Pseudomonas xy-1 and application thereof in carbon dioxide reduction for producing acetic acid
By using Pseudomonas XY-1 to reduce carbon dioxide to acetic acid under specific conditions, the problem of converting carbon dioxide into valuable chemicals in existing technologies has been solved, achieving a highly efficient biological reduction effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV OF TECH
- Filing Date
- 2024-09-19
- Publication Date
- 2026-06-19
AI Technical Summary
There is a lack of effective methods in the current technology to reduce carbon dioxide into valuable chemicals, such as acetic acid, and biological methods are more environmentally friendly than other methods.
Under specific conditions, Pseudomonas XY-1 was inoculated into an inorganic salt culture medium and then subjected to the reduction of carbon dioxide to produce acetic acid. The optimal ferrous concentration was 10 mg/L.
Under optimal conditions, Pseudomonas XY-1 can reduce carbon dioxide to acetic acid up to a maximum cumulative amount of 73.11 mg/L, demonstrating significant reducing power and chemical production potential.
Smart Images

Figure CN118956687B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a strain of Pseudomonas XY-1 and its application in the production of acetic acid by carbon dioxide reduction. Background Technology
[0002] Global warming is one of the most severe challenges facing humanity today, with massive emissions of greenhouse gases accelerating the rise in global temperatures. In 2023, global energy-related carbon dioxide emissions increased by 1.1%, adding 410 million tons to reach a record high of 37.4 billion tons. Sources of atmospheric CO2 include: the combustion of fossil fuels (coal, oil, natural gas); the production and processing of coal and oil; animal respiration and excrement; plant respiration and humic acid fermentation; the fermentation and decay of organic matter (animals and plants); volcanic eruptions, forest fires, etc. Reducing greenhouse gas emissions and achieving carbon neutrality and peak carbon emissions are efforts made by humanity in response to the climate change crisis. The main task is to target carbon dioxide generated by human production and daily life, primarily researching the entire process of carbon dioxide emission, capture, utilization, storage, and removal, and related technological systems (CCUS technologies). These include photocatalysis, electrocatalysis, thermocatalysis, and radiolysis, but all require additional energy consumption. In comparison, biological methods are greener and milder, with broader application prospects.
[0003] While moderate amounts of carbon dioxide can benefit humanity, a concentration of 1% in the air is harmful; 4-5% can cause shortness of breath, headaches, and dizziness; and 10% can lead to unconsciousness, respiratory arrest, and even death. Carbon dioxide is a major driver of the greenhouse effect, absorbing heat from the Earth and preventing it from escaping into space. However, a continuous increase in carbon dioxide concentration disrupts the Earth's energy balance, leading to global climate change, increased extreme weather events, reduced crop nutritional value and pest resistance, increased pest reproduction, and harm to agricultural production. Furthermore, it damages marine ecosystems and impacts the survival of marine life.
[0004] Therefore, it is essential to study the utilization of CO2 in the environment and its conversion into other beneficial substances for human health. A literature search revealed no reports of Pseudomonas strains using CO2 as the sole carbon source for CO2 reduction. The Pseudomonas XY-1 strain of this invention achieved a maximum cumulative acetic acid production of 73.11 mg / L from CO2 reduction under optimal ferrous concentration (10 mg / L), and exhibited a mild growth environment, facilitating large-scale cultivation. The discovery of this strain is of great significance for CO2 reduction and alleviating the energy crisis. Summary of the Invention
[0005] The purpose of this invention is to provide a novel strain—Pseudomonas XY-1—and its application in CO2 reduction to produce acetic acid.
[0006] The technical solution of this invention is:
[0007] This invention provides a novel strain—Pseudomonas XY-1, deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M20241326, deposit date: June 20, 2024, address: Wuhan University, Wuhan, China, 430072.
[0008] The basic characteristics of the *Pseudomonas* XY-1 strain of this invention are: the colonies are light yellow, with neat edges, opaque, smooth, moist, and easy to pick up. Under a field emission scanning electron microscope, the morphology of this bacterium is that of a rod-shaped bacillus, without flagella, and its size is 500 × 3600 nm.
