Multivalent biological toxin antigen vaccine based on dual receptor binding domain (RBD) assembly and preparation method and application thereof

By using genetic engineering technology to prepare a multivalent biological toxin vaccine with dual Hc fusion proteins, the problem of existing vaccines being unable to protect against multiple biological toxins has been solved, achieving broad-spectrum protection against multiple toxins and safe and efficient vaccine preparation.

CN116270998BActive Publication Date: 2026-07-24ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2023-03-15
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing botulinum toxin and tetanus toxin vaccines cannot effectively protect against a variety of biological toxins, and traditional vaccine production processes are not safe or efficient enough to cope with the variability of toxins with multiple serotypes and subtypes.

Method used

By fusing the Hc antigens of the receptor-binding regions of different biotoxins using genetic engineering techniques, a double Hc fusion protein is prepared as a multivalent biotoxin vaccine. The highly efficient fusion protein is obtained by expressing and purifying it using recombinant Escherichia coli, and then an adjuvant is added to prepare a multivalent biotoxin molecular antigen vaccine.

Benefits of technology

It achieves broad-spectrum protection against a variety of biological toxins, improves the safety and efficacy of vaccines, and can simultaneously prevent multiple biological toxin pathogens, especially botulinum toxins of types A, B, E, F and H, as well as tetanus toxin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a multivalent biological toxin antigen vaccine based on double receptor binding domain (RBD) assembly and a preparation method and application thereof. The application provides a multivalent biological toxin molecular antigen vaccine, and an active ingredient of the vaccine is a fusion protein formed by connecting an Hc protective antigen of biological toxin 1 and an Hc protective antigen of biological toxin 2 through a connecting peptide; the biological toxin 1 and the biological toxin 2 are two different biological toxins; and the biological toxin is selected from the following: tetanus toxin or other types of botulinum toxin (including types A, B and H) except type E. The application proves that different serotypes of botulinum toxin and tetanus toxin receptor binding domain Hc antigens are fused and assembled into a double Hc fusion antigen molecule by using genetic engineering and biosynthesis technology, and the double Hc fusion antigen molecule can generate strong protection against multiple biological toxins as a single subunit vaccine. Therefore, the Hc fusion antigen molecule vaccine of the application can generate protection against multiple different serotypes of biological toxin pathogens, and can be used as a broad-spectrum multivalent vaccine for biological toxin prevention and preventive treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biopharmaceuticals, specifically to multivalent biological toxin antigen vaccines assembled based on dual receptor binding domain (RBD), their preparation methods, and applications. Background Technology

[0002] Botulinum neurotoxin (BoNTs) is a neurotoxin secreted by Clostridium botulinum. It is the most potent biological and chemical poison known to humans, with a median lethal dose (LD50) for humans. 50 The concentration is only 0.1-1 ng / kg. Botulinum toxin can be classified into eight serotypes (AH) based on its antigenic properties, among which types A, B, E, F, and H can cause botulism in humans. Type H, a novel botulinum toxin, was discovered by biologists in 2013. It is a hybrid of types A and F, with its Hc being similar to BoNT / A1, sharing 84% sequence homology. It can be partially neutralized by anti-A toxin antibodies. HN and L share 64% and 81% homology with BoNT / F1 and BoNT / F5, respectively.

[0003] Because Clostridium botulinum, which produces botulinum toxin, is widespread in nature and its spores are highly resistant to the external environment, botulism remains a very serious public health problem. Therefore, the development of drugs for the prevention and treatment of botulinum toxin is of great practical significance.

[0004] Tetanus toxin (TeNT) is a toxin produced by Clostridium tetani, which enters the human body through skin or mucous membrane wounds and multiplies in an anaerobic environment. Tetanus is highly toxic; the estimated lethal dose for humans is less than 2.5 ng / kg, and the mortality rate without treatment is as high as 40%. Tetanus is a life-threatening disease characterized by muscle spasms, caused by the neurotoxin of Clostridium tetani. It often occurs secondary to various traumas and can also occur in mothers and newborns who give birth under unsanitary conditions.

[0005] Tetanus toxin and botulinum toxin share similar structural features and mechanisms of poisoning. Mature, active botulinum toxin and tetanus toxin are both long peptide chains composed of a light chain (L chain, 50 kDa) and a heavy chain (H chain, 100 kDa) linked by non-covalent disulfide bonds. The light chain is the toxic domain, possessing zinc ion endopeptidase activity; the N-terminus of the heavy chain (HN domain), primarily composed of α-helices, plays a crucial role in the transmembrane transport of the toxin; the C-terminus of the heavy chain (Hc domain) is a nerve cell-specific binding domain, composed of two subdomains (Hc-N and Hc-C), which interacts with receptor proteins, facilitating the entry of neurotoxins into cells.

[0006] Botulinum toxin, as the most potent known protein, has attracted significant attention in the development of vaccines and neutralizing antibodies. However, current research and limited use of toxoid vaccines have many drawbacks, hindering widespread application. In recent years, research on botulinum toxin vaccines has intensified both domestically and internationally, aiming to find safe and effective vaccines. Among these, novel recombinant subunit vaccines hold the greatest promise. Previous studies have largely demonstrated that the receptor-binding domain (RBD) Hc of botulinum toxin is a fundamental protective antigenic determinant with complete protective efficacy, making it a primary target antigen in botulinum toxin vaccine research. Simultaneously, the tetanus toxin receptor-binding domain Hc is also an important protective antigen, capable of inducing strong protective effects in the body. This recombinant tetanus subunit vaccine would eliminate the need for culturing tetanus bacteria or purifying tetanus toxin, making the production process safer and more efficient, and potentially replacing formaldehyde-inactivated tetanus toxin (a toxoid molecule) as a novel vaccine candidate.

[0007] Multivalent vaccines represent a major development trend in the domestic and international vaccine industry. Relying on three major engineering technologies—genetics, fermentation, and protein—multivalent vaccines have made significant progress in two key technologies: more effective screening and preparation of protective antigens for various pathogens, and efficient and stable formulation processes. Multivalent vaccines can simultaneously protect against multiple pathogens, especially since a single vaccine can protect against multiple pathogens, demonstrating significant advantages and application prospects. Given the characteristics of botulinum toxin, such as its multiple serotypes and subtypes, and the complex and diverse nature of its toxin-producing strains, coupled with their variability and variability, monovalent vaccines often struggle to protect against multiple biotoxins or poisoning caused by multiple biotoxins simultaneously. Therefore, researching multivalent biotoxin antigen vaccines targeting various botulinum toxin and tetanus toxin pathogens, utilizing the protective antigens of mature monovalent candidate vaccines, is of great significance and application potential. Such multivalent vaccines can simultaneously protect against multiple botulinum toxins or botulinum toxin and tetanus toxin. Summary of the Invention

[0008] The purpose of this invention is to provide a multivalent biological toxin antigen vaccine assembled based on a dual receptor binding domain (RBD), its preparation method, and its application.

[0009] In a first aspect, the present invention claims protection for a multivalent biological toxin molecular antigen vaccine.

[0010] In this invention, the biotoxin is tetanus toxin or botulinum toxin.

[0011] The multivalent biotoxin molecular antigen vaccine claimed in this invention has an active ingredient that is a fusion protein formed by linking the Hc antigen of biotoxin 1 and the Hc antigen of biotoxin 2 through a linker peptide.

[0012] The biotoxin 1 and the biotoxin 2 are two different biotoxins;

[0013] The biotoxin is selected from the following: tetanus toxin or other types of botulinum toxin other than type E.

[0014] In a specific embodiment of the present invention, the other types of botulinum toxins besides type E are specifically type A botulinum toxin, type B botulinum toxin, or type H botulinum toxin.

[0015] Furthermore, the active ingredient of the multivalent biological toxin molecular antigen vaccine is any one of the following:

[0016] (A1) A fusion protein formed by linking the Hc antigen of botulinum toxin type A and the Hc antigen of tetanus toxin in the order from amino acid to carboxyl terminus through a linker peptide is named AHc-THc.

