Monoclonal antibody of mycobacterium tuberculosis c-di-amp decomposing enzyme and preparation method and application thereof

Abstract

The application provides a Mycobacterium tuberculosis c-di-AMP decomposing enzyme monoclonal antibody and a preparation method and application thereof, and belongs to the technical field of biological medicine, wherein the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody are respectively shown as SEQ ID No. 1 and SEQ ID No. 2; the nucleotide sequences for coding the heavy chain variable region and the light chain variable region of the monoclonal antibody are respectively shown as SEQ ID No. 3 and SEQ ID No. 4. The monoclonal antibody mAb provided by the application can specifically recognize natural Mycobacterium tuberculosis c-di-AMP decomposing enzyme CnpB; through analysis, the CDR region sequence of the monoclonal antibody mAb is determined, which provides materials for laboratory CnpB and cyclic nucleotide molecule related research, and preparation of a reagent for diagnosing Mycobacterium tuberculosis infection, a drug or a vaccine for treating Mycobacterium tuberculosis infection in clinic.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to a monoclonal antibody against Mycobacterium tuberculosis c-di-AMP degrading enzyme, its preparation method and application. Background Technology

[0002] Cyclic diadenosine monophosphate (c-di-AMP) is a widely distributed second signaling molecule in bacteria. It is synthesized from ADP or ATP via diadenosine cyclase (DAC) and then cleaved by specific phosphodiesterases (PDEs) into linear pApA or AMP. Many bacteria, including Bacillus subtilis, Staphylococcus aureus, Listeria monocytogenes, Streptococcus pneumoniae, and Mycobacterium tuberculosis, can control the homeostasis of intracellular c-di-AMP by regulating DAC or PDE activity. Currently, three types of c-di-AMP-specific PDEs have been identified: PDEs containing the DHH / DHHA1 domain, PDEs containing the HD domain, and other types of PDEs (such as AtaC). Mutations or deletions in the PDE-encoding gene lead to increased c-di-AMP levels in bacteria, affecting a variety of physiological functions, including bacterial growth, cell wall integrity, fatty acid metabolism, potassium uptake, biofilm formation, pigment production, bacterial adaptation to environmental stress, and bacterial virulence.

[0003] Meanwhile, studies have confirmed that c-di-AMP also participates in regulating host adaptability and innate immune responses. During bacterial infection, c-di-AMP can not only activate STING-dependent type I interferon responses, but also induce autophagy, activate inflammasomes, and enhance BCG-induced training immunity. Furthermore, when c-di-AMP is used as a mucosal adjuvant, it can enhance mucosal immune responses induced by model antigens and pathogen-specific antigens, as well as Th1 / Th2 / Th17 immune responses. Therefore, c-di-AMP can serve as a target in bacterial drug and vaccine research and is considered a newly discovered pathogen-associated molecular model.

[0004] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (Mtb) infection, which seriously endangers human health. The inventor's team, through analysis of the Mtb genome sequence, has for the first time identified Rv2837c in Mtb as the unique c-di-AMP degrading enzyme, and named it CnpB (second cyclic nucleotide phosphodiesterase). CnpB is composed of 336 amino acids (aa) and has independent DHH (Asp-His-His) (15-202aa) and DHHA1 (DHH-associated domain 1) (220-336aa) domains. The DHH domain is essential for CnpB to decompose c-di-AMP (Jun Y, Yinlan B, Yang Z, et al. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection. [J]. Molecular microbiology, 2014, 93(1): 65-79.).Meanwhile, in vitro experiments confirmed that the recombinant CnpB protein has the activity of decomposing c-di-AMP. The levels of c-di-AMP in the recombinant MtbΔcnpB cells with CnpB knockout and in the culture supernatant secreted by the bacteria were significantly increased (Jun Y, Yinlan B, Yang Z, et al. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection.[J].Molecular microbiology,2014,93(1):65-79;Feng W, Qing H, Kaixuan S, et al. Structural and biochemical characterization of the catalytic domains of GdpP reveals a unified hydrolysis mechanism for the DHH / DHHA1 phosphodiesterase.[J].The Biochemical journal,2018,475(1):191-205;Jain RD, Bappaditya D, Yue Z, et al. Inhibition of innate immune cytosolic surveillance by an M. tuberculosis phosphodiesterase. [J]. Nature chemical biology, 2017, 13(2): 210-217.).