[0009] The present invention also provides an application of the aforementioned Pseudomonas XY-1 in the CO2 reduction to produce acetic acid. Specifically, the application involves inoculating Pseudomonas XY-1 into an inorganic salt culture medium with pH = 6-8 (preferably 7), adding sodium 2-bromoethanesulfonate, and bubbling high-purity CO2 into the inorganic salt culture medium until the solution is saturated. The medium is then cultured at 30-35°C (preferably 30°C) and 100-300 rpm (preferably 160 rpm) to achieve CO2 reduction.
[0010] Furthermore, the Pseudomonas XY-1 is added in the form of resting cells, and an appropriate amount of resting cells is added to the inorganic salt culture medium.
[0011] The components of the inorganic salt culture medium are as follows: Na₂HPO₄·12H₂O 45–47 g / L; NH₄Cl 1.2–1.3 g / L; NaH₂PO₄·H₂O 9.3–10.3 g / L; KCl 0.45–0.55 g / L; mineral stock solution 12.2–12.7 mL / L; vitamin diluent 4–6 mL / L; deionized water, balance. The ratio of sodium 2-bromoethanesulfonate to inorganic salt culture medium is 0.8–1.2 g: 1 L. The content of each component in the mineral mother liquor is as follows: NTA 1.2-1.7 g / L; MgSO4 2-4 g / L; MnSO4·H2O 0.4-0.6 g / L; NaCl 0.8-1.2 g / L; FeSO4·7H2O 0.08-0.12 g / L; CaCl2·2H2O 0.08-0.12 g / L; CoCl2·6H2O 0.08-0.12 g / L; ZnCl2 0.1-0.15 g / L; CuSO4·5H2O 0.008-0.012 g / L; AlK(SO4)2·12H2O 0.008-0.012 g / L; H3BO3 0.008-0.012 g / L; Na2MoO4 0.02~0.027g / L; NiCl2·6H2O 0.02~0.027g / L; Na2WO4·2H2O 0.02~0.027g / L; deionized water balance. The components in the vitamin diluent are as follows: Vitamin H 0.0015–0.0025 g / L; Folic acid VB 0.0015–0.0025 g / L; Pyridoxine hydrochloride 0.008–0.012 g / L; Riboflavin 0.0045–0.0055 g / L; Thiamine VB 0.0045–0.0055 g / L; Niacin 0.0045–0.0055 g / L; Pantothenic acid VB 0.0045–0.0055 g / L; Vitamin B-12 0.00008–0.00012 g / L; Para-aminobenzoic acid 0.0045–0.0055 g / L; Lipoic acid 0.0045–0.0055 g / L; Deionized water, balance.Furthermore, the inorganic salt culture medium is composed of: Na₂HPO₄·12H₂O 46.165 g / L, NH₄Cl 1.25 g / L, NaH₂PO₄·H₂O 9.808 g / L, KCl 0.52 g / L, trace mineral stock solution 12.5 mL / L, trace vitamin dilution solution 5 mL / L, pH 6-8, and deionized water as the solvent; wherein the trace mineral stock solution is composed of: NTA 1.5 g / L, MgSO₄ 3 g / L, MnSO₄·H₂O 0.5 g / L, NaCl 1 g / L, FeSO₄·7H₂O 0.1 g / L, CaCl₂·2H₂O 0.1 g / L, CoCl₂·6H₂O 0.1 g / L, ZnCl₂ The following ingredients were added: 0.13 g / L CuSO4·5H2O, 0.01 g / L AlK(SO4)2·12H2O, 0.01 g / L H3BO3, 0.01 g / L Na2MoO4, 0.025 g / L NiCl2·6H2O, 0.024 g / L Na2WO4·2H2O, with deionized water as the solvent. The trace vitamin diluent was obtained by diluting the trace vitamin stock solution 100 times. The trace vitamin stock solution consisted of: Vitamin H 0.2 g / L, Folic Acid VB 0.2 g / L, Pyridoxine Hydrochloride 1 g / L, Riboflavin, Vitamin Br 0.5 g / L, Thiamine VB1 0.5 g / L, Niacin 0.5 g / L, Pantothenic Acid VB5 0.5 g / L, and B-12. 0.01 g / L, p-aminobenzoic acid 0.5 g / L, thioctic acid 0.5 g / L, solvent is deionized water.