[0017] (A2) A fusion protein formed by linking the Hc antigen of tetanus toxin and the Hc antigen of botulinum toxin type A in the order from amino acid to carboxyl terminus through a linker peptide is named THc-AHc.

[0018] (A3) A fusion protein formed by linking the Hc antigen of botulinum toxin type A and the Hc antigen of botulinum toxin type B in the order from amino acid to carboxyl terminus through a linker peptide is named AHc-BHc.

[0019] (A4) A fusion protein formed by linking the Hc antigen of botulinum toxin type B and the Hc antigen of botulinum toxin type H in the order from amino acid to carboxyl terminus through a linker peptide is named BHc-HHc.

[0020] Furthermore, the linker peptide is (G4S)3, with the specific amino acid sequence being: GGGGSGGGGSGGGGSGS.

[0021] Furthermore, the amino acid sequence of the Hc antigen of the type A botulinum toxin is shown in SEQ ID No. 10.

[0022] Furthermore, the amino acid sequence of the Hc antigen of the type B botulinum toxin is shown in SEQ ID No. 12.

[0023] Furthermore, the amino acid sequence of the Hc antigen of the H-type botulinum toxin is shown in SEQ ID No. 8.

[0024] Furthermore, the amino acid sequence of the Hc antigen of the tetanus toxin is shown in SEQ ID No. 16.

[0025] More specifically, the amino acid sequence of the AHc-THc is shown in SEQ ID No. 18.

[0026] More specifically, the amino acid sequence of the THc-AHc is shown in SEQ ID No. 20.

[0027] More specifically, the amino acid sequence of AHc-BHc is shown in SEQ ID No. 26.

[0028] More specifically, the amino acid sequence of the BHc-HHc is shown in SEQ ID No. 28.

[0029] Secondly, the present invention claims a method for preparing the multivalent biological toxin molecular antigen vaccine described in the first aspect above.

[0030] The method for preparing the multivalent biotoxin molecular antigen vaccine described in the first aspect above, as claimed in this invention, may include the following steps: introducing a nucleic acid molecule encoding the fusion protein into Escherichia coli recipient cells to obtain recombinant Escherichia coli; culturing the recombinant Escherichia coli to obtain the fusion protein; and then using the fusion protein as the active ingredient to prepare the multivalent biotoxin molecular antigen vaccine.

[0031] Furthermore, the nucleic acid molecule sequence encoding the Hc antigen of the type A botulinum toxin is shown in SEQ ID No. 9.

[0032] Furthermore, the nucleic acid molecule sequence encoding the Hc antigen of the type B botulinum toxin is shown in SEQ ID No. 11.

[0033] Furthermore, the nucleic acid molecule sequence encoding the Hc antigen of the H-type botulinum toxin is shown in SEQ ID No. 7.

[0034] Furthermore, the nucleic acid molecule sequence encoding the Hc antigen of the tetanus toxin is shown in SEQ ID No. 15.

[0035] Furthermore, the nucleic acid molecule sequence encoding the AHc-THc is shown in SEQ ID No. 17.

[0036] Furthermore, the nucleic acid molecule sequence encoding the THc-AHc is shown in SEQ ID No. 19.

[0037] Furthermore, the nucleic acid molecule sequence encoding the AHc-BHc is shown in SEQ ID No. 25.

[0038] Furthermore, the nucleic acid molecule sequence encoding the BHc-HHc is shown in SEQ ID No. 27.

[0039] In the method, during the cultivation of the recombinant Escherichia coli, IPTG is added to a final concentration of 0.4 mmol / L when the culture reaches the logarithmic growth phase, and then the culture is carried out at 30°C for 4-5 hours or at 18°C ​​overnight. After the culture is completed, the bacterial cells are collected, sonicated, and the supernatant is collected by centrifugation. The fusion protein can be obtained from the supernatant.

[0040] Furthermore, after centrifuging and collecting the supernatant, the process further includes a purification step using a Ni-NTA affinity chromatography column or a streptomycin affinity chromatography column.

[0041] In both of the above aspects, the multivalent biological toxin molecular antigen vaccine contains an adjuvant in addition to the active ingredient.

[0042] Furthermore, aluminum adjuvants.

[0043] Thirdly, the present invention claims protection for any of the following substances:

[0044] (B1) Protein, which is the fusion protein described in the first aspect above;

[0045] (B2) Nucleic acid molecules, which are the nucleic acid molecules described in the first aspect above, encoding the protein described in (B1);

[0046] (B3) Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the nucleic acid molecules described in (B2);

[0047] (B4) Products for the prevention and / or treatment of poisoning symptoms caused by botulinum toxin and / or tetanus toxin, containing the protein described in (B1) or the nucleic acid molecule described in (B2) or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria described in (B3).

[0048] Fourthly, this invention claims protection for the use of the protein described in (B1) of the third aspect above, or the nucleic acid molecule described in (B2), or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria described in (B3) in the preparation of products for the prevention and / or treatment of poisoning symptoms caused by botulinum toxin and / or tetanus toxin. The botulinum toxin may also be type H botulinum toxin.

[0049] The applicant's team has established a cutting-edge basic and immunogenicity research platform for various functional domains of botulinum toxin. They have systematically studied the biological activity and immunogenicity of various functional epitopes of botulinum toxin types A, B, E, F, and H, as well as tetanus toxin. This has identified a series of novel functional epitopes and immunomodulatory molecules with strong protective efficacy, such as the receptor-binding domain A / B-Hc or the light chain-transmembrane domain E / FL-HN, providing a wealth of candidate protective antigen molecules for the development of broad-spectrum, highly effective, multivalent botulinum toxin vaccines. Furthermore, this invention investigated the immunogenicity of epitope antigens from various functional domains of H-type botulinum toxin. The results showed that the H-type receptor-binding domain HHc also has strong protective effects, and it exhibits strong cross-protective effects with the A-type botulinum toxin receptor-binding domain AHc. Given that the receptor-binding domain (RBD) of botulinum toxin and tetanus toxin are important protective antigens, they can serve as subunit vaccine candidates. This technical solution utilizes recombinant technology to fuse and assemble Hc antigens from the receptor-binding regions of different serotypes of botulinum toxin or tetanus toxin into a dual Hc antigen molecule structure, which is then biosynthesized to prepare a dual Hc fusion antigen molecule. This dual Hc fusion antigen molecule serves as a multivalent biological toxin vaccine for the prevention of various biological toxin pathogens.

[0050] Based on this concept and technology, this invention explored a series of dual Hc (or dual receptor-binding domain (RBD) fusion antigen molecules, verifying the feasibility of this technical approach and the effectiveness of the protective efficacy of multivalent vaccine antigen molecules. For example, the fusion molecular structure of botulinum toxin type A and tetanus toxin was combined to prepare AHc-THc and THc-AHc antigen molecules. Results showed that they all possess the correct structural characteristics and biological activity, and as subunit vaccines, they can produce strong protection against both botulinum toxin type A and tetanus toxin, while also providing cross-protection against novel botulinum toxin type H. Similarly, other combinations such as AHc-BHc and BHc-HHc can also produce strong protection against botulinum toxin types A and B. These results indicate that single fusion antigen molecule vaccines can produce protective efficacy against two or three different serotypes of toxin pathogens, and can be used as broad-spectrum multivalent vaccines for the prevention and prophylactic treatment of biotoxins. These results demonstrate that the technology of assembling multivalent biotoxin antigens based on dual receptor-binding domain (RBD) assemblies is feasible and can be applied to the research and development of multivalent vaccines against various biotoxin pathogens. Attached Figure Description

