TNF-alpha antagonistic peptides and uses thereof

Abstract

The application belongs to the technical field of polypeptides, and discloses a TNF-alpha antagonistic peptide and application thereof, wherein the amino acid sequence of the TNF-alpha antagonistic peptide is shown as SEQ ID NO:1. The TNF-alpha antagonistic peptide has good stability, and has significant anti-inflammatory, immune-regulating and TNF-alpha antagonistic effects, and can be used for preparing a medicine for treating inflammatory and autoimmune diseases.

Description

Technical Field

[0001] This invention belongs to the field of polypeptide technology, specifically relating to a TNF-α antagonistic peptide and its applications. Background Technology

[0002] Tumor necrosis factor-α (TNF-α) is a pleiotropic cytokine with effects on various cell types. It has been identified as a major regulator of inflammatory responses, involved in physiological and pathological processes such as inflammation, apoptosis, immune homeostasis, and autoimmunity. It participates in the pathogenesis of various inflammatory and autoimmune diseases, including pathogenic microbial infections, rheumatoid arthritis, systemic lupus erythematosus, autoimmune skin diseases (including psoriasis), inflammatory bowel disease (ulcerative colitis), autoimmune hematologic disorders, ankylosing spondylitis, and non-infectious uveitis. The level and duration of TNF-α activity play a crucial role in pathogenic microbial infections and immunophysiology. Elevated serum TNF-α levels are closely related to the pathophysiology of autoimmune diseases; therefore, neutralizing TNF-α has become a major strategy for treating these diseases.

[0003] The TNF-α antagonists already in clinical use mainly include anti-TNF-α antibodies (infliximab) and soluble TNF-α receptors (etanercept). However, the use of these drugs has some limitations, including poor stability, high production costs, and insufficient safety. Therefore, the development of safer and more effective new TNF-α antagonist drugs is urgently needed. Summary of the Invention

[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a TNF-α antagonistic peptide and its applications. The TNF-α antagonistic peptide exhibits good stability and significant anti-inflammatory, immunomodulatory, and TNF-α antagonistic effects, and can be used to prepare drugs for treating inflammatory and autoimmune diseases.

[0005] This invention provides a TNF-α antagonistic peptide, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0006] TPCGLGCKIEKVKQKIKQKIRAKTEAVIGKIRERLG (SEQ ID NO: 1).

[0007] China's vast and diverse natural biological resources are an important source of structurally diverse small-molecule organic compounds. (The flower frog ( ) Microhyla pulchraThe *Avicennia marina*, widely inhabiting southern China, has females averaging 33 mm in length and males averaging 30 mm. This invention discovered a novel TNF-α antagonistic peptide (named MP-CATH) in the skin of the *Avicennia marina*. Testing revealed that the MP-CATH peptide has a molecular weight of 4020.54 Da and an isoelectric point of 10.24. The binding constant (KD) of the MP-CATH peptide to TNF-α is 6.36 e^(-kDa). -6 ± 26.2e -6 M.

[0008] The present invention also provides a nucleic acid molecule that can encode the above-mentioned TNF-α antagonistic peptide.

[0009] Preferably, the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO: 7.

[0010] 5'-ACTCCCTGCGGACTTGGCTGTAAGATTGAGAAGGTTAAGCAGAAGATTAAGCAGAAGATCAGGGCCAAGACCGAGGCTGTGATCGGGAAGATCCGTGAGCGCTTGGGA-3' (SEQ ID NO: 7).

[0011] This invention constructs a cDNA library of the skin of the flower frog and determines the nucleotide sequence encoding the above-mentioned TNF-α antagonistic peptide through bioinformatics analysis and activity prediction.

[0012] More preferably, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2.

[0013] 5'--3'(SEQ ID NO: 2).

[0014] The present invention also provides a method for preparing the above-mentioned TNF-α antagonistic peptide, which is prepared by any one of the following methods (1)-(3):

[0015] (1) It was isolated from the flower frog or a closely related frog species;

[0016] (2) Chemical synthesis;

[0017] (3) Recombinant expression using the above-mentioned nucleic acid molecules.

[0018] The present invention also provides a biomaterial, which is an expression cassette, a recombinant vector, or a recombinant bacterium, and the biomaterial contains the above-mentioned nucleic acid molecules.

[0019] This invention also provides the application of the above-mentioned TNF-α antagonistic peptide in the preparation of anti-inflammatory drugs.

[0020] This invention also provides the application of the above-mentioned TNF-α antagonistic peptide in the preparation of cosmetics.

[0021] This invention also provides the application of the above-mentioned TNF-α antagonistic peptide in the preparation of food.

[0022] The present invention also provides the use of the above-mentioned TNF-α antagonistic peptide or its modified form / composition in the preparation of medicaments for the treatment / prevention of autoimmune diseases.

[0023] Experiments showed that the above-mentioned TNF-α antagonistic peptides had good therapeutic effects on imiquimod-induced mouse psoriasis models, dextran sulfate sodium (DSS)-induced mouse colitis models, and transgenic mouse models of arthritis with high expression of TNF-α, indicating that the above-mentioned TNF-α antagonistic peptides have the function of treating a variety of autoimmune diseases.