[0005] Studies on the role of CnpB in the pathogenicity of Mtb have found that MtbΔcnpB infection of mice and macrophages can induce an enhanced STING-dependent type I interferon response; the survival time of mice infected with MtbΔcnpB is significantly longer than that of wild-type Mtb-infected mice, the survival of recombinant bacteria in mice is reduced compared with wild-type strains, and the pathological damage to mouse lung tissue caused by infection is alleviated (Jun Y, Yinlan B, Yang Z, et al. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection.[J].Molecular microbiology,2014,93(1):65-79; Jain RD, Bappaditya D, Yue Z, et al. Inhibition of innate immunecytosolic surveillance by an M. tuberculosis phosphodiesterase.[J].Nature Chemical Biology, 2017, 13(2):210-217.). This indicates that CnpB is closely related to the pathogenicity of Mtb. By inhibiting CnpB activity, bacterial c-di-AMP levels are increased, thereby activating the host's innate immunity against Mtb. CnpB is a candidate target for novel drug research.

[0006] Researchers found that four FDA-approved PDE inhibitors, cilostazol (PDE3-I), cilostazol (PDE4-I), sildenafil (PDE5-I), and tadalafil (PDE5-I), all had varying degrees of inhibitory effects on CnpB activity; and small molecule analogs of c-di-AMP degradation product pApA could inhibit CnpB activity and promote c-di-AMP-induced type I interferon response (Jain RD, Bappaditya D, Yue Z, et al. Inhibition of innate immune cytosolic surveillance by an M. tuberculosis phosphodiesterase.[J]. Nature chemicalbiology,2017,13(2):210-217). In a mouse model of Mtb infection, the combined treatment of PDE inhibitors cilostazol and sildenafil with anti-tuberculosis drugs reduced histopathological damage in infected mice and promoted host clearance of Mtb, thus shortening the treatment period (Mamoudou M, Nisheeth A, C NA, et al. Successful shortening of tuberculosis treatment using adjuvant host-directed therapy with FDA-approved phosphodiesterase inhibitors in the mouse model.[J]. PloS one, 2012, 7(2).). Therefore, inhibiting CnpB activity may be a novel adjuvant therapy strategy for Mtb.

[0007] Previous studies by our research group have demonstrated that CnpB has strong immunogenicity, and immunization with recombinant CnpB protein can induce mice to produce high levels of specific antibodies. At the same time, high levels of CnpB-specific antibodies were detected in the serum of Mtb-infected mice and guinea pigs (Yanzhi L, Huanhuan N, Jian K, et al. Cyclic-di-AMP Phosphodiesterase Elicits Protective Immune Responses Against Mycobacterium tuberculosis H37Ra Infection in Mice[J]. Frontiers in Cellular and Infection Microbiology, 2022, 12: 871135), suggesting that CnpB can serve as a target for diagnosing Mtb infection.

[0008] Monoclonal antibodies (mAbs) possess excellent specificity, making them important tools for studying target protein function and crucial materials for developing diagnostic reagents and targeted therapies. A search revealed that there is currently no research on monoclonal antibodies targeting the Mtb c-di-AMP degrading enzyme CnpB, either domestically or internationally. Summary of the Invention

[0009] In view of this, the purpose of the present invention is to provide a monoclonal antibody, its preparation method and application, wherein the monoclonal antibody is unique and can specifically recognize the natural CnpB protein, and has good specificity.

[0010] To achieve the above objectives, the present invention provides the following technical solution:

[0011] This invention provides a monoclonal antibody against Mycobacterium tuberculosis cyclic diadenosine monophosphate degrading enzyme, the amino acid sequence of its heavy chain variable region is shown in SEQ ID No. 1, and the amino acid sequence of its light chain variable region is shown in SEQ ID No. 2.