[0051] Figure 1SDS-PAGE electrophoresis and Western blot identification of the functional domains HL, HHc, HHN, and HL-HN proteins of purified H-type botulinum toxin. A shows the SDS-PAGE identification of the functional domain proteins of H-type botulinum toxin and other protein antigens; lanes 1-7 represent FHc, AHc, FL-HN, HL, HHc, HHN, and HL-HN protein samples, respectively. FHc represents Hc of type F botulinum toxin; FL-HN represents L-HN of type F botulinum toxin; and AHc represents Hc of type A botulinum toxin. These serve as control functional domain proteins. B shows the Western blot identification of the receptor-binding domain protein antigens of various botulinum toxin types (detection results using murine hyperimmune serum against the receptor-binding domain of H-type botulinum antitoxin as the primary antibody); lanes 1-3 represent HHc, AHc, and FHc, respectively. C represents the Western blot identification of receptor-binding domain protein antigens of various botulinum toxin types (using hyperimmune serum of equine anti-type A botulinum antitoxin receptor-binding domain as the primary antibody), lanes 1-3 are HHc, AHc, and FHc, respectively. D represents the Western blot identification of functional binding domains of botulinum toxin type H (L and HN) and FL-HN protein antigens (using hyperimmune serum of murine anti-type F botulinum toxin FL-HN as the primary antibody), lanes 1-4 are HL, HN, HL-HN, and FL-HN, respectively. E represents the Western blot identification of functional binding domains of botulinum toxin type H (L and HN) and FL-HN protein antigens (using hyperimmune serum of murine anti-type H botulinum toxin HL-HN as the primary antibody), lanes 1-4 are HL, HN, HL-HN, and FL-HN, respectively. The target protein is shown in the box. M stands for protein marker (from top to bottom: 170, 130, 90, 70, 55, 40, 35, 25, 15 and 10 kDa).

[0052] Figure 2 This is a schematic diagram of the structure of a multivalent biological toxin antigen vaccine molecule assembled based on a dual receptor-binding domain (RBD). Note: The selected botulinum toxin and tetanus toxin receptor-binding domains (Hc) and their assembly order are shown in the figure. The numbers in parentheses indicate the amino acid sequence information of the Hc receptor-binding domain. The two receptor-binding domains (Hc-RBD) are assembled into a dual receptor-binding domain (Hc) molecule via a (G4S)3 linker peptide. The GS linker indicates the (G4S)3 linker peptide.

[0053] Figure 3This image shows SDS-PAGE electrophoresis and Western blotting identification of THc-linker-AHc, AHc-linker-THc, THc, and AHc antigen proteins obtained after biosynthesis and purification. Lanes 1-4 represent the protein samples of THc-linker-AHc (100 kDa), AHc-linker-THc (100 kDa), THc (50 kDa), and AHc (50 kDa), respectively; M represents the protein markers (from top to bottom: 170, 130, 90, 70, 55, 40, and 35 kDa). Lane A shows the SDS-PAGE identification of the fusion receptor-binding domain of tetanus toxin and botulinum toxin type A, THc-linker-THc antigen, and the individual tetanus toxin receptor-binding domain THc antigen and botulinum toxin type A receptor-binding domain AHc antigen. B shows the Western blot identification of the fusion receptor-binding region and individual receptor-binding region antigens of tetanus toxin and botulinum toxin type A (using equine botulinum toxin type A standard as the primary antibody test result). C shows the Western blot identification of the fusion receptor-binding region and individual receptor-binding region antigens of tetanus toxin and botulinum toxin type A (using murine anti-tetanus toxin receptor-binding region hyperimmune serum as the primary antibody test result).

[0054] Figure 4 SDS-PAGE electrophoresis images show the recombinant AHc-linker-EHc, EHc-linker-AHc, AHc-linker-BHc, and BHc-linker-HHc proteins obtained after biosynthesis and purification. In lane A, lane 1 shows the control strain that did not express the target protein; lane 2 shows the strain that biosynthesized and expressed the EHc-linker-AHc protein; lane 3 shows the purified EHc-linker-AHc protein (100 kDa); lane 4 shows the strain that biosynthesized and expressed the AHc-linker-EHc protein; and lane 5 shows the purified AHc-linker-EHc protein (100 kDa). In lane B, lane 1 shows the control strain that does not express the target protein; lane 2 shows the strain that biosynthesized and expressed the AHc-linker-BHc protein; lane 3 shows the purified AHc-linker-BHc protein (100 kDa); lane 4 shows the strain that biosynthesized and expressed the BHc-linker-HHc protein; and lane 5 shows the purified BHc-linker-HHc protein (100 kDa).

[0055] Figure 5The results show the antibody levels in mice immunized with the HL, HHc, HHN, and HL-HN protein antigens of H-type botulinum toxin. A represents the antibody titers against their respective antigens in the immunized serum of HL, HHN, HL-HN, and HHc antigens; B represents the antibody titers against AHc and FL-HN antigens in the immunized serum of HHc and HL-HN antigens.

[0056] Figure 6 This report presents the antibody levels in mice after co-immunization with the Hc fusion molecule of tetanus toxin and botulinum toxin type A dual receptor binding regions and the functional epitope antigen protein of the individual receptor binding regions. A represents the antibody titers against each recombinant antigen (THc-linker-AHc, AHc-linker-THc) in serum after single and double immunization with 1 μg and 4 μg of recombinant antigens THc-linker-AHc and AHc-linker-THc, and in serum after single and double immunization with 1 μg of THc+AHc combined with 1 μg. B represents the antibody titers against each AHc in serum after single and double immunization with recombinant antigens THc-linker-AHc and AHc-linker-THc, and in serum after single and double immunization with 1 μg of THc+AHc combined with 1 μg. C represents the antibody titers against each THc in the serum of mice immunized once and twice with recombinant antigens THc-linker-AHc and AHc-linker-THc (1 μg and 4 μg groups), and the antibody titers against each THc in the serum of mice immunized once and twice with THc+AHc combined with 1 μg group.

[0057] Note: All data in this experiment were analyzed using GraphPad Prism 5.0. The experimental results are expressed as mean ± standard error (mean ± SD). The differences between paired experiments were analyzed using t-tests or chi-square tests to determine their statistical significance. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: *Molecular Cloning: A Laboratory Manual* (Sambrook, J., Russell, David W., *Molecular Cloning: A Laboratory Manual*, 3rd edition). rd (edition, 2001, NY, Cold Spring Harbor) and the Pharmacopoeia of the People's Republic of China (edited by the National Pharmacopoeia Commission, Vol. 3, 2020, Chemical Industry Press).

[0061] The following examples first investigated the immunogenicity of epitope antigens from various functional domains of H-type botulinum toxin. The results showed that the H-type receptor-binding domain (HHc) also exhibited strong protective activity, and it showed strong cross-protective effects with the A-type botulinum toxin receptor-binding domain (AHc). Then, a series of dual-Hc fusion antigen molecules were designed and prepared, and their structural characteristics and immunological activities were systematically evaluated. The protective efficacy of single-fusion antigen molecule vaccines against various toxin pathogens was also evaluated. The purpose of this technical solution is to utilize recombinant technology to fuse RBD antigen proteins from different serotypes of biological toxin receptor-binding domains into dual-Hc antigen molecule structures, assembling and preparing dual-Hc fusion antigen molecules. These dual-Hc fusion antigen molecules serve as multivalent biological toxin vaccines for the prevention of various toxin biological agents.

[0062] Example 1. Expression, purification, and identification of recombinant proteins with functional domain epitopes of H-type botulinum toxin in Escherichia coli. I. Gene design and synthesis of recombinant proteins with functional domain epitopes of H-type botulinum toxin (L, HN, L-HN, and Hc).

[0063] Based on codon degeneracy, recombinant protein genes encoding various functional epitopes of botulinum toxin H were artificially optimized and synthesized. These genes were then directly cloned into cloning vectors such as pMD18-T (TaKaRa) to encode HL, HHN, L-HN, and HHc, respectively (detailed recombinant protein and sequence information are shown in Table 1). To facilitate subsequent operations, EcoRI restriction sites were introduced at the 5' end and XhoI restriction sites at the 3' end of each functional epitope antigen gene during cloning.