[0024] Preferably, the autoimmune disease includes at least one of rheumatoid arthritis, systemic lupus erythematosus, autoimmune skin diseases (including psoriasis), inflammatory bowel disease (including Crohn's disease and ulcerative colitis), autoimmune hematologic disorders, and non-infectious uveitis.

[0025] Preferably, the modified / composition of the TNF-α antagonist peptide includes polypeptides, truncated forms, analogs, compositions of the TNF-α antagonist peptide, and pharmaceutically acceptable carriers.

[0026] The present invention also provides a medicament comprising the above-described TNF-α antagonistic peptide and pharmaceutically acceptable excipients.

[0027] Preferably, the dosage form of the drug includes tablets, granules, dispersants, capsules, pellets, injections, powder for injection, or aerosols.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] The TNF-α antagonistic peptide (MP-CATH) described in this invention possesses a strong ability to antagonize the binding of TNF-α and its receptor TNFR. By controlling the activity level and duration of free TNF-α, it slows the progression of autoimmune diseases. The TNF-α antagonistic peptide (MP-CATH) has relatively little effect on normal cells and erythrocytes, exhibits minimal changes in secondary structure under high-dose salt concentrations and temperature conditions, and maintains stable pharmacological activity. In particular, the results of this invention show that the TNF-α antagonistic peptide (MP-CATH) demonstrates good therapeutic effects in mouse models of psoriasis, inflammatory bowel disease, and rheumatoid arthritis. Furthermore, the MP-CATH peptide, with its anti-inflammatory and immunomodulatory activities, is suitable for the preparation of food and health products. Attached Figure Description

[0030] Figure 1 The results of HPLC purification and identification of MP-CATH peptide from the flower frog are shown.

[0031] Figure 2 Mass spectrometry identification results of MP-CATH peptide from the flower frog.

[0032] Figure 3 The results of ITC analysis on the binding interaction between MP-CATH peptide and TNF-α in the flower frog.

[0033] Figure 4 The result shows that MP-CATH peptide from the flower frog competitively inhibits the binding of TNF-α to cells; B is the statistical value of the average fluorescence intensity of A, and ### indicates that there is a highly significant difference between the MP-CATH group and the control group. p <0.01); *** indicates a highly significant difference between the mTNF group (1500 pg / mL) and the MP-CATH group ( p <0.01); ** indicates a highly significant difference between the mTNF group (1000 pg / mL) and the MP-CATH group. p <0.01); * indicates a significant difference between the mTNF group (500 pg / mL) and the MP-CATH group. p <0.05; ns indicates that there was no significant difference between the mTNF group (100 pg / mL) and the MP-CATH group ( p >0.05). D is the statistical value of the average fluorescence intensity of C, and *** indicates that there is a highly significant difference between the hTNF group (1000 pg / mL) and the MP-CATH group ( p <0.01); * indicates a significant difference between the hTNF group (200 or 500 pg / mL) and the MP-CATH group. p <0.05; ns indicates that there was no significant difference between the hTNF group (100 pg / mL) and the MP-CATH group ( p >0.05).

[0034] Figure 5 The results show the cytotoxicity of MP-CATH peptide from the flower frog and its antagonism of TNF-α-induced pro-inflammatory cytokine production in macrophages; in Figure A, ns indicates that there was no significant difference between the peptide group and the control group (0 μM). p >0.05). In Figure B, ### indicates a highly significant difference between the TNF-α induced model group and the control group ( p <0.01); *** indicates a highly significant difference between the MP-CATH peptide group and the TNF-α induced model group ( p <0.01); ns indicates that there was no significant difference between the MP-CATH group and the TNF-α induced model group ( p >0.05).

[0035] Figure 6 The effects of MP-CATH peptide from the flower frog on spleen cell proliferation and on the release of the cytokine IL-2 induced by concanavalin A (ConA).

[0036] Figure 7 The PASI score results of the mouse psoriasis model treated with MP-CATH peptide from the flower frog; ### indicates that there was a highly significant difference between the model group and the control group at the peak (3 days). p <0.01); *** indicates a highly significant difference between the experimental group and the model group at the peak ( p <0.01).

[0037] Figure 8 The results show the colon length in a mouse model of inflammatory bowel disease treated with MP-CATH peptide from the flower frog; ## indicates a highly significant difference between the model group and the control group. p <0.01); * indicates a significant difference between the experimental group and the model group ( p <0.05).

[0038] Figure 9 The results of the experiment on joint swelling in a mouse model of rheumatoid arthritis treated with MP-CATH peptide from the flower frog; * indicates a highly significant difference between the experimental group and the control group at the endpoint (21 days). p <0.05); ns indicates that there was no highly significant difference between the polypeptide group and control group 1 ( p >0.05).

[0039] Figure 10 The graph shows the effect of MP-CATH peptide from the flower frog on the hemolytic toxicity of human erythrocytes.

[0040] Figure 11 The results of circular dichroism spectroscopy for MP-CATH peptide from the flower frog after treatment with different salt concentrations and temperatures. Detailed Implementation

[0041] To enable those skilled in the art to more clearly understand the technical solutions described in this invention, the following embodiments are provided for illustration. It should be noted that the following embodiments are merely preferred embodiments of this invention and do not constitute a limitation on the scope of protection claimed by this invention. Any modifications, substitutions, or combinations made without departing from the spirit and principle of this invention are included within the scope of protection of this invention.