[0012] The present invention also provides a nucleic acid molecule encoding the monoclonal antibody, wherein the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No. 3, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID No. 4.

[0013] The present invention also provides the application of the monoclonal antibody in the preparation of reagents for diagnosing Mycobacterium tuberculosis infection.

[0014] The present invention also provides the use of the monoclonal antibody in the preparation of a medicament for treating Mycobacterium tuberculosis infection.

[0015] The present invention also provides the application of the monoclonal antibody in the preparation of tuberculosis vaccines.

[0016] The present invention also provides the application of the nucleic acid molecule in the preparation of small molecule genetically engineered antibodies.

[0017] Preferably, the small molecule genetically engineered antibody includes ScFv antibody, Fab antibody, F(ab)2 antibody, and antibody fusion protein.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) The present invention successfully obtained the amino acid sequences of the heavy chain and light chain variable regions of monoclonal antibody mAb and the nucleotide sequences encoding the heavy chain and light chain variable regions of monoclonal antibody mAb. Homology analysis results show that the sequences in the present invention are unique.

[0020] (2) The monoclonal antibody mAb in this invention can specifically recognize the natural CnpB protein and has good specificity. Through analysis, this invention has determined the CDR region sequence of the monoclonal antibody mAb, providing materials for the diagnosis, detection and function study of Mtb infection in the laboratory and in clinical practice. Attached Figure Description

[0021] Figure 1 This is a graph showing the results of the detection of monoclonal antibody mAb subclasses;

[0022] Figure 2 The results are for the detection of monoclonal antibody mAb titers;

[0023] Figure 3 The results are for the detection of the equilibrium dissociation constant of monoclonal antibody mAbs;

[0024] Figure 4 This is a graph showing the results of detecting the specificity of monoclonal antibody mAbs using Western blotting. Detailed Implementation

[0025] This invention provides a monoclonal antibody against Mycobacterium tuberculosis cyclic diadenosine monophosphate degrading enzyme, the amino acid sequence of its heavy chain variable region is shown in SEQ ID No. 1, and the amino acid sequence of its light chain variable region is shown in SEQ ID No. 2.

[0026] In this invention, the amino acid sequences of the heavy chain variable region and the light chain variable region are shown in Table 1.

[0027] Table 1. Amino acid sequences of the heavy chain variable region and the light chain variable region.

[0028]

[0029] Note: "_" represents "CDR area".

[0030] The present invention also provides a nucleic acid molecule encoding the monoclonal antibody, wherein the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No. 3, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID No. 4.

[0031] In this invention, the nucleotide sequences encoding the heavy chain variable region and the light chain variable region are shown in Table 2.

[0032] Table 2. Nucleotide sequences encoding the heavy chain variable region and the light chain variable region.

[0033]

[0034]

[0035] The present invention also provides the application of the monoclonal antibody in the preparation of reagents for diagnosing Mycobacterium tuberculosis infection.

[0036] The present invention also provides the use of the monoclonal antibody in the preparation of a medicament for treating Mycobacterium tuberculosis infection.

[0037] The present invention also provides the application of the monoclonal antibody in the preparation of tuberculosis vaccines.

[0038] The present invention also provides the application of the nucleic acid molecule in the preparation of small molecule genetically engineered antibodies.

[0039] In this invention, the small molecule genetically engineered antibodies include ScFv antibodies, Fab antibodies, F(ab)2 antibodies, and antibody fusion proteins.

[0040] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1: Preparation and Performance Determination of Monoclonal Antibody mAbs

[0042] 1.1 Preparation and purification of monoclonal antibodies

[0043] Following the methods described in "Jun Y, Yinlan B, Yang Z, et al. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection. [J]. Molecular microbiology, 2014, 93(1): 65-79" and "Yanzhi L, Huanhuan N, Jian K, et al. Cyclic-di-AMP Phosphodiesterase Elicits Protective Immune Responses Against Mycobacterium tuberculosis H37Ra Infection in Mice [J]. Frontiers in Cellular and Infection Microbiology, 2022, 12: 871-135," the CnpB encoding gene was amplified by PCR using the Mtb H37Rv genome as a template, cloned into the prokaryotic expression vector pET28a(+), and the target protein was induced by IPTG. Ni 2+Recombinant CnpB protein was purified by affinity chromatography.

