Use of beta-nicotinamide mononucleotide in preparation of preparation for promoting placental angiogenesis of sows and feed

Abstract

The present application relates to the application of beta-nicotinamide mononucleotide in the preparation of preparations for promoting placental angiogenesis of sows, 2g-5g of beta-nicotinamide mononucleotide is added in feed every day from the 70th day of pregnancy of sows to the end of delivery. By recording the number of piglets, piglet birth weight and other data, it is found that beta-nicotinamide mononucleotide can significantly increase the number of live piglets, the number of healthy piglets, the initial litter weight, the initial individual weight, and significantly reduce the weak piglet rate. The placental HE staining results show that the addition of beta-nicotinamide mononucleotide in the gestational diet significantly improves the placental vascular density, and the correlation analysis shows that the placental vascular density is significantly positively correlated with the initial individual weight of piglets, the addition of beta-nicotinamide mononucleotide in the diet of pregnant sows significantly improves the expression of placental angiogenesis related genes CD31, FLK1 and VEGF-A mRNA, indicating that beta-nicotinamide mononucleotide plays an important role in promoting placental angiogenesis of sows.

Description

Technical Field

[0001] This invention belongs to the field of feed, specifically relating to the application of β-nicotinamide mononucleotide in the preparation of formulations that promote placental angiogenesis in sows and its application in feed. Background Technology

[0002] Placental vascular density is directly related to the growth and development of the embryo / fetus or its organs in mammals during pregnancy. Low placental vascular density can affect the birth weight of newborn piglets and negatively impact their subsequent growth and development, leading to increased morbidity and mortality, metabolic disorders, and decreased growth performance. Nicotinamide mononucleotide (NMN) is a naturally occurring bioactive nucleotide. NMN is a precursor to nicotinamide adenine dinucleotide (NAD+), which can be converted into NAD+ in mammals. NAD+, also known as coenzyme I, is widely distributed in all cells and participates in thousands of biocatalytic reactions, making it an essential coenzyme. Currently, NMN is known for its anti-aging and life-extending effects and is commonly used in food additives and cosmetics. However, whether there is a relationship between NMN and placental vascular density in pregnant sows remains unknown. Summary of the Invention

[0003] To address the technical problems mentioned above, this invention provides the application of β-nicotinamide mononucleotide in the preparation of formulations that promote placental angiogenesis in sows.

[0004] As a further explanation of the present invention, the β-nicotinamide mononucleotide can increase the number of live piglets, the number of healthy piglets, the initial litter weight, the average weight of newborn individuals, and reduce the rate of weak piglets.

[0005] The present invention also provides a feed that promotes placental angiogenesis in sows, the feed containing β-nicotinamide mononucleotide.

[0006] As a further illustration of the invention, the feed is used to feed pregnant sows.

[0007] As a further illustration of the invention, the feed is used to feed sows from 70 days of gestation to the parturition stage.

[0008] As a further illustration of the present invention, the β-nicotinamide mononucleotide is added to the diet of sows at a rate of 2 g-5 g / day.

[0009] Compared with the prior art, the present invention has the following beneficial technical effects: The β-nicotinamide mononucleotide (NMN) provided in this invention can significantly increase the number of live piglets, the number of healthy piglets, the litter weight at birth, and the average weight of newborn piglets, while significantly reducing the rate of weak piglets. Placental HE staining results showed that adding NMN to the gestation diet significantly increased placental vascular density. Furthermore, correlation analysis revealed a significant positive correlation between placental vascular density and the birth weight of piglets. In addition, adding NMN to the diet of pregnant sows significantly increased the mRNA expression levels of placental angiogenesis-related genes CD31, FLK1, and VEGF-A, indicating that NMN plays an important role in promoting placental angiogenesis in sows, thereby increasing the number of live piglets, the number of healthy piglets at birth, the litter weight at birth, and the average weight of newborn piglets. Attached Figure Description

[0010] Figure 1 is a sow placental vascular density map provided by the present invention, where A is placental HE staining, the arrow indicates placental blood vessels, and B is placental vascular density.

[0011] Figure 2 This is a correlation analysis diagram of placental vascular density and piglet birth weight provided by the present invention.

[0012] Figure 3 This is a placental expression level diagram provided by the present invention, wherein D is the placental CD31 mRNA expression level, E is the placental VEGF-A mRNA expression level, and F is the placental FLK1 mRNA expression level. Detailed Implementation

[0013] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Example 1

[0014] 1. Feeding and Management of Experimental Animals This experiment selected 60 primiparous Landrace × Large White crossbred sows of similar age and weight, and randomly divided them into three treatment groups, with 20 sows in each group and one sow per replicate. The control group (NC) was fed a basal gestation diet, the low-dose group (2g / d) received 2g / d NMN supplemented to the basal gestation diet, and the high-dose group (5g / d) received 5g / d NMN supplemented to the basal gestation diet. The experiment lasted 44 days from day 70 of gestation to the end of farrowing. The sows were synchronized in estrus, mated, and farrowed. During gestation, any sows that were not pregnant or returned to estrus were observed and culled. The final replicate number for each treatment group was 15 sows. All sows were housed in individual pens, and the temperature in the pens was maintained at 18-22 ℃. During gestation, sows were fed a restricted diet, specifically 2.2 kg / day from gestation days 0-90 and 2.5 kg / day from gestation days 91-114. Feeding was done at 7:30 AM daily, with free access to feed and water. Throughout the experiment, all sows consumed their daily rations without exhibiting any signs of fasting.