[0042] Unless otherwise specified, the raw materials, reagents or devices used in the following examples are available from conventional commercial sources or can be obtained by existing known methods.

[0043] The *Pterocarya stenoptera* used in the following examples is not a protected species and does not require specific permission. It was collected from the countryside of Baiyun District, Guangzhou City, Guangdong Province (23.12). N, 113.28 E); The RAW264.7 cells and Jurkat T cells used were purchased from the Cell Preservation Center of the School of Pharmacy, Southern Medical University.

[0044] Example 1: TNF-α antagonistic peptide (MP-CATH) and its encoding gene

[0045] I. Total RNA extraction from the skin of the Flower Frog:

[0046] Live *Pterocarya stenoptera* frogs were cleaned with water, euthanized, and flash-frozen in liquid nitrogen for 4 hours. Approximately 300 mg of *Pterocarya stenoptera* frog skin tissue was collected and 10 mL of total RNA extraction buffer (Trizol solution, purchased from GIBCOBRL) was added. The mixture was homogenized in a glass homogenizer for 30 minutes. An equal volume of phenol / chloroform solution was added, and the mixture was vigorously mixed. The mixture was incubated at room temperature for 10 minutes, then centrifuged at 4°C and 12,000 rpm for 10 minutes, and the precipitate was discarded. An equal volume of isopropanol was added to the supernatant, and the mixture was incubated at room temperature for 10 minutes, then centrifuged at 4°C and 12,000 rpm for 10 minutes, and the supernatant was discarded. The precipitate was washed once with 75% ethanol, and the dried precipitate was the total RNA from the *Pterocarya stenoptera* frog skin.

[0047] II. Purification of mRNA from the skin of the Flower Frog:

[0048] The total RNA from the skin of the flower frog obtained in step I was isolated and purified using the PolyATtract® mRNA Isolation Systems kit (purchased from PROMEGA). The specific steps are as follows:

[0049] Take 500 μg of total RNA from the skin of the flower frog obtained in step I and dissolve it in 500 μL of DEPC water. Incubate at 65°C for 10 min. Then add 3 μL of biotinylated Oligo (dT) probe and 13 μL of 20×SSC solution (from PolyATtract® mRNA Isolation Systems kit), mix well, and let cool at room temperature. This solution is called solution A.

[0050] Gently tap the magnetic beads (from the PolyATtract® mRNA Isolation Systems kit) to mix, and allow them to adhere to the magnetic rack for 30 seconds. Discard the supernatant. Then add 0.3 mL of 0.5×SSC solution to the magnetic beads, and allow them to adhere to the magnetic rack for 30 seconds. Discard the supernatant. Finally, resuspend the magnetic beads in 0.1 mL of 0.5×SSC solution; this is called solution B.

[0051] Add solution A to solution B and incubate at room temperature for 10 min. After magnetic adsorption for 30 s, discard the supernatant. Wash four times with 0.2 mL of 0.1×SSC solution, discarding the supernatant again. Then, resuspend the precipitate in 0.15 mL of DEPC-treated water and allow it to adsorb on a magnetic rack for 30 s. Transfer the supernatant to a new test tube, which is called solution C. Add another 0.15 mL of DEPC-treated water to the precipitate and resuspend it again, allowing it to adsorb on a magnetic rack for 30 s. Transfer the supernatant to solution C. This mixture is called solution D (solution D contains purified *Agropyron cristatum* skin mRNA).

[0052] Add 1 / 10 volume of 3 M sodium acetate (pH=5.2) and an equal volume of isopropanol to solution D, incubate at -70℃ for 30 min, centrifuge at 4℃ and 12000 rpm for 10 min, discard the supernatant, and dissolve the precipitate in 10 μL of DEPC water to obtain the skin mRNA of the flower frog.

[0053] III. Construction of the cDNA library of the skin of the Flower Frog:

[0054] Using Creator TM SMART TM The cDNA Library Construction Kit (purchased from CLONTECH) was used to synthesize double-stranded cDNA (including steps a and b). The PCR products were extracted and recovered using the Wizard® SV Gel and PCRClean-Up System (purchased from PROMEGA) (including step c). The purified cDNA products were then ligated into the pMD18-T vector using the pMD™818-VcoT Vector Cloning Kit (purchased from Takara). The specific steps are as follows:

[0055] cDNA first-strand synthesis (mRNA reverse transcription): Add 1 μL SMART IV oligonucleotides and 1 μL CDS III / 3' PCR primers (from Creator) to a 0.5 mL sterile centrifuge tube. TM SMART TMThe cDNA Library Construction Kit (plasmid cDNA library construction kit), 1 μL of *Agropyron cristatum* skin mRNA obtained in step II, and 2 μL of deionized water were mixed and centrifuged at 12000 rpm for 15 s, then incubated at 72℃ for 2 min. The centrifuge tube was then incubated on ice for 2 min. Subsequently, 2.0 μL of 5× first-chain buffer, 1.0 μL of 20 mM dithiothreitol, 1.0 μL of 10 mM dNTP mixture, and 1.0 μL of PowerScript reverse transcriptase (from Creator) were added to the centrifuge tube. TM SMART TM (cDNA Library Construction Kit), after mixing, centrifuge at 12000 rpm for 15 s and incubate at 42℃ for 1 h. Place the centrifuge tube on ice to stop the synthesis of the first strand of cDNA. The liquid in the centrifuge tube contains the synthesized first strand of cDNA.