[0044] Monoclonal antibodies were prepared according to the method described in "Practical Monoclonal Antibody Technology" (edited by Xu Zhikai, Xi'an: Shaanxi Science and Technology Press, pp. 9-11). The specific steps are as follows:

[0045] Female BALB / c mice (purchased from the Experimental Animal Center of Air Force Medical University) were immunized with purified recombinant CnpB protein. The initial subcutaneous immunization was performed with 50 μg of antigen per mouse plus Freund's incomplete adjuvant. Two weeks later, two more subcutaneous immunizations were performed. For the third subcutaneous immunization, 25 μg of antigen per mouse was used. One week after the third immunization, blood was collected from the tail vein to detect the immunization effect.

[0046] Boost immunization of mice: 25 μg of antigen per mouse; three days after completion, mice were sacrificed, and mouse spleen lymphocyte suspensions were prepared and counted.

[0047] Count the SP2 / 0 cells of mouse myeloma cells in the logarithmic growth phase, and use 5 × 10⁻⁶ cells. 4 One myeloma cell and 1×10 4 Cell fusion was performed on 1000 spleen lymphocytes. The fused cell suspension was then added to a solution containing 1×10 ... 4 Feeder cells (normal female BALB / c mouse peritoneal macrophages) were cultured in 96-well plates at 37°C and 5% CO2. After cell clones appeared, the cell supernatant was collected, and antibody levels were detected by indirect ELISA to select positive clones. Cells containing positive clones were cloned using limiting dilution until a hybridoma cell line capable of stably secreting antibodies was obtained, named CnpB mAb.

[0048] The Ig subclass of the monoclonal antibody mAb secreted by this hybridoma cell strain was determined, and the results are as follows: Figure 1 As shown. By Figure 1 It can be seen that this monoclonal antibody is an IgG1 subclass, κ type light chain.

[0049] 1.2 Monoclonal antibody titer and affinity determination

[0050] The titer of monoclonal antibody mAbs was detected using an indirect ELISA method: the coating antigen was purified CnpB protein, the test sample was serially diluted purified mAb, the detection antibody was HRP-goat anti-mouse IgG, the chromogenic substrate was TMB, and the chromogenic stop solution was 2M H2SO4. Results are as follows: Figure 2 As shown.

[0051] ELISA results showed that the titer of the monoclonal antibody mAb was 1:51200.

[0052] The equilibrium dissociation constant (Kab) of mAb was determined using a competitive ELISA method.D Specifically, after the purified monoclonal antibody mAb is incubated with serially diluted CnpB antigen, the reaction solution is added to an ELISA plate coated with CnpB protein, the secondary antibody is incubated, chromogenic solution is added for color development, and OD is detected. 450 The result is as follows Figure 3 As shown.

[0053] Competitive ELISA results showed that the equilibrium dissociation constant K of monoclonal antibody mAb was... D The value is 2μM.

[0054] 1.3 Recognition of recombinant CnpB protein by monoclonal antibody mAb

[0055] The protein marker and recombinant CnpB protein were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoresis conditions were 120V for 15 min and 160V for 40 min. After electrophoresis, the membrane was transferred at 100V for 1 h and blocked at 25℃ for 1 h. The membrane was incubated at 37℃ for 1 h with mAb as the primary antibody. The secondary antibody was HRP-goat anti-mouse IgG. The recognition of the recombinant protein by mAb was detected by ECL luminescence assay. The results are as follows: Figure 4 As shown.

[0056] The results showed that the monoclonal antibody mAb could specifically recognize the recombinant CnpB protein, with a specific band at 35 kDa, indicating that the mAb had good specificity.