[0012] Furthermore, the Pseudomonas XY-1 was inoculated in the form of resting cells, which were prepared according to the following steps:
[0013] (1) Shake-flask screening: Take 10 mL of the mixed bacterial strain and place it in an inorganic salt culture medium. Add 1 g / L of sodium 2-bromoethanesulfonate and purge with high-purity CO2 until the solution is saturated. After acclimatization culture for 2-3 weeks, spread the culture onto an inorganic salt plate using the dilution plating method. The inorganic salt plate composition is the same as the above-mentioned inorganic salt culture medium and 15-20 g / L agar. After 4-5 of the above operations, single colonies will appear on the solid plate.
[0014] (2) Slant culture: The strain was inoculated into LB solid medium slant and cultured at 30℃ for 24-36h to obtain slant cells. The final concentration of the LB solid medium was: NaCl 10g / L, tryptone 10g / L, yeast extract 5g / L, agar 15-20g / L, deionized water as solvent, and natural pH.
[0015] (3) Expanded culture: The slant cells from step (1) were inoculated into LB liquid medium with an inoculation loop and cultured at 30℃ and 160rpm for 24-36h to obtain expanded culture medium. The cells were centrifuged, collected, washed with inorganic salt culture medium, and the resting cells of the strain were obtained. The composition of LB liquid medium was: yeast powder 5g / L, NaCl 10g / L, peptone 10g / L, pH natural, and deionized water as solvent.
[0016] Compared with the prior art, the beneficial effects of the present invention are reflected in:
[0017] The strain provided by this invention is derived from sewage sludge from a wastewater treatment plant. This strain can reduce CO2 to acetic acid, and under optimal ferrous concentration (10 mg / L), the highest cumulative amount of acetic acid produced from CO2 reduction can reach 73.11 mg / L. Therefore, this Pseudomonas bacterium has a certain reducing ability for CO2 and can produce a valuable chemical (acetic acid). Attached Figure Description
[0018] Figure 1 Photographs showing the colony morphology of Pseudomonas XY-1 on LB medium.
[0019] Figure 2 Field emission scanning electron microscope images of Pseudomonas XY-1 (×10000 and ×20000).
[0020] Figure 3 This is a phylogenetic tree diagram of Pseudomonas XY-1.
[0021] Figure 4 This is a graph showing the cumulative amount of acetic acid in Pseudomonas XY-1 when CO2 is used as the carbon source.
[0022] Figure 5 This is a graph showing the cumulative amount of acetic acid in Pseudomonas XY-1 when sodium bicarbonate is used as the carbon source.
[0023] Figure 6 For Pseudomonas XY-1, different concentrations of ferrous ions (Fe) 2+ ) under the condition of cumulative acetic acid amount. Detailed Implementation
[0024] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0025] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0026] The inorganic salt culture medium is composed of: Na₂HPO₄·12H₂O 46.165 g / L, NH₄Cl 1.25 g / L, NaH₂PO₄·H₂O 9.808 g / L, KCl 0.52 g / L, trace mineral stock solution 12.5 mL / L, trace vitamin dilution solution 5 mL / L, pH 6-8, and deionized water as the solvent. The trace mineral stock solution consists of: NTA 1.5 g / L, MgSO₄ 3 g / L, MnSO₄·H₂O 0.5 g / L, NaCl 1 g / L, FeSO₄·7H₂O 0.1 g / L, CaCl₂·2H₂O 0.1 g / L, CoCl₂·6H₂O 0.1 g / L, ZnCl₂ 0.13 g / L, CuSO₄·5H₂O 0.01 g / L, and AlK(SO₄)₂·12H₂O. The following ingredients were used: 0.01 g / L H3BO3, 0.01 g / L Na2MoO4, 0.025 g / L NiCl2·6H2O, 0.024 g / L Na2WO4·2H2O, and 0.025 g / L deionized water. The trace vitamin dilution solution was obtained by diluting the trace vitamin stock solution 100 times. The trace vitamin stock solution consisted of: Vitamin H 0.2 g / L, Folic Acid VB 0.2 g / L, Pyridoxine Hydrochloride 1 g / L, Riboflavin, Vitamin Br 0.5 g / L, Thiamine VB1 0.5 g / L, Nicotinic Acid 0.5 g / L, Pantothenic Acid VB5 0.5 g / L, B-12 0.01 g / L, Para-aminobenzoic Acid 0.5 g / L, and Lipoic Acid 0.5 g / L, with deionized water as the solvent.