[0056] The second strand was amplified using long-terminated polymerase chain reaction (LD-PCR): the PCR instrument was preheated to 95°C. 2 μL of the first strand of cDNA obtained in step a was mixed with 80 μL of deionized water, 10 μL of 10×Advantage 2 PCR buffer, 2 μL of 50×dNTP mixture, 2 μL of 5' PCR primers, 2 μL of CDS III / 3' PCR primers, and 2 μL of E. coli polymerase (from Creator). TM SMART TM Mix the cDNA Library Construction Kit (plasmid / cDNA library construction kit) thoroughly. Amplify in a PCR instrument according to the following program: 95℃ for 20 s, 95℃ for 5 s, 68℃ for 6 min, for 22 cycles. After the cycles are complete, extract the synthesized double-stranded cDNA from the centrifuge tube.

[0057] Extraction and recovery of PCR products: Add an equal volume of membrane binding buffer (from Wizard® SV Gel and PCR Clean-Up System kit) to the cDNA double strands obtained in step b, mix by inversion, and then transfer the mixture to a centrifuge purification column (from Wizard® SV Gel and PCR Clean-Up System kit). Incubate at room temperature for 5 min to allow the DNA to fully bind to the silica membrane. Centrifuge at 12000 rpm for 30 s and discard the waste liquid in the collection tube. Add 700 μL of membrane elution buffer (containing five volumes of 95% ethanol, from Wizard® SV Gel and PCR Clean-Up System kit) to the centrifuge purification column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid in the collection tube. Repeat the above steps once. Then centrifuge again at 12000 rpm for 5 min, and transfer the centrifuge purification column to a new centrifuge tube. Add 30 μL of ultrapure water to the center of the column, let it stand at room temperature for 5 min, then centrifuge at 12000 rpm for 30 s. The solution at the bottom of the centrifuge tube is the purified cDNA double strand.

[0058] Enzyme digestion, ligation, and transformation of the ligation product: Add 4 μL of the cDNA double strand obtained in step c, 1 μL of the pMD18-T vector, and 5 μL of Solution I (from the pMD™ 818-VcoT Vector Cloning Kit) (total volume 10 μL) to a microcentrifuge tube and incubate at 16°C for 2 h. Add the 10 μL reaction solution to 100 μL of DH5α competent cells, incubate on ice for 30 min, then heat at 42°C for 90 s, and incubate on ice for another 1 min. Subsequently, add 890 μL of preheated LB medium (37°C) to the competent cells and incubate at 37°C with gentle shaking for 60 min. Spread 200 μL of bacterial culture onto Petri dishes containing X-Gal (5-bromo-4-chloro-3-indole-β-D-galactoside), IPTG (isopropyl-β-D-thiogalactoside), and ampicillin (Amp). Incubate at 37°C for 16 h to form single colonies. Wash each Petri dish with 5 mL of LB liquid medium, add 30% glycerol, and freeze for later use.

[0059] The constructed cDNA was tested and found to contain approximately 1 × 10⁻⁶ cDNA. 6 A single clone.

[0060] IV. Screening of skin gene clones in the flower frog:

[0061] The bacterial cDNA library constructed in step III was titrated, and then diluted to appropriate concentrations (approximately 5000 bacteria / mL and 30 bacteria / mL) with LB medium containing 100 μg / mL ampicillin. The 5000 bacteria / mL concentration was used for the first round of screening, and the 30 bacteria / mL concentration was used for the second round of screening. The cDNA was seeded in an 8×8 matrix on 96-well plates (64 wells total, 100 μL per well) and incubated overnight at 37°C.

[0062] Bacterial cultures were combined by row and column, and PCR amplification was performed using the following primer set.

[0063] The nucleotide sequences of the amplification primers are as follows:

[0064] PF1: 5'-AGATGTTSACCWTGAAGAAATC-3' (SEQ ID NO: 3);

[0065] PR1: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-3' (SEQ ID NO: 4);

[0066] Where S=G / C; W=A / T.

[0067] Among them, the primer sequence shown in SEQ ID NO: 3 contains 22 nucleotides, and the primer sequence shown in SEQ ID NO: 4 contains 27 nucleotides (from CLONTECH SMART). TM (3' PCR Primer from the cDNA Library Construction Kit). Amplify according to the following program: 94℃ for 30 s, 50℃ for 45 s, 72℃ for 2.5 min, 35 cycles.

[0068] Cross-positive well bacterial samples proceed to the second round of screening (using the same method as the first round of screening).

[0069] V. MP-CATH peptide gene sequence determination and results:

[0070] Take bacterial samples from wells that showed positive results in the second round of screening in step IV, extract plasmid DNA, and determine the nucleotide sequence using the dideoxy method (using an Applied Biosystems 373A fully automated nucleotide sequencer).

[0071] The sequencing primers were BcaBEST. TM Sequencing Primer RV-M and BcaBEST TM Sequencing Primer M13-47.