[0057] 1.4 Recognition of native CnpB protein in bacteria by monoclonal antibodies

[0058] The coding sequences of the CnpB protein in Mtb and BCG are completely identical. Due to the high biosafety requirements of Mtb manipulation, wild-type BCG bacterial protein was prepared according to the method described in "Ning H, Wang L, et al. Recombinant BCG With Bacterial Signaling Molecule Cyclic di-AMP as Endogenous Adjuvant Induces Elevated Immune Responses After Mycobacterium tuberculosis Infection[J]. Frontiers in Immunology, 2019, 10: 1519." The recognition ability of the monoclonal antibody mAb for the bacterial protein was analyzed using Western blotting. The results are as follows... Figure 4 As shown.

[0059] The results showed that the monoclonal antibody mAb could specifically recognize the CnpB protein in wild-type BCG cells, indicating that the monoclonal antibody mAb had good specificity.

[0060] Example 2: Cloning of the variable region genes of the heavy and light chains of monoclonal antibodies

[0061] Hybridoma cells secreting monoclonal antibodies were cultured in RPMI 1640 complete medium (purchased from HyClone) at 37°C in a 5% CO2 incubator until the logarithmic growth phase. Total RNA was extracted from the hybridoma cells using the TRIZol lysis method, and after quantification, cDNA was synthesized using a reverse transcription kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). Using the cDNA as a template and the primer pairs in Table 3 as primers, the variable region sequence was amplified by PCR to obtain the PCR amplification product.

[0062] The PCR reaction system consisted of 50 μL, and the amplification program was as follows: 95℃ for 1 min; 95℃ for 5 s, 58℃ for 30 s, 72℃ for 1 min, for 35 cycles; 72℃ for 5 min.

[0063] Table 3. Nucleotide sequences of primer pairs (5'→3')

[0064]

[0065] Note: The primers in parentheses are degenerate primers.

[0066] The PCR amplification products were subjected to 1% agarose gel electrophoresis. The target gene fragment was purified using a DNA purification kit (purchased from Chongqing Qingke Xingye Biotechnology Co., Ltd.). The purified target gene fragment was ligated with the pMD19-T vector at 16℃ for 30 min. The ligation product was transformed into E. coli DH5α competent cells and plated on LB agar plates containing ampicillin (Amp) antibiotic. After incubation at 37℃ for 8 h, single colonies were picked from the plates. Using the plasmid in the colony as a PCR template, PCR amplification was performed using the primers listed in Table 3 to obtain the PCR product. The PCR product was detected by 1% agarose gel electrophoresis to identify positive clones. The formulation of the LB agar plate was: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, pH 7.2.

[0067] Transformants that were identified as positive by PCR were cultured in expanded culture, and plasmids were extracted and sent to Qingke Xingye Technology Co., Ltd. for DNA sequencing.

[0068] The DNA sequencing results are as follows: the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No. 3, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID No. 4. The DNA sequences were translated using DNAMAN software to obtain the amino acid sequences: the amino acid sequence of the monoclonal antibody heavy chain variable region is shown in SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO. 2.

[0069] Example 3 Homology Analysis

[0070] 3.1 Homology analysis of nucleotide sequences encoding the variable region of monoclonal antibodies

[0071] After sequencing the variable region, the nucleotide sequences encoding the heavy and light chain variable regions of the monoclonal antibody mAb were aligned using the NCBI (GenBank+EMBL+DDBJ+PDB) database (http: / / www.ncbi.nlm.nih.gov / blast) and the IMGT database (http: / / www.imgt.org) to analyze sequence homology. The obtained sequences were compared with the homology of various other reported antibody genes to analyze their germline gene origin.