[0064] The above gene design uses codons commonly used in E. coli and ensures that the encoded amino acid residue sequences remain unchanged. Based on the full-length gene sequence and amino acid residue sequence of botulinum toxin type H (BoNT / H, strain WP_047402807.1, full-length 1288 amino acids), all functional epitope antigen genes were optimized to better promote gene expression.

[0065] Table 1. Basic Information on Epitopes of Functional Domains of H-type Botulinum Toxin

[0066]

[0067] II. Construction of various recombinant prokaryotic expression vectors

[0068] The plasmids obtained above were double-digested with EcoRI and XhoI, respectively. The corresponding target gene fragments were recovered using a DNA recovery kit and ligated with the prokaryotic expression vector pTIG-Trx (see patent: ZL200710089588.2) that had been double-digested with the same enzymes. The ligation product was transformed into E. coli DH5α competent cells, positive clones were screened, plasmids were extracted, and sequencing was performed to obtain recombinant prokaryotic expression vectors with correct sequences and insertion positions. Based on the different inserted fragments, they were named pTIG-Trx-HL, pTIG-Trx-HHN, pTIG-Trx-HL-HN, and pTIG-Trx-HHc, respectively.

[0069] III. Expression of each recombinant protein in Escherichia coli and purification and identification of the expression products

[0070] 1. Expression of each recombinant protein in Escherichia coli and SDS-PAGE detection of expression products

[0071] The four recombinant prokaryotic expression vectors constructed in step two were transformed into *E. coli* BL21(DE3) competent cells (TIANGEN). Positive recombinants were screened, with recombinant bacteria transformed with the pTIG-Trx empty vector serving as a negative control. The positive recombinant bacteria were then inoculated at a 1:100 ratio into 500 mL of LB broth containing 100 mg / mL ampicillin and cultured at 37°C and 250 rpm until the logarithmic growth phase (OD200) was reached. 600 When the concentration of the chemical inducer IPTG was approximately 0.6-0.8, it was added to a final concentration of 0.4 mmol / L. The cells were then cultured overnight at 18°C ​​with shaking at 220 rpm, or for 4-5 hours at 30°C with shaking at 220 rpm. After culture, the cells were collected by centrifugation, resuspended in 20 mM sodium phosphate buffer (pH 8.0), and the cells were sonicated to break them up. The supernatant was collected by centrifugation and analyzed by 12% SDS-PAGE. The results showed that the recombinant proteins expressed by the induction were all expressed and existed in a soluble form, while the target protein band did not appear in the uninduced strains and the induced empty vector control, indicating that the expressed protein was likely the target protein, i.e., the recombinant protein.

[0072] 2. Purification and identification of the expression product

[0073] The recombinant proteins expressed in step 1 each contain a six-histidine tag at their C-terminus. Therefore, the soluble expression products were purified using a Ni-NTA affinity chromatography column (Pharmacia) according to the manufacturer's instructions to obtain the eluted purified protein. The purified protein was then analyzed by 12% SDS-PAGE, and the results showed that the purified target protein was obtained. The obtained target protein was stored at -20℃ or -80℃ for later use. Figure 1 Figure A shows the SDS-PAGE electrophoresis images of the four target proteins after purification.

[0074] 3. Western blot identification of the expressed product

[0075] Using mouse-derived anti-H type botulinum toxin or anti-A and F type botulinum toxin serum antibodies (hyperimmune serum antibodies against each functional domain of various toxins prepared in our laboratory, obtained by collecting immune serum antibodies after 3-4 immunizations with recombinant Hc, etc.) as primary antibodies, and horseradish peroxidase (HRP)-labeled rabbit anti-mouse IgG (Sigma) as secondary antibodies, the purified recombinant proteins were analyzed by Western blot. Figure 1 The results showed that the prepared target protein was compatible with anti-H type botulinum toxin antibodies such as anti-HHc (B and E). Figure 1 (B) or HL-HN serum antibody ( Figure 1 The specific binding of the protein to E (e.g., E) and the positive band size and location corresponded to the electrophoretic position, which was comparable to the theoretical size of each recombinant protein, indicating that the purified recombinant protein was indeed the target protein. Furthermore, this invention also identified its antigenic cross-reactivity with other serotypes (…). Figure 1 (C and D) The results showed that the serum antibody against type A botulinum toxin Hc had a significant cross-reactivity with type H botulinum toxin ( Figure 1 (C) does not bind to type F botulinum toxin Hc, and anti-type F botulinum toxin L-HN serum antibodies do not cross-react with type H botulinum toxin. Figure 1 (D).

[0076] In summary, the gene sequences of each functional domain of botulinum toxin type H were cloned using genetic engineering techniques and ligated into the prokaryotic expression vector pTIG-Trx to obtain a recombinant expression plasmid. Through optimization of the induction expression conditions, efficient soluble expression of the recombinant plasmid in *E. coli* was achieved, and the expression was validated using HisTrap. TM HP protein purification column purified recombinant protein with high purity and good stability, providing a basis for comparing the immunoprotective efficacy of molecules with different protein functional domains.

[0077] Example 2: Expression, purification, and identification of recombinant proteins of various dual receptor-binding domain Hc-RBD fusion molecules in Escherichia coli.

[0078] I. Gene Design and Synthesis of Recombinant Proteins from Various Dual-Receptor Binding Domain Hc-RBD Fusion Molecules

[0079] Genes encoding the receptor-binding domains (Hc-RBDs) of various botulinum toxin and tetanus toxin (AHc, BHc, EHc, and THc) were artificially synthesized based on codon degeneracy (detailed receptor-binding domain Hc and sequence information are shown in Table 2). These genes were first directly cloned into cloning vectors such as pMD18-T for later use. To facilitate the subsequent ligation operations, EcoRI was introduced at the 5' end and BamHI restriction sites were introduced at the 3' end of one Hc gene, and BamHI and XhoI restriction sites were introduced at the 5' end and 3' end of another Hc gene.

[0080] The above gene design uses codons commonly used in E. coli and ensures that the encoded amino acid residue sequences remain unchanged. Based on the full-length gene sequences and amino acid residue sequences of various botulinum toxin types (e.g., botulinum toxin type A, strain 62A, 1296 amino acids; botulinum toxin type B, strain Okra, 1291 amino acids; botulinum toxin type E, strains Beluga or NCTC11219, 1252 amino acids; tetanus toxin, strain CMCC64008, 1315 amino acids), the Hc genes of the receptor-binding regions of all types of biotoxins were optimized, which is more conducive to the biosynthesis and expression of biotoxin gene proteins.

[0081] Table 2. Basic Information on Hc Receptor Binding Regions of Various Types of Botulinum Toxin and Tetanus Toxin

[0082]

[0083]

[0084] II. Construction and Identification of Various Recombinant Prokaryotic Expression Vectors

[0085] First, to facilitate the cloning of multiple target genes into the prokaryotic expression vector pTIG-Trx (see patent: ZL200710089588.2), this invention first clones BamHI and a linker peptide Linker-(G4S)3 into the space between EcoRI and XhoI in pTIG-Trx. This gives the entire vector three cloning restriction sites (EcoRI, BamHI, and XhoI; with the linker peptide Linker-(G4S)3 preceding BamHI), making it easy to clone two different genes. This expression vector is named pTIG-Trx-M. Furthermore, to enrich the methods for purifying target proteins, this invention also replaces the his tag of the expression vector pTIG-Trx-M with a Twin Strep tag (gene sequence TGGAGCCACCCCCAGTTCGAGAAGGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCAGCGGCTGGAGCCACCCCCAGTTCGAGAAG and encoding amino acid WSHPQFEK-(GGGS)2-GGSAWSHPQFEK) through the Xho I and Sac I restriction sites. This expression vector is named pTIG-Trx-M-TS, and therefore the target protein can be purified through the Strep-tag tag.