[0072] Among them, BcaBEST TM The nucleotide sequence of Sequencing Primer RV-M is: 5'-GAGCGGATAACAATTTCACACAGG-3' (SEQ ID NO: 5);

[0073] BcaBEST TM The nucleotide sequence of Sequencing Primer M13-47 is: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3' (SEQ ID NO: 6).

[0074] The gene sequencing results from the 5' end to the 3' end are shown in SEQ ID NO: 2. The specific sequencing results are as follows:

[0075] 5'--3'(SEQ ID NO: 2).

[0076] The nucleotide sequence of the MP-CATH peptide gene of the flower frog is 599 bases in length.

[0077] Based on the gene sequence of the *Avicennia marina* MP-CATH peptide, the gene encoding the functional mature peptide *Avicennia marina* MP-CATH peptide is nucleotides 400-507 of this sequence (SEQ ID NO: 7), and its nucleotide sequence is as follows: 5'-ACTCCCTGCGGACTTGGCTGTAAGATTGAGAAGGTTAAGCAGAAGATTAAGCAGAAGATCAGGGCCAAGACCGAGGCTGTGATCGGGAAGATCCGTGAGCGCTTGGGA-3' (SEQ ID NO: 7);

[0078] The amino acid sequence obtained by translating the nucleotide sequence shown in SEQ ID NO: 7 is: Thr Pro Cys GlyLeu Gly Cys Lys Ile Glu Lys Val Lys Gln Lys Ile Lys Gln Lys Ile Arg Ala LysThr Glu Ala Val Ile Gly Lys Ile Arg Glu Arg Leu Gly. Its single-letter amino acid sequence is: TPCGLGCKIEKVKQKIKQKIRAKTEAVIGKIRERLG (SEQ ID NO: 1).

[0079] Example 2: Preparation of MP-CATH peptide from the flower frog

[0080] Based on the encoding gene of the *Agropyron cristatum* MP-CATH peptide obtained in Example 1, the peptide was synthesized using an automated peptide synthesizer. The peptide was then desalted and purified by HPLC reversed-phase C18 column chromatography. The disulfide bond formation was achieved using air oxidation, specifically by dissolving the peptide in 0.1% acetic acid solution in a flask, titrating with ammonium hydroxide to pH 7.8, and stirring overnight at room temperature. The peptide was then desalted and purified by HPLC reversed-phase C18 column chromatography. During purification, the aqueous phase consisted of 0.1% TFA + 100% CH3CN, and the organic phase consisted of 0.1% TFA, with an aqueous phase concentration gradient of 27-52% over 25 min. The detection wavelength was 220 nm. The detection results are as follows: Figure 1 As shown.

[0081] Depend on Figure 1 It can be seen that the purified *Agropyron cristatum* MP-CATH peptide appeared at 8.108 min.

[0082] The molecular weight of the purified *Agropyron cristatum* MP-CATH peptide was further determined by fast atom bombardment mass spectrometry (FAB-MS). The substrate was glycerol:m-nitrobenzyl alcohol:dimethyl sulfoxide (1:1:1, V:V:V, volume ratio), with Cs+ as the bombardment particle. The current was 1 μA and the emission voltage was 25 kV. The results are as follows: Figure 2 As shown.

[0083] Depend on Figure 2 As can be seen from the mass spectrometry, the molecular weight of the MP-CATH peptide from the *Agropyron cristatum* in this embodiment of the invention is calculated to be 4020.54 Da.

[0084] The isoelectric point of MP-CATH peptide from the flower frog was further predicted using the ExPASy bioinformatics resource portal (http: / / www.expasy.org / tools / ).

[0085] The isoelectric point of the MP-CATH peptide from the *Agropyron cristatum* in this embodiment of the invention is predicted to be 10.24.

[0086] In summary, the MP-CATH peptide obtained in the embodiments of the present invention is derived from the Chinese amphibian, the Chinese frog, with a molecular weight of 4020.54 Da and an isoelectric point of 10.24.

[0087] Example 3: Binding effect of MP-CATH peptide and TNF-α in the flower frog *Agropyron cristatum*

[0088] The binding capacity of MP-CATH peptide and TNF-α in the flower frog was determined by isothermal titration, and the specific steps are as follows:

[0089] (1) Prepare in advance PBS buffer (pH=6.0) degassed by sonication, human recombinant protein TNF-α (0.1 μM) and the MP-CATH peptide of the flower frog obtained in Example 1 (0.25 mM). Perform a second degassed treatment before loading the sample.

[0090] (2) Load the sample into the sample cell and syringe according to the instrument instructions. Take 40 µL of the MP-CATH peptide of the flower frog prepared in Example 1 and place it in the titration needle, and place 280 µL of human recombinant protein TNF-α in the sample cell.

[0091] (3) Instrument parameters: Set the initial time interval to 60 s, temperature to 25℃, needle rotation speed to 1000 rpm, reference power to 5 μCal / s, and high feedback mode. Titrate 1.0 μL into the reaction cell each time using the needle, with a 60 s interval, for a total of 17 titrations. The ITC instrument will detect the heat change throughout the titration process. The detection results are as follows: Figure 3 As shown.

[0092] Depend on Figure 3 It can be seen that the binding of the MP-CATH peptide from the flower frog to TNF-α leads to a decrease in enthalpy and a downward trend in the ITC curve, indicating that the reaction is exothermic; binding saturation occurs at approximately 11 min, and the binding constant KD is 6.36 e. -6 ± 26.2e -6 This indicates that the MP-CATH peptide from the flower frog can neutralize TNF-α.