[0072] Sequence alignment results showed that the nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody mAb had the highest homology with the gene sequence of the mouse Ig heavy chain variable region (GenBank: KT726209.1), at 333 / 357 (93%). The gene sequence encoding the light chain variable region of the monoclonal antibody mAb had the highest homology with the gene sequence of the mouse Ig light chain variable region (GenBank: JX492418.1), at 326 / 331 (98%). The results are as follows:

[0073] (1) Encoding monoclonal antibody heavy chain <400> germline gene origin of 1

[0074] V-GENE: Musmus IGHV1-37*01F

[0075] J-GENE: Musmus IGHJ3*01F

[0076] D-GENE: Musmus IGHD2-3*01F

[0077] Analysis using FR-IMGT and CDR-IMGT showed that:

[0078] CDR1:GGTTACTCATTTACTGGCTACTTT(SEQ ID No.9)

[0079] CDR2: ATTAATCCTTACAATGGTGATATT (SEQ ID No.10)

[0080] CDR3: GGAAGAGGGGATGGTTACTCCTGTTTGCTTAC (SEQ ID No. 11)

[0081] The homology comparison results from NCBI show:

[0082] RID:27970KFH013

[0083] Query Length: 354

[0084] Database Name:All non-redundant GenBank+EMBL+DDBJ+PDB+RefSeqsequences(no EST,STS,GSS,WGS,TSA,patent sequences or HTGS sequences)

[0085] Sequence ID:KT726209.1Mus musculus strain muMT / BALB / c clone muMTL2-4immunoglobulin deltaheavy chain mRNA,partial cds

[0086] Length: 385

[0087] Score: 521 bits (282)

[0088] Expect:3e-143

[0089] Identities: 333 / 357 (93%)

[0090] Gaps: 6 / 357 (1%)

[0091] Strand:Plus / Plus

[0092] (2) Encoding the light chain of monoclonal antibodies <400> Germline gene origin of 3:

[0093] V-GENE: Musmus IGKV1-135*01F

[0094] J-GENE: Musmus IGKJ1*01F

[0095] Analysis using FR-IMGT and CDR-IMGT showed that:

[0096] CDR1:CAGAGCCCTTAGATAGTGATGGAAAGACATAT(SEQ ID No.12)

[0097] CDR2: CTGGTGTCT(SEQ ID No.13)

[0098] CDR3: TGGCAAGGTACACATTTTCCTCAGACG (SEQ ID No.14)

[0099] The homology comparison results from NCBI show:

[0100] RID:2X37ANZ2013

[0101] Query Length: 337

[0102] Database Name:All non-redundant GenBank+EMBL+DDBJ+PDB+RefSeqsequences(no EST,STS,GSS,WGS,TSA,patent sequences or HTGS sequences)

[0103] Sequence ID:JX492418.1Mus musculus clone FS2-03 immunoglobulin lightchain variable region mRNA,partial cds

[0104] Length: 337

[0105] Score: 584 bits (316)

[0106] Expect:3e-162

[0107] Identities: 326 / 331 (98%)

[0108] Gaps: 0 / 331 (0%)

[0109] Strand:Plus / Plus

[0110] Sequence homology analysis showed that the nucleotide sequences of the heavy and light chain variable regions encoding the monoclonal antibody mAb originated from mouse germline genes, but were not completely consistent with the gene sequences of various previously reported monoclonal antibodies, indicating that the present invention is unique in terms of gene sequence.

[0111] 3.2 Homology analysis of amino acid sequences in the variable region of monoclonal antibodies

[0112] The amino acid sequence of the heavy chain variable region of the monoclonal antibody mAb is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2. Amino acid sequence homology analysis was performed in the non-redundant GenBank CDS translations+PDB+SwissProt+PIR+PRF protein database.

[0113] The analysis results showed that the heavy chain amino acid sequence of the monoclonal antibody mAb had the highest homology with the mouse Ig heavy chain variable region protein (AAD47016.1), at 10³ / 118 (87%). The light chain amino acid sequence of the monoclonal antibody mAb had the highest homology with the mouse Ig light chain variable region protein (AGN91335.1), at 10⁷ / 112 (96%). The homology comparison results for the heavy and light chain amino acids are as follows:

[0114] (1) Monoclonal antibody heavy chain amino acid sequence <400> 2. Comparison Results:

[0115] RID:2XKXUJMS013

[0116] Query ID:lcl|Query_12029

[0117] Query Length: 118

[0118] Database Name:All non-redundant GenBank CDS translations+PDB+SwissProt+PIR+PRF excluding environmental samples from WGS projects