[0027] The composition of LB solid medium is: yeast extract 5 g / L, NaCl 10 g / L, peptone 10 g / L, agar 15-20 g / L, natural pH, and deionized water as the solvent.
[0028] LB liquid medium composition: yeast extract 5g / L, NaCl 10g / L, peptone 10g / L, pH natural, solvent is deionized water.
[0029] Example 1: Isolation, purification and identification of strain Pseudomonas XY-1.
[0030] 1. Isolation and purification of strain Pseudomonas XY-1.
[0031] The strain Pseudomonas XY-1 is a Gram-negative bacterium that was domesticated and isolated from activated sludge. The specific steps are as follows:
[0032] Add 90 mL of inorganic salt culture medium to a 300 mL serum bottle, then add 10 mL of bacterial culture obtained from a laboratory reactor, followed by 1 g / L sodium 2-bromoethanesulfonate and high-purity CO2 until the solution is saturated. Place the serum bottle in a shaker at 30 °C and 160 rpm for enrichment culture, and monitor the acetic acid accumulation using a gas chromatograph. When the acetic acid accumulation begins to decrease, transfer 10 mL of bacterial culture from the serum bottle to the next serum bottle, add fresh inorganic salt culture medium, 1 g / L sodium 2-bromoethanesulfonate, and high-purity CO2 until the solution is saturated. Repeat the above process 4-5 times. After the last bacterial culture is serially diluted with sterile water, it is plated onto LB solid medium and incubated at 30 °C. Single colonies are selected and purified by streaking on LB plates. Figure 1 The obtained single colonies were inoculated into inorganic salt culture medium serum bottles, and high-purity CO2 was bubbled through until the solution was saturated. CO2 was used as the sole carbon source for verification (a blank control was set up, one with only CO2 as the carbon source and one without CO2 as a control). In the CO2-containing serum bottle, the microorganisms grew well, while the CO2-free serum bottle was clear and showed no microbial growth. Strain XY-1 was screened and its morphology was determined by field emission scanning electron microscopy. Figure 2 ).
[0033] 2. Identification of strain XY-1
[0034] (1) Characteristics of strain XY-1: The colonies are light yellow with neat edges, opaque, smooth and moist, and easy to pick up. The morphology of the bacteria was observed under a field emission scanning electron microscope. The bacteria are rod-shaped and 500×3600nm in size.
