Acinetobacter X-2 and application thereof in production of acetic acid by reducing carbon dioxide

Abstract

The invention discloses acinetobacter X-2 and application of the acinetobacter X-2 in production of acetic acid by reducing carbon dioxide. The acinetobacter X-2 can reduce CO2 into acetic acid. The application comprises the following steps: inoculating the acinetobacter X-2 into a phosphate culture solution which has the pH value of 6-8 and is aerated to be saturated by CO2 gas, and culturing at the temperature of 30-35 DEG C to realize reduction of CO2. The highest cumulant of the acinetobacter X-2 for reducing CO2 to produce acetic acid under the optimal ferrous concentration (4mg / L) can reach 30.39 mg / L. Therefore, the acinetobacter X-2 has good CO2 reducing capacity, and conversion of CO2 into high-value chemicals is realized.

Description

Technical Field

[0001] The present invention relates to the field of Acinetobacter, and specifically relates to an Acinetobacter X-2 and its application in growing the bacteria under suitable conditions to reduce CO 2 for acetic acid production. Background Art

[0002] As one of the main components of greenhouse gases, the concentration of carbon dioxide in the atmosphere has been continuously rising, becoming an important driver of global warming. This climate change not only significantly affects the Earth's climate system, but also brings about glacier melting, sea level rise, and the occurrence of climate events. In the face of this challenge, countries around the world have gradually reached a consensus on addressing climate change. The goal is to control the increase in the global average temperature to no more than 2 degrees Celsius above the pre-industrial level and strive to limit the temperature increase within 1.5 degrees Celsius. However, according to the latest assessment of the Intergovernmental Panel on Climate Change (IPCC), to achieve this goal, we must take immediate action and rapidly advance the decarbonization process. Nevertheless, for specific industries such as aviation and shipping, the emission reduction task is particularly arduous, forcing us to explore new technologies and methods to remove carbon dioxide from the atmosphere. Acetic acid (chemical formula CH 3 COOH) is an important raw material for industrial production and an indispensable product in human daily life. In the vast natural world, acetic acid is ubiquitous. It often hides in fruits and vegetable oils in the form of esters, and at the same time appears as a free acid in animal tissues, excreta, and blood. In nature, many microorganisms have the ability to convert different organic substances into acetic acid through the fermentation process. In the presence of an external electron donor, microorganisms can also reduce CO 2 to high-value products such as acetic acid through reduction, realizing the fixation of CO 2

[0003] Therefore, biosynthesizing CO 2 into other high-value products has scientific value and economic and social significance for CO 2 emission reduction and resource utilization. Through literature retrieval, no reports were found on Acinetobacter reducing CO 2 using it as the sole carbon source to achieve the reduction of CO 2 Summary of the Invention

[0004] The present invention provides a novel bacterium for reducing CO 2 to produce acetic acid by culturing the above-mentioned bacterium.

[0005] The present invention provides a CO 2The reducing bacterium - Acinetobacter sp. X-2, was deposited in the China Center for Type Culture Collection on June 20, 2024, with the deposit number CCTCC M 20241327, and the address is Wuhan University, Wuhan, China, Zip Code 430072.

[0006] The basic characteristics of Acinetobacter X-2 of the present invention are as follows: The colony is light white, with a neat edge, opaque, smooth and moist, and easy to pick. Under scanning electron microscopy, the morphology of the bacteria is coccobacillus, without flagella, and Gram-negative staining.

[0007] The present invention provides an application of the Acinetobacter X-2 in the production of acetic acid. Specifically, the application is to add resting cells obtained by the enlarged culture of Acinetobacter X-2 to a phosphate culture solution with a pH of 6 - 8 (preferably 7), while adding sodium 2-bromoethanesulfonate, and introducing CO 2 into the saturated phosphate culture solution, and culturing at 25 - 35°C (preferably 30°C) and 140 - 180 rpm (most preferably 160 rpm) to achieve the reduction production of acetic acid from CO 2 The dosage ratio of the sodium 2-bromoethanesulfonate to the phosphate culture solution is 0.8 - 1.2 g:1 L.

[0008] The composition of the phosphate culture solution is as follows:

[0009]

[0010]

[0011] The content of each component in the mineral mother liquor is as follows:

[0012] The content of each component in the vitamin dilution solution is as follows:

[0013]

[0014]

