15 <212> PRT <213> artificial sequence <220> <223> C4 <400> 58 Arg Leu Phe Arg Val Met Arg Leu Val Lys Leu Leu Ser Arg Gly 1 5 10 15 <210> 59 <211> 15 <212> PRT <213> Synthetic sequence <220> <223> S2 <400> 59 Arg Ser Phe Arg Leu Leu Arg Val Phe Lys Leu Ala Lys Ser Trp 1 5 10 15 <210> 60 <211> 22 <212> PRT <213> Synthetic sequence <220> <223> S4 <400> 60 Arg Val Ile Arg Leu Ala Arg Ile Gly Arg Ile Leu Arg Leu Val Lys 1 5 10 15 Gly Ala Lys Gly Ile Arg 20 <210> 61 <211> 13 <212> PRT <213> Synthetic sequence <220> <223> D1 <400> 61 Arg Ala Gly Arg Ile Leu Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 62 <211> 13 <212> PRT <213> Synthetic sequence <220> <223> D2 <400> 62 Arg Ile Met Arg Gly Leu Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 63 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D3 <400> 63 Arg Ile Met Arg Ile Leu Arg Leu Met Lys Leu Ala Arg 1 5 10 <210> 64 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D4 <400> 64 Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Met Phe Arg 1 5 10 <210> 65 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D5 <400> 65 Arg Ile Met Arg Ile Leu Arg Ala Leu Lys Leu Ala Arg 1 5 10 <210> 66 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D6 <400> 66 Arg Ile Met Arg Gly Met Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 67 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> D7 <400> 67 Arg Leu Phe Arg Ile Leu Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 68 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> D8 <400> 68 Arg Ile Met Arg Met Val Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 69 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> D9 <400> 69 Arg Ile Met Arg Ile Leu Arg Leu Val Lys Leu Ala Arg 1 5 10 <210> 70 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> D10 <400> 70 Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Gly Val Arg 1 5 10 <210> 71 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D11 <400> 71 Arg Asn Leu Arg Ile Leu Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 72 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D12 <400> 72 Arg Ile Met Arg Asp Ile Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 73 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D13 <400> 73 Arg Ile Met Arg Ile Leu Arg Glu Leu Lys Leu Ala Arg 1 5 10 <210> 74 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D14 <400> 74 Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Gln Leu Arg 1 5 10 <210> 75 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D15 <400> 75 Arg Ile Met Arg Ile Leu Arg His Met Lys Leu Ala Arg 1 5 10 <210> 76 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D16 <400> 76 Arg Ile Met Arg Ser Val Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 77 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D17 <400> 77 Arg Thr Met Arg Ile Leu Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 78 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D18 <400> 78 Arg Ile Met Arg Tyr Ala Arg Ile Leu Lys Leu Ala Arg 1 5 10 <210> 79 <211> 13 <212> PRT <213> Artificial sequence <220> <223> D19 <400> 79 Arg Ile Met Arg Ile Leu Arg Gln Ile Lys Leu Ala Arg 1 5 10 <210> 80 <211> 13 <212> PRT <213> artificial sequence <220> <223> D20 <400> 80 Arg Ile Met Arg Ile Leu Arg Ile Leu Lys Glu Val Arg 1 5 10

Claims

1. An AGM peptide that specifically binds to nucleolin (NCL), characterized in that The AGM peptide consists of the amino acid sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 9 to SEQ ID NO: 15 and SEQ ID NO:

20.

2. An AGM peptide-PEG conjugate, characterized in that The AGM peptide according to claim 1 is coupled to a polyethylene glycol (PEG) chain.

3. An AGM peptide-PEG-drug conjugate, characterized in that: The method comprises the AGM peptide-PEG conjugate according to claim 2 and a drug.

4. The AGM peptide-PEG-drug conjugate according to claim 3, characterized in that The drug is any one or more selected from the group consisting of the following drugs: taxanes, maytansinoids, auristatins, aminopterin, actinomycin, bleomycin, thalidomide, camptothecin, N8-acetyl spermidine, 1-(2-chloroethyl)-1,2-dimethylsulfonyl hydrazide, esperamicin, etoposide, 6-mercaptopurine, caudatepine, trichothecenes, calicheamicin, methotrexate, vincristine, vinblastine, doxorubicin, melphalan, phenylbutyrate Mustard, duocarmycin, L-asparaginase, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, cisplatin, carboplatin, mitomycin, dacarbazine, procarbazine, topotecan, nitrogen mustard, carboplatin, α-amanitin, 5-fluorouracil, bischloroethyl nitrosourea, irinotecan, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, asparaginase, vinorelbine, pyrrolobenzodiazepine, camoxetine Ting, lomustine, busulfan, trioxan, teniposide, 9-aminocamptothecin, clinator, trimetrexate, mycophenolic acid, thiazofurine, ribavirin, 5-ethynyl-4-carbamoyl-1-β-furanosyl imidazole, deferoxamine, floxuridine, doxifluridine, raltitrexed, cytosine arabinoside, fludarabine, tamoxifen, raloxifene, megestrol acetate, goserelin, leuprorelin acetate, flutamide, bicalutamide, EB1089, CB1093, KH1060, berberine, verteporfin, curcumin, albumin-bound paclitaxel, oxaliplatin, Xeloda and indolecarboxamide, phthalocyanine, tubulysin, photosensitizer Pe4, demethoxyhypocrellin A, interferon-α, interferon-γ, tumor necrosis factor, gemcitabine, Velcade, Revlimid, lovastatin, 1-methyl-4-phenylpyridinium ion, staurosporine, peplomycin, epirubicin, pirarubicin, daunorubicin, mitoxantrone, verapamil, nuclease.

5. A polymer, characterized in that The multimer comprises two or more AGM peptide-PEG conjugates according to claim 2.

6. A polymer-drug conjugate, characterized in that: The polymer-drug conjugate comprises the polymer according to claim 5 and a drug.

7. An AGM peptide-PEG-CPP fusion peptide, characterized in that: Wherein the AGM peptide-PEG conjugate according to claim 2 is fused with a cell penetrating peptide (CPP).

8. The AGM peptide-PEG-CPP fusion peptide according to claim 7, characterized in that: The AGM peptide-PEG conjugate and the cell-penetrating peptide are connected via a linker.

9. A polymer-CPP fusion peptide, characterized in that Wherein the multimer according to claim 5 is fused with a cell-penetrating peptide (CPP).

10. A composition for diagnosing cancer, characterized in that The composition comprises: the AGM peptide according to claim 1, the AGM peptide-PEG conjugate according to claim 2, the AGM peptide-PEG-drug conjugate according to claim 3 or 4, The multimer according to claim 5, the multimer-drug conjugate according to claim 6, the AGM peptide-PEG-CPP fusion peptide according to claim 7 or 8, or the multimer-CPP fusion peptide according to claim 9.

11. A composition comprising the AGM peptide according to claim 1, the AGM peptide-PEG conjugate according to claim 2, the AGM peptide-PEG-drug conjugate according to claim 3 or 4, Use of the multimer according to claim 5, the multimer-drug conjugate according to claim 6, the AGM peptide-PEG-CPP fusion peptide according to claim 7 or 8, or the multimer-CPP fusion peptide composition according to claim 9 in the preparation of a therapeutic agent for preventing or treating cancer, wherein: The cancer overexpresses nucleolin (NCL).

Images