[0015] 2. Determination of sow reproductive performance On the day of farrowing, record the total number of piglets born, the number of live piglets, the number of healthy piglets, the number of weak piglets, the number of mummified litters, and the number of stillbirths, and calculate the weak piglet rate of the sow. At the same time, weigh the newborn piglets and calculate the initial litter weight of the piglets. Piglets with an initial weight of ≤0.9kg are recorded as weak piglets.

[0016] 3. Placental sample collection On the day of farrowing, as soon as the piglets are born, quickly clamp the umbilical cord at one end of the sow's arm and the other end of the piglet's arm with hemostatic forceps. Tie sterilized cotton thread with labels to both ends of the umbilical cord, then cut the umbilical cord in the middle, allowing the labeled cotton thread to retract back into the sow's body so that the placenta can be matched with each piglet after it is expelled. After the sow has finished farrowing and the placenta has been delivered, separate the individual placentas and weigh them.

[0017] Collection of placental molecular biology samples: After the sow placenta is delivered, the placental membrane and connective tissue are peeled off, and three placental samples of about 5 g each are cut from the same part of each placenta, placed in cryovials, and quickly frozen with liquid nitrogen and stored in a freezer at -80°C for subsequent index determination.

[0018] Collection of placental morphological samples: After the sow's placenta is delivered, the placental membrane and connective tissue are peeled off, and a 5*5 cm sample is cut from approximately 5 cm above the umbilical cord. 2 Placental tissue was preserved in 4% paraformaldehyde for subsequent HE staining.

[0019] 4. Placental vascular density analysis Placental tissue embedded in 4% paraformaldehyde was paraffin-embedded and sectioned, then stained with hematoxylin and eosin (HE). The stained sections were photographed under a microscope, with three fields of view randomly selected from each section. The placental vascular area and density were measured using ImageJ, calculated as: placental vascular density = total stromal vascular area / stromal area × 100%.

[0020] 5. Extraction of RNA from placental tissue The sample was removed from the -80°C freezer, and 100 mg of tissue sample was accurately weighed. The sample was washed with PBS solution to remove surface blood. The washed sample was transferred to a mortar and ground using liquid nitrogen. The ground powder was quickly transferred to a pre-cooled centrifuge tube. Placental tissue RNA was extracted according to the Trizol reagent instructions through steps such as lysis, precipitation, extraction, purification, washing, and drying. The concentration was measured using a Nano Drop One spectrophotometer. The RNA sample with a total RNA concentration of 3000 ng was used for reverse transcription to synthesize cDNA and stored at -20°C for later use.

[0021] 6. Real-time quantitative PCR Add 4 μL of cDNA diluted 10-fold, 5 μL of 2×PerfectStart@Green qPCRSuperMix, 0.2 μL of upstream primer, and 0.2 μL of downstream primer to a 96-well plate, and then bring the volume to 10 μL / well with 0.6 μL of sterile water. Each sample was tested in duplicate, and B2M1 was used as an internal control for tissue calibration. Results were calculated using the 2-ΔΔct method. Primer sequences for each target gene were designed using NCBI primer design software and synthesized by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). The primer sequences used in the experiment are shown in Table 1.

[0022] Table 1 Primer sequences for real-time PCR VEGF-A ATGGCAGAAGGAGACCAGAA ATGGCGATGTTGAACTCCTC Ang 1 TTGGTCTTCATGCTGGGTCT GTGTTGACCTCTTTGCAGGG FLK 1 GATGCTCGCCTCCCTTTGA GAGTACGTGAAGCCGCTGTTG PLGF GGAGACGGTCAATGTCACCAT GAGAATGTCAGCTCCACGTAG CD31 CGAGGTCTGGGAACAAAGGG AGCCTTCCGTTCTAGAATATCTGTT B2M1 CAAGATAGTTAAGTGGGATCGAGAC TGGTAACATCAATACGATTTCTGA 7. Statistical Methods After initial recording and processing of the raw data using Excel, the tabular data were analyzed using SPSS 28 software using one-way ANOVA. Different lowercase letters in the same row headings indicate significant differences (P < 0.05), and different uppercase letters indicate extremely significant differences (P < 0.01).

[0023] 8 Results At farrowing, piglets and placentas were weighed and statistically analyzed. The results showed that adding 2 g / d NMN to the gestation diet significantly increased the number of live piglets, the number of healthy piglets born, and the birth litter weight and average birth weight of piglets (P<0.05). Adding 5 g / d NMN significantly increased the average birth weight of piglets (P<0.05). Adding NMN to the gestation diet significantly reduced the number and rate of weak piglets born to sows (P<0.05) (Table 3). These results indicate that adding NMN to the gestation diet can significantly improve the reproductive performance and litter quality of sows.

[0024] Table 3. Effects of NMN supplementation in gestation diets on reproductive performance of sows.

[0025] After farrowing, the placenta was collected from the sow and stored in 4% paraformaldehyde solution. It was then embedded in paraffin and sectioned for HE and IF staining. The results showed that, compared with the control group, the addition of NMN to the gestation diet significantly increased placental vascular density (P < 0.01) (Figure 1 A, B). Correlation analysis also revealed a significant positive correlation between placental vascular density and the birth weight of piglets (P < 0.05). Figure 2 Quantitative fluorescence results showed that, compared with the control group, the addition of NMN to the gestational diet significantly increased the expression levels of placental CD31, FLK1, and VEGF-A mRNA (P < 0.05). Figure 3 DF).

[0026] It should be noted that, in this document, terms such as “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0027] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. The application of β-nicotinamide mononucleotide as the sole active ingredient in the preparation of formulations that promote placental angiogenesis in sows, characterized in that, The preparation that promotes placental angiogenesis in sows can increase the number of live piglets, the number of healthy piglets, the initial litter weight, the average weight of newborn piglets, and reduce the rate of weak piglets.

Images