[0086] The plasmids containing the target gene sequence obtained in step one above were double-digested with either EcoRI and BamHI or BamHI and XhoI. The corresponding target gene fragments were recovered using a DNA recovery kit and ligated with the prokaryotic expression vectors pTIG-Trx-M or pTIG-Trx-M-TS, which had been double-digested with the same enzymes. The ligation products were transformed into E. coli DH5α competent cells, positive clones were screened, plasmids were extracted, and sequencing was performed to obtain recombinant prokaryotic expression vectors with correct sequences and insertion positions. Based on the different inserted fragments, they were named pTIG-Trx-AHc-THc, pTIG-Trx-THc-AHc, pTIG-Trx-AHc-EHc, pTIG-Trx-EHc-AHc, pTIG-Trx-AHc-BHc, and pTIG-Trx-BHc-HHc, respectively.

[0087] III. Expression of each recombinant double Hc fusion protein molecule in Escherichia coli and purification and identification of the expression products

[0088] 1. Expression of each recombinant double Hc fusion protein molecule in Escherichia coli and SDS-PAGE detection of expression products

[0089] The recombinant prokaryotic expression vector constructed in step two was transformed into *E. coli* BL21(DE3) competent cells (TIANGEN). Positive recombinants were screened, with recombinant bacteria transformed with the pTIG-Trx empty vector serving as a negative control. The positive recombinant bacteria were then inoculated at a 1:100 ratio into 500 mL of LB broth containing 100 mg / mL ampicillin and cultured at 37°C and 250 rpm until the logarithmic growth phase (OD200) was reached. 600 When the concentration of the chemical inducer IPTG is approximately 0.6-1.0, add it to a final concentration of 0.4 mmol / L. Incubate at 30°C with shaking at 220 rpm for 4-5 hours, or at 18°C ​​with shaking at 220 rpm overnight. After incubation, collect the bacterial cells by centrifugation, resuspend them in 20 mM sodium phosphate buffer (pH 8.0), sonicate to break up the cells, collect the supernatant by centrifugation, and perform 12% SDS-PAGE analysis. The results showed that the recombinant proteins expressed by the induction were all expressed and existed in a soluble form, while the uninduced strains and the induced empty vector control did not show the target protein band, indicating that the expressed protein is likely the target protein, i.e., the recombinant antigen.

[0090] 2. Purification and identification of the expression product

[0091] The recombinant toxin protein molecules expressed in step 1 contain six histidine residues or a streptoxin TS tag at their C-terminus. Therefore, the soluble expression products were purified using a Ni-NTA affinity chromatography column (Pharmacia) or a streptoxin affinity chromatography column (Dakow Biotech Co., Ltd.) according to the manufacturer's instructions to obtain the eluted purified protein. The purified protein was then analyzed by 12% SDS-PAGE, and the results showed that the purified target protein was obtained. The obtained target protein was stored at -20℃ or -80℃ for later use. Figure 2 The diagram shown is a schematic representation of the structure of a multivalent biological toxin antigen vaccine molecule designed and biosynthesized based on a dual receptor binding domain (RBD). Figure 3 and Figure 4 The image shown is an SDS-PAGE electrophoresis identification diagram of the purified target proteins (THc-linker-AHc, AHc-linker-THc, AHc-linker-EHc, EHc-linker-AHc, AHc-linker-BHc, and BHc-linker-HHc).

[0092] 3. Western blot analysis of the expressed product

[0093] Using equine toxin standards (purchased from the National Institutes for Food and Drug Control) and polyclonal antibodies against the receptor-binding regions of various toxins (hyperimmune serum antibodies prepared in this experiment) as primary antibodies, and horseradish peroxidase (HRP)-labeled rabbit anti-equine IgG (Sigma) as secondary antibodies, the purified double Hc fusion protein molecules were subjected to Western blot analysis. The results showed that the expressed target proteins specifically bound to the antibodies in the antitoxin standards of various toxins, indicating that they all contained the corresponding Hc functional domains of each toxin, which is consistent with the theoretical design. Figure 3 Figures B and C show the identification results of the double Hc fusion protein molecule of tetanus toxin and botulinum toxin type A. The size and position of the positive band are consistent with the electrophoretic position and are comparable to the theoretical size of the recombinant protein molecule, indicating that the purified recombinant protein is the target protein, containing the Hc functional domain of the receptor binding region of both toxins.

[0094] In summary, gene sequences of the Hc functional domains of various toxin receptor binding regions were cloned using genetic engineering techniques and ligated into the pTIG-Trx series of prokaryotic expression vectors to obtain recombinant expression plasmids. Through optimization of induction expression conditions, efficient soluble expression and biosynthesis of the recombinant plasmids in *E. coli* were achieved. High-purity and stable recombinant biotoxin protein molecules were purified using HisTrap™ HP protein purification columns or streptozotocin affinity chromatography columns. Figure 4 This provides a foundation for further investigation into the immunoprotective efficacy of different biotoxin proteins as subunit vaccines.

[0095] The final Hc fusion molecular structures and characteristics of each dual receptor binding region obtained through this embodiment are shown in Table 3.

[0096] Table 3. Information on the structure and characteristics of Hc fusion molecules in each dual receptor binding region

[0097]

[0098] Note: Each dual receptor-binding Hc fusion molecule is composed of two functional domains of receptor-binding Hc from two different biotoxin sources, which are linked by a GS linker. The gene sequence of this GS linker is GGCGGTGGCGGTAGTGGCGGTGGCGGTAGCGGCGGTGGCGGTAGTGGATCC; the amino acid sequence is GGGGSGGGGSGGGGSGSGS.

[0099] Example 3: Detection of antibody levels in mice immunized with epitope antigen proteins of various functional domains of botulinum toxin H and their protective effect against botulinum toxin H.

[0100] Given that H-type botulinum toxin is a novel serum-type toxin that can cause poisoning in humans, and currently there are no specific antibodies or vaccines to protect against it, this invention investigates the immunogenicity of epitope antigens of various functional domains of H-type botulinum toxin, as well as its immune cross-reactivity with protective antigens of other serum-type botulinum toxins.

[0101] The recombinant protein antigens prepared in Example 1 above were used to immunize mice to test their immunogenicity and protective effect. Specifically, Balb / c mice (6-8 weeks old, female, SPF grade, purchased from the Experimental Animal Center of the Academy of Military Medical Sciences) were randomly divided into groups of 10 mice each. The immunization dose was 1 μg or 10 μg of antigen protein per mouse, while the negative control group was immunized with PBS containing no recombinant protein. All immunizations were combined with aluminum adjuvant (Alhydrogel) at a final concentration of 1 mg / ml. TM 2.0% (BrenntagBiosector product) was mixed and immunized with booster immunization every 3 weeks (the dosage of antigen protein and aluminum adjuvant was the same as above). After two or three immunizations, blood was collected from the mice, and then they were challenged with various types of botulinum toxin (BoNT / A / F / H, of which H type botulinum toxin was mainly used for protective tests in Examples 3-4, and A, F and H types botulinum toxin were used for protective tests in Example 5) to evaluate the protective effect of the protein antigen (observed for one week and the results were statistically analyzed). The serum antibody level of mice was detected by ELISA and the neutralizing titer was determined by the classic in vivo neutralization test, as follows.

[0102] Serum antibody levels were measured using an ELISA method (enzyme-linked immunosorbent assay plate coated with each recombinant antigen at a concentration of 2 μg / mL, using isolated immunized mouse serum as the primary antibody, and HRP-labeled goat anti-mouse IgG (Santa Cruz Biotechnology, Inc.) as the secondary antibody). Mouse serum immunized with aluminum adjuvant diluted in PBS served as a negative control (N). The OD of the immunized group... 492 A positive result was defined as a P-value (i.e., P) of 0.5 or higher and a P / N ratio ≥ 2.1. Antibody levels in each group are expressed as mean ± standard error.