[0093] Example 4: Study on the effect of MP-CATH peptide from the flower frog on antagonizing TNF binding to cell surface receptors

[0094] 1. Culture of RAW264.7 and Jurkat T cells

[0095] Mouse peritoneal macrophage line RAW264.7 cells were cultured in DMEM medium (Gibco) containing 100 U / mL penicillin, 0.1 mg / mL streptomycin, and 10% fetal bovine serum at 37°C in a 5% CO2 environment. Human acute T-lymphoblastic leukemia cells (Jurkat T cells) were cultured under the same conditions.

[0096] 2. Cell competition binding assay

[0097] Different concentrations of murine recombinant TNF-α (0, 500, 1000, and 1500 pg / mL) were co-incubated with FITC-labeled *Agropyron cristatum* MP-CATH peptide (10 μM) for 10 min, and then the mixture was directly added to a solution containing 1×10 5 In a centrifuge tube containing RAW264.7 cells; or incubate different concentrations of recombinant human TNF-α (0, 200, 500, and 1000 pg / mL) with FITC-labeled MP-CATH peptide (10 μM) for 10 min, then add the mixture directly to a centrifuge tube containing 1×10 5 Jurkat T cells were placed in centrifuge tubes. The mixture was incubated at 37°C for 5 min, centrifuged, the culture medium was discarded, and the cells were thoroughly washed with PBS and resuspended in 200 μL of PBS for analysis. Fluorescence intensity of all collected cells was measured using a flow cytometer (BD FACSCanto II, USA), and data were processed using FlowJo software. The results are shown below. Figure 4 As shown.

[0098] Depend on Figure 4 As shown in section A, the MP-CATH peptide of the flower frog can antagonize the binding of mouse recombinant TNF-α to mouse macrophages in a concentration-dependent manner. Figure 4 In the diagram, B represents the statistical value of the average fluorescence intensity in A; from... Figure 4 As shown in C, the MP-CATH peptide from the flower frog can antagonize the binding of recombinant human TNF-α to human acute T-lymphoblastic leukemia cells in a concentration-dependent manner. Figure 4 D represents the statistical value of the average fluorescence intensity in C.

[0099] Example 5: Research on the application of MP-CATH peptide from the flower frog in controlling the release of inflammatory factors

[0100] 1. Cytotoxic effects

[0101] RAW264.7 cells were grown at a rate of 2 × 10⁻⁶. 4 Cells were seeded at a density of [number] cells / well in 96-well plates. After overnight culture, cells were treated with different concentrations of MP-CATH peptide (1.25 μM, 2.5 μM, 5 μM, 10 μM, and 20 μM) for 24 h, followed by incubation with CCK8 reagent for another 2 h, and then absorbance was measured at 450 nm. Cell viability % was calculated using the formula: (Sample A - Blank Control A) / (Control A - Blank Control A) × 100%.

[0102] 2. Effects of MP-CATH peptide on TNF-α-induced release of the cytokine IL-6

[0103] RAW264.7 cells were grown at a rate of 2 × 10⁻⁶. 4 Cells were seeded at a density of [number] cells / well in 96-well plates and cultured overnight. Cells were pretreated for 1 h with different concentrations of MP-CATH peptide (2.5, 5, 10, and 20 μM), followed by stimulation with 200 pg / mL mouse recombinant TNF-α for 24 h. Cells without peptide and / or TNF-α were used as negative controls. IL-6 levels were measured using commercial kits (Beyotime Biotechnology, Shanghai, China; Thermo Fisher Scientific Inc., USA) in the supernatant. Absorbance was measured at 450 nm. Experiments were repeated three times.

[0104] Test results as follows Figure 5 As shown. By Figure 5 As shown in section A, 20 μM MP-CATH peptide did not significantly inhibit macrophages, indicating low cytotoxicity to normal cells and relatively safe for drug application. Figure 5 As shown in Figure B, extremely low doses of MP-CATH peptide (2.5 μM) can inhibit the release of cytokine IL-6 from macrophages stimulated by TNF-α, indicating that the peptide can significantly antagonize the recognition of TNF-α and TNFR receptors, and exert anti-inflammatory and immunomodulatory effects.

[0105] Example 6: Study on the immunomodulatory activity of MP-CATH peptide in the flower frog.

[0106] 1. Effects of MP-CATH peptide on spleen cell proliferation

[0107] Spleens were aseptically harvested from female BALB / c mice aged 4-6 weeks. After removing excess tissue adhering to the spleen, spleen cells were dispersed using a 40 μm cell sieve. Red blood cell lysis buffer was added for 2 min, followed by the addition of 8 mL PBS. The cells were then sieved through a 70 μm cell sieve to remove flocculent material. The filtered cell solution was transferred to centrifuge tubes and centrifuged at 1500 rpm for 5 min, discarding the supernatant. Cells were resuspended in 6 mL of RPMI 1640 medium (containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin) and counted. Cells were seeded at a density of 200,000 per well in 96-well plates. The cytotoxicity of MP-CATH peptide to spleen cells was determined using the CCK8 assay. Six hours after cell seeding, different concentrations of MP-CATH peptide (0, 2.5, 5 and 10 μM) were added to the cells in the presence of 0.5 μg / mL ConA. The cells were then incubated at 37°C for 48 hours. After adding CCK8 reagent (Beyotime Biotechnology, Shanghai, China) and incubating for another 2 hours, the absorbance at 450 nm was measured.