[0035] (2) The strain was identified as Pseudomonas by 16S rRNA sequence analysis and physiological and biochemical experiments. The specific steps are as follows:
[0036] DNA from the bacterial strain was extracted and purified using the Ezup column-based bacterial genomic DNA extraction kit and stored at 4°C. The purified DNA was amplified by PCR using universal primers for bacteria: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as follows: 95°C pre-denaturation for 5 min, followed by 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 90 s, for 25 cycles, and a final 72°C repair extension for 10 min. The PCR product was purified and recovered, and then sequenced (Shanghai Meiji Biotechnology Co., Ltd.). The 16S rRNA (SEQ ID NO.1) sequencing result was uploaded to NCBI, obtaining accession number MK346044. This sequence was also compared with gene sequences in the NCBI database using BLAST. It was found to belong to the genus *Pseudomonas*, and showed 99% homology with *Pseudomonas koreensis* strain DP24, *Pseudomonas moraviensis* strain cqsm g2, *Pseudomonas* sp. CS-MA1, and *Pseudomonas koreensis* strain Cr13. From the results, 12 representative *Pseudomonas* strains were selected, and a phylogenetic tree was constructed using MEGA 7.0 software based on 16S rRNA gene sequence homology. Figure 3 Based on genetic distance and 16S rRNA sequence comparison, strain XY-1 was identified as Pseudomonas. The DNA base sequence of strain XY-1 is shown in SEQ ID NO.1.
[0037] Example 2: Study on the reduction of acetic acid by Pseudomonas XY-1 using sodium bicarbonate as a carbon source
[0038] Resting cells were prepared according to the following steps: (1) Shake flask screening: 10 mL of mixed strains were placed in inorganic salt culture medium, and 1 g / L of sodium 2-bromoethanesulfonate and high-purity CO2 were added to the inorganic salt culture medium until the solution was saturated. After acclimatization culture for 2-3 weeks, the strains were spread onto inorganic salt plates by dilution plating. The composition of the inorganic salt plate was the same as the above inorganic salt culture medium and 15 g / L agar. After 4 of the above operations, single colonies appeared on the solid plates. (2) Slant culture: The strains were inoculated on LB solid slant medium and cultured at 30°C for 24 h to obtain slant cells. The final concentration of the LB solid medium was: NaCl 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, agar 15 g / L, deionized water as solvent, and natural pH. (3) Expanded culture: The slant cells from step (2) were inoculated into LB liquid medium using an inoculation loop and cultured at 30℃ and 160 rpm for 24 h to obtain expanded culture medium. The cells were centrifuged, collected, and washed with inorganic salt culture medium to obtain resting cells. The LB liquid medium consisted of 5 g / L yeast extract, 10 g / L NaCl, and 10 g / L peptone, with a natural pH and deionized water as the solvent. The resting cells were added to a container containing 100 mL of inorganic salt culture medium (Fe...). 2+ A serum solution of 2 mg / L was added to a vial, along with 1 g / L sodium 2-bromoethanesulfonate and 2 g / L sodium bicarbonate. The vial was then incubated at 30°C and 160 rpm in a shaker, and samples were taken at intervals to detect the accumulation of acetic acid. The results are as follows: Figure 5 As shown, when sodium bicarbonate is used as the carbon source, the highest cumulative amount of acetic acid produced by this strain is 31.74 mg / L, which is lower than the yield when CO2 is used as the carbon source under the same conditions. Figure 4 ).
[0039] Example 3: Study on the ability of Pseudomonas XY-1 to produce acetic acid by CO2 reduction under different ferrous ion concentrations
[0040] Ferrous ions (Fe) in the initial inorganic salt culture medium 2+ The concentration of ferrous sulfate was 2 mg / L. The concentration of ferrous ions in the inorganic salt culture medium was increased by adding an appropriate amount of ferrous sulfate to 100 mL of inorganic salt culture medium. The concentrations of ferrous ions in each group of inorganic salt culture medium were 2 mg / L, 4 mg / L, 10 mg / L, and 50 mg / L, respectively. 1 g / L of sodium 2-bromoethanesulfonate was added to each group of inorganic salts, and high-purity CO2 was bubbled through until the solution was saturated with an appropriate amount of bacteria. Serum bottles containing the above substances were placed in a shaker at 30℃ and 160 rpm and samples were taken at regular intervals to detect the accumulation of acetic acid. The results are as follows: Figure 6As shown, when the ferrous ion concentration is no greater than 10 mg / L, the maximum cumulative amount of acetic acid increases with the increase of ferrous ion concentration. However, when the ferrous ion concentration is 50 mg / L, a significant inhibitory effect occurs, and the maximum cumulative amount of acetic acid decreases significantly to only 9.86 mg / L.