[0103] The in vivo neutralizing activity and titer of serum antibodies in immunized mice were determined using a classic in vivo neutralization assay. Serum antibody titers were reported as International Units per milliliter (IU / ml), with one IU defined as 10⁻⁶ neutralizing units. 4 LD 50 Neutralizing antibodies against botulinum toxin types A / F / H (Note: This protocol should be referenced when determining botulinum toxin neutralizing antibodies. This study primarily uses type H botulinum toxin; other neutralizing antibodies are simply substituted for different types of botulinum toxin, and the determination should follow this method). The following protocol was designed to determine the neutralizing titer in mouse serum (referencing the 2020 edition of the Chinese Pharmacopoeia).

[0104] (1) Dilution of the toxin with the test sample. Dilute the toxin to 100 LD. 50 / ml. Then, the mouse serum was diluted to a factor equivalent to the corresponding toxin according to the expected potency, such as diluting 2 IU / ml serum 200 times to 0.1 IU / ml. At the same time, the antitoxin standard was diluted to the corresponding concentration.

[0105] (2) In vitro binding of toxin to the test sample. 1 ml of diluted toxin was mixed with different volumes of diluted serum or antitoxin standard (purchased from the China National Institutes for Food and Drug Control), with 5 gradients set up for each group. The final volume was brought up to 2.5 ml with diluent. The toxin and antibody were mixed thoroughly and incubated at 37°C for 15 min to allow for complete reaction between the toxin and antibody.

[0106] (3) Animal administration and observation. SPF-grade female KM mice (15-18g) were randomly divided into groups of four. The incubated biotoxin and antitoxin standard or test sample were injected intraperitoneally into the mice at a dose of 500 μl / mouse, with four mice administered each dilution of each sample. Animal morbidity and mortality were observed daily for seven consecutive days. Serum potency was calculated by comparing the 50% mortality endpoint of the biotoxin standard group with the 50% protective endpoint of the experimental group (refer to the 2020 edition of the Chinese Pharmacopoeia).

[0107] Table 4 and Figure 5 The results shown in Figure A indicate that all recombinant antigens—HL, HHN, HL-HN, and HHc—produced antibody responses against themselves. Protective responses were observed in all immunization groups at different doses and immunization frequencies, showing a positive dose-related correlation. However, the protective effects against the toxins and the levels of neutralizing antibodies differed. Different doses and immunization frequencies in the HL-HN and HHc immunization groups produced strong protective effects, while HHN, being a weaker protein antigen, produced partial protection, and HL showed no protective effect.

[0108] Table 4. Protective effect of H-type botulinum toxin epitope antigen proteins from various functional domains in mice after immunization

[0109]

[0110]

[0111] Note: 2× indicates the second immunization group, and 3× indicates the third immunization group; protective experiments were conducted 3 weeks after the last immunization using different doses of H-type botulinum toxin; the survival rate / total number indicates the level of protection, with 10 animals in each group. Serum neutralizing antibodies were determined using classic in vivo neutralization assays. At the level of protection, the HL and HN groups showed highly statistically significant differences compared to the Hc and HL-HN groups. ***p = 0.00001 < 0.001). ND indicates that no protective testing was performed for this dose group.

[0112] Example 4: Dose-dependent immunoprotective effects of H-type botulinum toxin functional domains Hc and L-HN protein antigens.

[0113] To further evaluate the protective efficacy of THc and TL-HN at low doses, this invention conducted a protective assay three weeks after immunization with these two protein antigens at different doses, once or twice. The dose-dependent immunization protective regimen of H-type botulinum toxin recombinant Hc and L-HN antigens is as follows: the antigen doses for the recombinant Hc and L-HN antigen and the Hc+L-HN combination group were 4000, 1000, 250, 62.5, 15.6, and 3.9 ng / animal, respectively, with one or two immunizations, and other details were the same as in Example 3 above. The single-immunization group received 10 ng / animal immunization three weeks after the first immunization. 2 LD 50 Toxins, the two-immunization group received 10 doses three weeks after the second immunization. 3 LD 50 The patients were attacked with the toxin and observed for one week. The number of survivors was then recorded. The median effective dose (ED) for each group was calculated using probabilistic analysis (SPSS 17.0-Probit). 50 The value is used to represent the efficacy of the vaccine.

[0114] The results shown in Table 5 indicate that all three immunization groups (HHc, HL-HN, and HHc+HL-HN) produced strong protective effects after immunization with different doses. The median effective dose (ED50) of the HHc, HL-HN, and HHc+HL-HN groups after a single immunization was [data missing]. 50 The ED50 values ​​were 96.419 ng, 673.105 ng, and 32.144 ng, respectively; the median effective dose (ED50) for the HHc, HL-HN, and HHc+HL-HN groups after two immunizations was 96.419 ng, 673.105 ng, and 32.144 ng. 50 The concentrations were 2.193 ng, 8.262 ng, and 4.478 ng, respectively.

[0115] The HHc antigen group produced a stronger protective effect compared to the HL-HN antigen group, indicating that it is the most potent subunit vaccine antigen. The HHc+HL-HN antigen group showed the highest protective efficacy after a single immunization, indicating a synergistic effect between the combined group and either HHc or HL-HN alone, demonstrating that more neutralizing antibody epitopes induced a stronger immune response; while the HHc antigen group showed the strongest protective effect after two immunizations. These results further demonstrate that HHc is far superior to HL-HN as an immunogenic antigen, especially under low-dose, fewer-immunization-time conditions, where its effect is more pronounced. Therefore, the results of this invention validate and support HHc as its protective antigen.

[0116] Table 5. Protective effects on mice immunized with different doses of recombinant HHc and HL-HN antigens of botulinum toxin type H.

[0117]

[0118] Note: The HHc+HL-HN group received combined immunization with two antigen groups; the single-immunization group received 10 doses three weeks after the first immunization. 2 LD 50 Toxins, the two-immunization group received 10 doses three weeks after the second immunization. 3 LD 50 The toxin was used to attack the target cells, and the survivors were observed for one week. The number of survivors was then tallied.

[0119] Example 5: Protective effect of H-type botulinum toxin functional domain epitope antigen protein on mice after immunization with A, F, and H-type botulinum toxins.

[0120] Given that both HL-HN and HHc functional domains are important protective antigens, and that they share sequence homology with functional domains associated with botulinum toxins A and F, this invention further investigated their cross-protective effects with botulinum toxins A and F. The experimental protocol was the same as in Example 3, with HL-HN and HHc immunization doses of 1 μg or 10 μg of antigen protein per mouse, followed by booster immunizations every 3 weeks (using the same amounts of antigen protein and aluminum adjuvant). Blood samples were collected from mice after two or three immunizations for protective testing.

[0121] Figure 5 The results shown in Figure B indicate that HL-HN and HHc immune serum antibodies showed cross-antibody reactions with both FL-HN and AHc, which is related to their high sequence homology with FL-HN and AHc. However, protective assays were performed on HL-HN and HHc functional domain antigens at doses of 1 μg and 10 μg, with 2 and 3 immunizations respectively. The results showed that the HL-HN recombinant antigen could not protect against 100 LD50. 50 Type F botulinum toxin offers no protection against its effects; however, the HHc antigen provides complete protection against 1000 LD. 50 The immune serum contained high titers of neutralizing antibodies after immunization with botulinum toxin type A at doses of 1 μg and 10 μg. The neutralizing antibody levels against botulinum toxin type H were 2.0 and 10.0 IU / ml, respectively, after two immunizations with the HHc functional domain, while the levels against botulinum toxin type A were 0.5 and 4.0 IU / ml, respectively, indicating cross-protective neutralizing antibodies. Therefore, these results suggest that the protective effect is directly related to neutralizing antibodies.