[0108] 2. Effects of MP-CATH peptide on ConA-induced release of the cytokine IL-2

[0109] Spleen cells were obtained in the same manner as above. Different concentrations of MP-CATH peptide (0, 2.5, 5 and 10 μM) were treated for 48 h in the presence or absence of 0.5 μg / mL ConA, followed by centrifugation. The supernatant was collected and IL-2 levels were measured using a commercial kit (Thermo Fisher Scientific Inc., USA).

[0110] Test results as follows Figure 6 As shown. By Figure 6 As shown in section A, MP-CATH peptide from the flower frog can inhibit ConA-induced proliferation of mouse spleen cells in a concentration-dependent manner; furthermore, from Figure 6 As shown in Figure B, MP-CATH peptide from the flower frog can inhibit ConA-induced release of the cytokine IL-2 from mouse spleen cells. All of the above demonstrates that the immunomodulatory function of MP-CATH peptide can affect immune cell proliferation and factor release, which is beneficial for its application in the treatment of immune diseases.

[0111] Example 7: Study on the therapeutic effect of MP-CATH peptide from the flower frog on a mouse model of psoriasis.

[0112] Female BALB / c mice aged 8-10 weeks were weighed and randomly divided into groups. Hair was removed from a 3cm x 5cm area on the midline of the mouse's back using a shaver and depilatory cream. The day after hair removal, except for the control group, 62.5mg of imiquimod cream (Licojie) was applied to the back of the other mice. The cream was then spread evenly over the entire bare area using a cotton swab. After the cream was absorbed, the mice were returned to their cages. The control group received an equal amount of petroleum jelly. The MP-CATH peptide treatment group received a subcutaneous injection of 1 mg / kg MP-CATH peptide (dissolved in physiological saline) in the back 6 hours later. The corresponding model group and control group received an equal volume of physiological saline subcutaneously. The modeling and drug administration procedures were repeated for 7 days.

[0113] From the initial modeling date, mice were weighed and scored daily using the PASI scale. Using the color and degree of psoriasis in the hairless area on the back of control mice as a baseline (0), the degree of erythema and psoriasis on the backs of all mice were scored from 0 to 4. Additionally, the skin thickness in the hairless area on the backs of the mice was measured using calipers as a score for skin infiltration. The results are as follows: Figure 7 As shown.

[0114] Depend on Figure 7 It was found that imiquimod cream treatment resulted in erythema and scaling on the backs of mice in the model group, and a significant increase in skin thickness. MP-CATH peptide treatment effectively reversed these skin changes and reduced skin thickness. The PASI psoriasis score results were consistent with these changes in skin appearance.

[0115] Example 8: Study on the therapeutic effect of MP-CATH peptide from the flower frog on a mouse model of inflammatory bowel disease.

[0116] Female BALB / c mice aged 4-6 weeks were weighed and randomly divided into groups. An appropriate amount of DSS (diethylsaturated saline) was weighed and prepared into a 4% DSS aqueous solution (w:v) with ultrapure water, and stored at 4°C protected from light. The aqueous solution in the animal's water bottle was replaced with the DSS aqueous solution, and fresh DSS solution was added every two days. On the 7th day, the DSS solution was replaced with ultrapure water without DSS. After modeling, the animals' condition was continuously observed, and the DAI (Digital Artery Identification) score was used to determine the success of the model. The mice were weighed and their fecal condition was observed daily. The MP-CATH peptide treatment group received an intraperitoneal injection of 1 mg / kg MP-CATH peptide (dissolved in physiological saline) daily starting from day one. The corresponding model group and control group received an equal volume of physiological saline subcutaneously. The modeling and drug administration procedures were repeated for 7 days. The test results are as follows: Figure 8 As shown.

[0117] Depend on Figure 8It was found that mice in the DSS-induced inflammatory bowel disease model group showed weight loss and significant colon shortening, while the MP-CATH peptide treatment group could slow the progression of enteritis, did not cause significant weight changes, and maintained colon length at a normal level.

[0118] Example 9: Study on the therapeutic effect of MP-CATH peptide from the flower frog on an arthritis model mouse

[0119] Transgenic mice exhibited symptoms similar to those of rheumatoid arthritis in humans. Female transgenic mice (overexpressing human tumor necrosis factor α, a transgenic arthritis mouse model) at weaning (3 weeks old) were weighed and randomly divided into two groups. The MP-CATH peptide treatment group received either 1 mg / kg intraperitoneally once weekly (biw) or twice weekly (qw) for 4 consecutive weeks. Mouse weight and ankle diameter were recorded weekly. The control group received an equal volume of saline. Joint conditions were photographed at week 4. Results are shown below. Figure 9 As shown.

[0120] Depend on Figure 9 It was observed that the transgenic mice steadily increased in weight over time, while their joints swelled or deformed, manifested as an increase in ankle diameter. Severe joint deformities, limited mobility, and contractures of all toes were even observed by week 4. The MP-CATH peptide treatment group intervened in arthritis with two dosing frequencies. The results showed that MP-CATH peptide significantly improved joint swelling and inflammatory response, delayed the progression of arthritis, and had a long duration of effect. There was no significant difference in the therapeutic effect on arthritis between once-weekly and twice-weekly dosing frequencies.