[0041] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the scope of protection of the present invention. Any modifications and refinements made by those skilled in the art without departing from the concept and scope of the present invention shall fall within the scope of protection of the present invention.
Claims
1. A type of Pseudomonas ( Pseudomonas XY-1, characterized in that, It is deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M20241326.
2. The application of Pseudomonas XY-1 as described in claim 1 in the production of acetic acid by carbon dioxide reduction.
3. The application as described in claim 2, characterized in that, Specifically, it includes: Resting cells of Pseudomonas XY-1 obtained by culturing were added to an inorganic salt culture medium with pH 6-8, along with sodium 2-bromoethanesulfonate. CO2 was then introduced into the inorganic salt culture medium until the solution was saturated, and carbon dioxide was used to reduce and synthesize acetic acid.
4. The application as described in claim 3, characterized in that, The contents of each component in the inorganic salt culture medium are as follows: Na2HPO4·12H2O 45~47 g / L; NH4Cl 1.2~1.3 g / L; NaH2PO4·H2O 9.3~10.3 g / L; KCl 0.45~0.55 g / L; Mineral mother liquor 12.2~12.7 mL / L; Vitamin dilution solution 4~6 mL / L; Deionized water balance; The content of each component in the mineral mother liquor is as follows: NTA (nitrotriacetic acid) 1.2~1.7 g / L; MgSO4 2~4 g / L; MnSO4·H2O 0.4~0.6 g / L; NaCl 0.8~1.2 g / L; FeSO4·7H2O 0.095~0.5 g / L; CaCl2·2H2O 0.08~0.12 g / L; CoCl2·6H2O 0.08~0.12 g / L; ZnCl2 0.1~0.15 g / L; CuSO4·5H2O 0.008~0.012 g / L; AlK(SO4)2·12H2O 0.008~0.012 g / L; H3BO3 0.008~0.012 g / L; Na₂MoO₄ 0.02~0.027 g / L; NiCl2·6H2O 0.02~0.027 g / L; Na2WO4·2H2O 0.02~0.027 g / L; Deionized water balance; The content of each component in the vitamin diluent is as follows: Vitamin VH 0.0015~0.0025 g / L; Folic acid (vitamin B) 0.0015~0.0025 g / L; Pyridoxine hydrochloride 0.008~0.012 g / L; Riboflavin 0.0045~0.0055 g / L; Thiamine VBI 0.0045~0.0055 g / L; Nicotinic acid 0.0045~0.0055 g / L; Pantothenic acid (VB5) 0.0045~0.0055 g / L; Vitamin B-12: 0.00008~0.00012 g / L; p-Aminobenzoic acid 0.0045~0.0055 g / L; Lipoic acid 0.0045~0.0055 g / L; Deionized water balance.
5. The application as described in claim 3, characterized in that, The ratio of sodium 2-bromoethanesulfonate to inorganic salt culture medium is 0.8~1.2 g:1L.
6. The use according to claim 3, wherein the compound is ###0002### Resting cells were obtained by culturing Pseudomonas XY-1, specifically including: (1) Slant culture: Pseudomonas XY-1 was inoculated onto a plate containing LB solid medium and cultured at 30-35℃ to obtain slant cells; (2) Expanded culture: The slant cells from step (1) were inoculated into LB liquid medium and cultured at 30-35℃ and 100-300 rpm for 24-36 h to obtain expanded culture medium. The cells were centrifuged, wet cells were collected, washed with inorganic salt culture medium, and resting cells of Pseudomonas XY-1 were obtained.
7. The use according to claim 3, wherein the compound is ###0005### Acetic acid was synthesized by carbon dioxide reduction at 30-35℃ and 100-300 rpm.
Citation Information
Patent Citations
Pseudomonas monteilii SD-2 and application thereof in degradation of organic pollutants
CN116463254A
Nitrate reducing pseudomonas ZKJ and application thereof in degradation of organic pollutants
CN116731923A