[0119] Sequence ID:AAD47016.1 immunoglobulinheavy chainvariable region,partial[Mus musculus]

[0120] Length: 117

[0121] Score: 214 bits (544)

[0122] Expect:2e-69

[0123] Identities: 103 / 118 (87%)

[0124] Positives: 109 / 118 (92%)

[0125] Gaps: 1 / 118 (0%)

[0126] (2) Monoclonal antibody light chain amino acid sequence <400> 4. Homology alignment results:

[0127] RID:2XMCT98A013

[0128] Query ID:lcl|Query_76100

[0129] Query Length: 112

[0130] Database Name:All non-redundant GenBank CDS translations+PDB+SwissProt+PIR+PRF excluding environmental samples from WGS projects

[0131] Sequence ID:AGN91335.1 immunoglobulin light chain variable region,partial[Mus musculus]

[0132] Length: 112

[0133] Score: 221 bits (562)

[0134] Expect:3e-72

[0135] Identities: 107 / 112 (96%)

[0136] Positives: 110 / 112 (98%)

[0137] Gaps: 0 / 112 (0%)

[0138] Homology analysis showed that the amino acid sequences of the heavy and light chain variable regions of the monoclonal antibody mAb were mouse-derived proteins. Although they were homologous to the amino acid sequences of other proteins, no amino acid sequences were found that were exactly the same as those of the present invention, indicating that the present invention is also unique in terms of amino acid sequence.

[0139] Example 4: Determining the CDR Area

[0140] The heavy and light chain variable region sequences of the monoclonal antibody mAb obtained from sequencing were analyzed on the VBASE2 website (http: / / www.vbase2.org / vbase2.php) to obtain its CDR region.

[0141] The heavy chain variable region of the monoclonal antibody mAb contains three complementarity-determining regions (CDRs), as shown below:

[0142] CDR1: Gly-Tyr-Ser-Phe-Thr-Gly-Tyr-Phe (SEQ ID No. 15)

[0143] CDR2: Ile-Asn-Pro-Tyr-Asn-Gly-Asp-Ile (SEQ ID No. 16)

[0144] CDR3: Gly-Arg-Glu-Gly-Trp-Leu-Leu-Leu-Phe-Ala-Tyr (SEQ ID No. 17)

[0145] The sequences of the three complementarity-determining regions (CDRs) in the light chain variable region of a monoclonal antibody mAb are shown below:

[0146] CDR1: Gln-Ser-Leu-Leu-Asp-Ser-Asp-Gly-Lys-Thr-Tyr (SEQ ID No. 18)

[0147] CDR2: Leu-Val-Ser(SEQ ID No.19)

[0148] CDR3: Trp-Gln-Gly-Thr-His-Phe-Pro-Gln-Thr (SEQ ID No. 20)

[0149] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A monoclonal antibody against Mycobacterium tuberculosis cyclic diadenosine monophosphate degrading enzyme, characterized in that, The amino acid sequence of its heavy chain variable region is shown in SEQ ID No. 1, and the amino acid sequence of its light chain variable region is shown in SEQ ID No.

2.

2. A nucleic acid molecule encoding the monoclonal antibody of claim 1, characterized in that, The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No. 3, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID No.

4.

3. The use of the monoclonal antibody as described in claim 1 in the preparation of reagents for diagnosing Mycobacterium tuberculosis infection.

4. The use of the monoclonal antibody as described in claim 1 in the preparation of a medicament for treating Mycobacterium tuberculosis infection.

5. The use of the monoclonal antibody as described in claim 1 in the preparation of a tuberculosis vaccine.

6. The use of the nucleic acid molecule as described in claim 2 in the preparation of small molecule genetically engineered antibodies against Mycobacterium tuberculosis.

7. The application according to claim 6, characterized in that, The small molecule genetically engineered antibodies include ScFv antibodies, Fab antibodies, F(ab)2 antibodies, and antibody fusion proteins.

Images