[0121] Example 10: Study on the hemolytic toxicity of MP-CATH peptide from the flower frog on erythrocytes

[0122] Fresh whole blood from mice was added to an equal volume of sterile Alderman's solution and centrifuged at 2000 rpm for 5 min. Cells were washed with 0.9% saline until the supernatant no longer appeared red. The washed, compacted erythrocytes were diluted with 0.9% saline to a 2% erythrocyte suspension. This erythrocyte suspension was then incubated with MP-CATH peptides dissolved in saline at different concentrations (0 μM, 0.625 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, and 40 μM) at 37°C for 30 min. The suspension was then placed in a U-shaped plate at room temperature and observed and photographed after 2 h. Since hemolytic activity is directly proportional to the 540 nm absorbance, the supernatant was centrifuged at 2000 rpm for 5 min after the above treatment, and the absorbance at 540 nm was measured. 0.1% Triton X-100 was used as a positive control, and saline was used as a negative control. Hemolysis rate % = [(OD sample - OD negative) / (OD positive – OD negative)] × 100%. Test results are as follows: Figure 10 As shown.

[0123] Depend on Figure 10 It was found that the erythrocyte suspension in the control group settled naturally after standing, forming a red spot at the bottom of the U-shaped plate; the positive control group was induced to undergo hemolysis, manifested as the red spot becoming smaller or disappearing, and the supernatant becoming a clear pale red. Mouse erythrocytes treated with 40 μM and lower concentrations of MP-CATH peptide did not exhibit hemolysis or coagulation reactions, indicating that the peptide has low erythrocyte toxicity, thus ensuring its safety for clinical use.

[0124] Example 11: Stability study of MP-CATH peptide from the flower frog to salt concentration and temperature

[0125] Proteins are biological macromolecules with specific structures, and their inherent structural asymmetry determines their circular dichroism. The circular dichroism spectra of proteins are generally divided into the far-ultraviolet (UL) and near-ultraviolet (NIV) regions, with wavelength ranges of 178–250 nm and 250–320 nm, respectively. The UUV circular dichroism spectrum reflects the circular dichroism of peptide bonds. Based on this characteristic, this example examines the changes in circular dichroism results after treating peptides with different concentrations of salt solutions and at different temperatures.

[0126] Peptide salt stability test: MP-CATH peptide (50 µM) was dissolved in 60 mM sodium dodecyl sulfate solution, and then mixed with sodium chloride of different concentrations (0, 100, 200 and 400 mM) before measurement and incubated at room temperature for 1 h.

[0127] Peptide temperature stability test: MP-CATH peptide (50 µM) was dissolved in 60 mM sodium dodecyl sulfate solution, and then the mixture was incubated at 25 °C, 37 °C, 50 °C, 70 °C and 90 °C for 1 h before measurement.

[0128] The samples were added to separate detection dishes. The instrument settings were as follows: sample cell path length 0.1 cm, 25℃, distance from the column 1 nm, and scanning wavelength 180–260 nm. The bandwidth was adjusted to 1 nm, the response time to 1 sec, and the scan speed to 100 nm / min.

[0129] like Figure 11 As shown in Figure A, in different sodium chloride solutions, with increasing salt concentration, the large positive peak at 195 nm decreases, and the proportion of the α-helical conformation slightly decreases; as shown in Figure A... Figure 11 As shown in Figure B, temperature changes have almost no effect on its circular dichroism chromatogram results. Most peptides are prone to hydrogen bond breakage at high temperatures, leading to denaturation and thus limiting their production, storage, and use. However, the MP-CATH peptide maintains structural stability in high-temperature environments and high-salt solutions. This not only indicates its ease of preservation but also suggests a high probability of it exerting its original inhibitory activity after entering the body. Furthermore, its heat resistance allows for more rigorous sterilization procedures in clinical use, ensuring drug safety.

[0130] The embodiments of this application have been described in detail above with reference to the accompanying drawings. However, this application is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of this application. Furthermore, unless otherwise specified, the embodiments and features described in the embodiments of this application can be combined with each other.

Claims

1. A TNF-α antagonistic peptide, characterized in that, The amino acid sequence of the TNF-α antagonistic peptide is shown in SEQ ID NO:

1.

2. The method for preparing the TNF-α antagonistic peptide according to claim 1, characterized in that, It is prepared by chemical synthesis.

3. The use of the TNF-α antagonistic peptide according to claim 1 in the preparation of anti-inflammatory drugs.

4. The use of the TNF-α antagonist peptide according to claim 1 in the preparation of a medicament for treating / preventing autoimmune diseases, characterized in that, The autoimmune diseases mentioned include at least one of rheumatoid arthritis, psoriasis, and inflammatory bowel disease.

5. A drug, characterized in that, It includes the TNF-α antagonistic peptide of claim 1 and pharmaceutically acceptable excipients.

6. The drug according to claim 5, characterized in that, The dosage forms of the drug include tablets, granules, dispersants, capsules, pellets, injections, powder for injection, or aerosols.

Images