[0122] Furthermore, this invention continued to conduct a dose-dependent cross-immunoprotective study of recombinant HHc and recombinant AHc botulinum toxin. The protocol was as follows: the antigen doses of recombinant HHc and AHc were 4000, 1000, 250, 62.5, 15.6, and 3.9 ng / animal, respectively, with two immunizations, and other procedures were the same as in Example 3 above. Three weeks after one and two immunizations, each immunized group was challenged with BoNT / A and BoNT / H, respectively, and observed for one week. The survival rate was recorded, and the results are shown in Table 6. The protective test results showed that HHc and AHc not only produced a protective response against their own toxins, but also exhibited strong cross-protective responses with botulinum toxin A or H, respectively, and this cross-protective effect was antigen dose-dependent. The median effective dose (ED50) of the cross-protective effect of the HHc and AHc groups after one immunization was... 50 The doses were 40.479 ng and 1122.781 ng, respectively; the median effective dose (ED) of the cross-protective effect between the HHc and AHc groups after two immunizations was 40.479 ng and 1122.781 ng. 50 The concentrations were 32.144 ng and 55.816 ng, respectively.

[0123] Therefore, the results of this invention demonstrate that Hc, including HHc and AHc, are dominant protective antigen molecules with significant cross-protection against each other, and can be used to prepare vaccines and antitoxins to protect against each other's toxins. In our laboratory, the anti-AHc botulinum toxin antibody we prepared is capable of neutralizing H-type botulinum toxin, requiring four times the amount of anti-A-type botulinum toxin neutralizing antibody to completely neutralize the same amount of H-type botulinum toxin.

[0124] Meanwhile, the study found that BoNT / H's L-HN is unique. It does not cross-react with the protective antigen of type F botulinum toxin L-HN and cannot protect type F botulinum toxin. Therefore, it has significant differences in the functional domain of L-HN compared with existing botulinum toxins. Existing traditional antitoxins cannot neutralize this toxin and require 500 times more neutralizing antibodies to neutralize it. Therefore, this antibody drug cannot be used for specific treatment of it.

[0125] Table 6. Cross-protection results of Hc antigen protein immunization after H-type and A-type botulinum toxin receptor-binding domain.

[0126]

[0127]

[0128] Note: In the HHc immunization group, the group that received one immunization was given 10 doses three weeks after the first immunization. 2 LD 50 BoNT / A was used for protective testing; in the 2-immunization group, 10 mg of iodine was administered three weeks after the second immunization. 3 LD 50BoNT / A was used for protective testing; in the AHc immunization group, the single-immunization group received 10 doses three weeks after the first immunization. 2 LD 50 BoNT / H was used for protective testing. The group that received two immunizations received 10 mg of iodine three weeks after the second immunization. 3 LD 50 BoNT / H was subjected to a protective test; the number of survivors was counted after one week.

[0129] In summary, this invention utilized genetic engineering technology to prepare protein molecules of each functional domain of H-type botulinum toxin and investigated the immunoprotective efficacy of each recombinant protein antigen subunit vaccine. The results showed that among the functional domain protein antigens of H-type botulinum toxin, Hc and L-HN antigens exhibited excellent immunogenicity and immunoprotective effects, HN antigen provided general immunoprotection, and L antigens offered no protection. Further analysis revealed no cross-protection between HL-HN and F-type botulinum toxin, while HHc exhibited strong cross-protection with A-type botulinum toxin. Compared to L-HN antigen, Hc antigen demonstrated significant advantages and better efficacy in protective efficacy and neutralizing antibody production.

[0130] Therefore, the recombinant Hc protein antigen prepared in this invention is more effective than the L-HN antigen as an H-type botulinum toxin subunit vaccine, exhibiting better immunoprotective efficacy and application prospects. This Hc is not only an effective protective antigen but also exhibits cross-protective activity with type A botulinum toxin, and can be used to construct dual Hc fusion molecules as multivalent vaccines.

[0131] Example 6: Immunological effect of tetanus toxin and botulinum toxin type A double Hc fusion protein as a multivalent subunit vaccine

[0132] The recombinant protein antigens prepared in Example 2 above were used to immunize mice to test their immunogenicity and protective effect. Specifically, Balb / c mice (6-8 weeks old, female, SPF grade) were randomly divided into groups of 10 mice each. The immunization dose was either 1 μg or 4 μg of antigen protein per mouse. The negative control group was immunized with PBS containing no recombinant protein and with aluminum adjuvant (Alhydrogel) at a final concentration of 1 mg / ml. TM 2.0% (Brenntag Biosector product) was mixed and immunized with booster immunization every 3 weeks (the dosage of antigen protein and aluminum adjuvant was the same as above). After one or two immunizations, blood was collected from mice and then challenged with different biotoxins to evaluate the protective effect of the protein antigen.

[0133] Table 7 and Figure 6The results showed that both the AHc-THc and THc-AHc recombinant protein antigens elicited antibody responses against themselves, as well as immunoprotective effects against AHc and THc. Protective responses were generated in all immunization groups at different doses and numbers of immunizations, showing a positive dose-dependent relationship. After a single immunization, the protective effect against tetanus toxin was slightly weaker, but after two immunizations, both the AHc-THc and THc-AHc groups produced complete protection against tetanus toxin, exhibiting the same protective effect as the control group AHc+THc, indicating that there is no interaction between AHc and THc in the dual-Hc fusion molecule, and both combinations can exert an immune effect. In particular, the dual-Hc fusion molecules, as vaccines, both produced anti-AHc (… Figure 6 (B) and anti-THc ( Figure 6 The strong antibody response in C further demonstrates that the two antigenic components in the fusion molecule played their respective roles.

[0134] To further evaluate the protective efficacy of AHc-THc and THc-AHc at low doses, this invention conducted protective assays after immunizing these two protein antigens once or twice with different doses. The immunization protocol was as follows: the doses of each recombinant protein antigen were 1000, 250, 62.5, 15.6, and 3.9 ng / animal, respectively, with one or two immunizations, and other procedures were the same as above. Three weeks after immunization, each immunized group was challenged with different biotoxins, observed for one week, and the survival rate was recorded. The median effective dose (ED) for each group was calculated using probability analysis (SPSS 17.0-Probit). 50 The value is used to represent the efficacy of the vaccine.

[0135] The results shown in Tables 8 to 10 indicate that immunization with different doses of the THc-AHc, AHc-THc, and control AHc+THc combined groups all produced strong protective effects against both toxins, and there was no difference in protective efficacy among the three groups. Regarding tetanus toxin, the median effective dose (ED50) of the three vaccines after a single immunization was... 50 The effective doses were 8.17 ng, 31.45 ng, and 21.104 ng, respectively; the median effective dose (ED) of the three vaccines after two immunizations was... 50 The doses were 8.17 ng, 21.104 ng, and 31.225 ng, respectively. For botulinum toxin type A, the median effective dose (ED50) of the three vaccines after a single immunization is... 50 The doses were 223.721 ng, 31.45 ng, and 31.45 ng, respectively; the half-maximal effective dose (ED50) of the three vaccines after two immunizations. 50 They are 8.17ng, 8.17ng, and 8.17ng respectively.

[0136] Furthermore, the AHc-THc and THc-AHc molecular vaccines also provided complete protection against type H botulinum toxin after two immunizations, indicating that these RBD-based dual-fusion molecules can also produce cross-protection against type H botulinum toxin. Therefore, single-molecule AHc-THc and THc-AHc can serve as multivalent vaccine molecules, replacing combined group antigens, and can protect against three toxin pathogens, making them promising vaccine candidates.

[0137] Table 7. Immunoprotective effects of the tetanus toxin and botulinum toxin type A dual Hc fusion molecular vaccine against the two toxins.

[0138]

[0139] Note: Three weeks after the last immunization, protective experiments were conducted using different doses of botulinum toxin type A and tetanus toxin; serum neutralizing antibodies were determined using a classic in vivo neutralization assay. The survival count / total number indicates the level of protection, with 10 animals in each group of protected animals.

[0140] Table 8. Protective levels against two toxins in mice immunized with different doses of the dual-Hc fusion molecule THc-linker-AHc.

[0141]

[0142] Note: Protective experiments were conducted 3 weeks after the last immunization, using different doses of botulinum toxin type A and tetanus toxin. The survival count / total number indicates the level of protection, with 10 animals in each group receiving protection.

[0143] Table 9. Protective levels against two toxins in mice immunized with different doses of the dual-Hc fusion molecule AHc-linker-THc.

[0144]

[0145] Note: Protective experiments were conducted 3 weeks after the last immunization, using different doses of botulinum toxin type A and tetanus toxin. The survival count / total number indicates the level of protection, with 10 animals in each group receiving protection.

[0146] Table 10. Protective levels against the two toxins in mice immunized with different doses of the AHc+THc combined vaccine.

[0147]

[0148] Note: Protective experiments were conducted 3 weeks after the last immunization, using different doses of botulinum toxin type A and tetanus toxin. The survival count / total number indicates the level of protection, with 10 animals in each group receiving protection.

[0149] Example 7: Study on the immune effects of other types of botulinum toxin double Hc fusion molecular proteins as multivalent subunit vaccines

[0150] Based on the biosynthesis technology of multivalent biotoxin proteins assembled from dual receptor-binding domain (RBD), this invention also conducts research on the combination of other types of receptor-binding domain (RBD). Firstly, it explores the development of type A and type E botulinum toxin dual Hc fusion molecular protein vaccines (AHc-EHc and EHc-AHc). Figure 4 The immune effect of A) was evaluated. Immunization and protocol evaluation were the same as in Example 6, with 5 mice in each group. The immunization dose was 1 μg or 10 μg of antigen protein per mouse, and booster immunizations were performed 3 weeks apart. Blood samples were collected from the mice after the first and second immunizations, and the protective effect of the protein antigen was evaluated by challenge with different biotoxins.

[0151] The results in Table 11 show that AHc-EHc and EHc-AHc, as subunit vaccines, induced strong protective efficacy against type A botulinum toxin, but weak protective efficacy against type E botulinum toxin, requiring three immunizations to provide some protection. However, the combined AHc+EHc immunization group showed strong protective efficacy against both type A and type E botulinum toxin. These results suggest that the protective antigen of EHc in the dual Hc fusion molecule of type A and type E botulinum toxin is weakened. This effect may be related to the fact that type E botulinum toxin Hc is a weak protective antigen in the functional domain of type E botulinum toxin, while L-HN is a strong protective antigen (see patent ZL 201911292144.8 for details). Therefore, when studying the assembly of multivalent vaccines using type E botulinum toxin and other toxins, it is necessary to select EL-HN as the protective antigen. This theory and technique have been confirmed by our team.

[0152] Therefore, when combining dual Hc fusion molecules of various toxin types, it is necessary to consider the strength of their RBDs as protective antigens, supporting strong-strong fusion assembly. To validate this technology, this invention has conducted further confirmatory studies, such as the biosynthesis of dual Hc fusion molecules of type A or H and type B botulinum toxins as multivalent subunit vaccines. Figure 4The study investigated the immune effects of Hc fusion protein AHc and its combination with other Hc types. Immunization doses were 1 μg or 10 μg of antigen protein per mouse, with booster immunizations every 3 weeks. Three weeks after the two immunizations, mice were challenged with different biotoxins to evaluate the protective effect of the protein antigens. The results showed that other combinations, such as AHc-BHc and BHc-HHc, also produced strong protection against A, B, and H types of botulinum toxin, and the protective efficacy against the three toxins was comparable, with no significant difference in strength (Table 12). Previously, this study confirmed that A or H type Hc exhibits strong cross-protection due to high homology, with no difference in protective efficacy between them; both A-type and H-type Hc antigens can completely protect against A and H type botulinum toxins. The results of this dual Hc fusion molecule protein multivalent subunit vaccine further demonstrate the strong cross-protection of A or H type Hc in the fusion molecule and also confirm their applicability as a trivalent vaccine. These results further validate the feasibility of strong-strong combinations in the combination of A or H and B type dual Hc. Therefore, based on this principle, we can further verify the effectiveness of more combined candidate vaccine molecules.

[0153] In summary, the dual Hc fusion antigen molecular vaccine of the present invention can produce protective efficacy against two or three different serotype toxin pathogens and can be used as a broad-spectrum multivalent vaccine for biological defense against toxins.

[0154] Table 11. Immunoprotective effects of type A and type E botulinum toxin dual Hc fusion molecular protein vaccines against the two toxins.

[0155]

[0156] Note: Protective testing was conducted 3 weeks after the last immunization with different doses of botulinum toxin types A and E. The survival count / total number indicates the level of protection, with 5 animals per group. ND indicates that a protective test was not performed for this dose group.

[0157] Table 12. Immunoprotective effects of botulinum toxin dual Hc fusion molecular vaccine against three toxins

[0158]

[0159]

[0160] Note: Three weeks after each immunization, use 10... 3 Protective experiments were conducted using three different doses of botulinum toxin. The survival rate / total number indicates the level of protection, with 10 animals in each group receiving protection.

[0161] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A multivalent biological toxin molecular antigen vaccine, characterized in that: The active ingredient of the multivalent biological toxin molecular antigen vaccine is any one of the following: (A1) A fusion protein formed by linking the Hc antigen of botulinum toxin type A and the Hc antigen of tetanus toxin in the order from the amino terminus to the carboxyl terminus through a linker peptide is named AHc-THc. (A2) A fusion protein formed by linking the Hc antigen of tetanus toxin and the Hc antigen of botulinum toxin type A in the order from the amino terminus to the carboxyl terminus through a linker peptide is named THc-AHc. The amino acid sequence of the AHc-THc is shown in SEQ ID No. 18; The amino acid sequence of the THc-AHc is shown in SEQ ID No.

20.

2. The multivalent biological toxin molecular antigen vaccine according to claim 1, characterized in that: The linker peptide is (G4S)3.

3. The multivalent biological toxin molecular antigen vaccine according to claim 1 or 2, characterized in that: The amino acid sequence of the Hc antigen of the type A botulinum toxin is shown in SEQ ID No. 10; and / or The amino acid sequence of the Hc antigen of the tetanus toxin is shown in SEQ ID No.

16.

4. A method for preparing a multivalent biotoxin molecular antigen vaccine according to any one of claims 1-3, comprising the following steps: introducing a nucleic acid molecule encoding a fusion protein according to any one of claims 1-3 into Escherichia coli recipient cells to obtain recombinant Escherichia coli; culturing the recombinant Escherichia coli to obtain the fusion protein; and then using the fusion protein as an active ingredient to prepare the multivalent biotoxin molecular antigen vaccine.

5. The method according to claim 4, characterized in that: The nucleic acid molecule sequence encoding the Hc antigen of the type A botulinum toxin is shown in SEQ ID No. 9; The nucleic acid molecule sequence encoding the Hc antigen of the tetanus toxin is shown in SEQ ID No.

15.

6. The method according to claim 4 or 5, characterized in that: The nucleic acid sequence encoding the AHc-THc is shown in SEQ ID No. 17; and / or The nucleic acid molecule sequence encoding the THc-AHc is shown in SEQ ID No.

19.

7. Any of the following substances: (B1) Protein, which is the fusion protein described in any one of claims 1-3; (B2) Nucleic acid molecule, which is the nucleic acid molecule described in claim 4 or 6; (B3) Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the nucleic acid molecules described in (B2); (B4) Products for the prevention of poisoning symptoms caused by botulinum toxin and / or tetanus toxin, containing the protein described in (B1) or the nucleic acid molecule described in (B2) or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria described in (B3).

8. The use of the protein of claim 7 (B1) or the nucleic acid molecule of claim 7 (B2) or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria of claim 7 (B3) in the preparation of a product for the prevention of poisoning symptoms caused by botulinum toxin and / or tetanus toxin.