[0015] Furthermore, the composition of the phosphate buffer solution is: Na 2 HPO 4 ·12H 2 O 46.165 g / L, NH 4 Cl 1.25 g / L, NaH 2 PO 4 ·H 2O 9.808 g / L, KCl 0.52 g / L, trace mineral mother liquor 12.5 mL / L, trace vitamin dilution 5 mL / L, pH 6 - 8, with deionized water as the solvent; the composition of the trace mineral mother liquor: NTA 1.5 g / L, MgSO 4 3 g / L, MnSO 4 ·H 2 O 0.5 g / L, NaCl 1 g / L, FeSO 4 ·7H 2 O 0.1 g / L, CaCl 2 ·2H 2 O 0.1 g / L, CoCl 2 ·6H 2 O 0.1 g / L, ZnCl 2 0.13 g / L, CuSO 4 ·5H 2 O 0.01 g / L, AlK(SO 4 ) 2 ·12H 2 O 0.01 g / L, H 3 BO 3 0.01 g / L, Na 2 MoO 4 0.025 g / L, NiCl 2 ·6H 2 O 0.024 g / L, Na 2 WO 4 ·2H 2 O 0.025 g / L, with deionized water as the solvent; the trace vitamin dilution is obtained by diluting the trace vitamin mother liquor 100 - fold. The composition of the trace vitamin mother liquor: vitamin VH 0.2 g / L, folic acid VB 0.2 g / L, pyridoxine hydrochloride 1 g / L, riboflavin, thiamine VBI 0.5 g / L, niacin 0.5 g / L, pantothenic acid VB5 0.5 g / L, B - 12 0.01 g / L, p - aminobenzoic acid 0.5 g / L, lipoic acid 0.5 g / L, with deionized water as the solvent.

[0016] Furthermore, the resting cells obtained by the enlarged culture of Acinetobacter X - 2 are prepared according to the following steps:

[0017] (1) Slant culture: Inoculate Acinetobacter X - 2 onto an LB plate containing LB solid medium and culture at 25 - 35 °C to obtain slant bacteria; the composition of the LB solid medium: 4 - 6 g / L yeast extract, 8 - 12 g / L NaCl, 8 - 12 g / L peptone, 15 - 20 g / L agar, with deionized water as the solvent.

[0018] (2) Subculture: Inoculate the slant bacteria in step (1) into LB liquid medium, and culture at 25 - 35 °C and 140 - 180 rpm for 10 - 14 h to obtain the subcultured medium. Centrifuge to collect the wet bacteria, and wash with phosphate buffer solution to obtain resting cells. The composition of LB liquid medium: 4 - 6 g / L yeast extract, 8 - 12 g / L NaCl, 8 - 12 g / L peptone, and the solvent is deionized water.

[0019] Further preferably, the Acinetobacter X-2 resting cells are prepared according to the following steps:

[0020] (1) Slant culture: Inoculate Acinetobacter X-2 into LB liquid medium, and culture at 30 °C and 160 rpm for 2 d to activate and revive the preserved bacteria. Then streak the activated bacteria on an LB plate and culture in an incubator at 30 °C. Pick a single colony and continue streaking on the plate to detect the purity of the bacteria, and obtain a bacterial slant that can be routinely maintained (at 4 °C). This bacterial slant needs to be subcultured every three months to ensure the activity of the strain; The composition of LB solid medium: 5 g / L yeast extract, 10 g / L NaCl, 10 g / L peptone, 15 - 20 g / L agar, natural pH, and the solvent is deionized water; LB liquid medium is LB solid medium without agar.

[0021] (2) Subculture: Inoculate the slant bacteria in step (2) into LB liquid medium, and culture at 30 °C and 160 rpm for 12 h to obtain the subcultured medium. Centrifuge to collect the wet bacteria, and wash with phosphate buffer solution to obtain Acinetobacter resting cells; The composition of LB liquid medium: 5 g / L yeast extract, 10 g / L NaCl, 10 g / L peptone, natural pH, and the solvent is deionized water.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] The Acinetobacter X-2 provided by the present invention is taken from sewage plant sludge, and can provide a new, safer and more environmentally friendly biological pathway for converting CO 2 into acetic acid.

[0024] Under the condition of the optimal ferrous ion concentration (4 mg / L), the highest cumulative amount of acetic acid produced by the reduction of CO 2 by the Acinetobacter X-2 of the present invention is up to 30.39 mg / L, and the growth environment is mild and easy to subculture. The discovery of this strain is of great significance for greenhouse gas reduction and addressing climate change. Description of the Drawings

[0025] Figure 1 It is a photograph of the colony morphology of Acinetobacter X-2 on LB medium.

[0026] Figure 2 Scanning electron microscope photograph of Acinetobacter X-2.

[0027] Figure 3 Phylogenetic tree diagram of Acinetobacter X-2.

[0028] Figure 4 Acetic acid accumulation of Acinetobacter X-2 during the cycle.

[0029] Figure 5 Acetic acid accumulation of Acinetobacter X-2 under different concentrations of Fe 2+ conditions. Detailed implementation manners

[0030] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0031] Materials, reagents, etc. used in the following embodiments can be obtained from commercial channels without special instructions.

[0032] The composition of the phosphate buffer solution is as follows: Na 2 HPO 4 ·12H 2 O 46.165 g / L, NH 4 Cl 1.25 g / L, NaH 2 PO 4 ·H 2 O 9.808 g / L, KCl 0.52 g / L, trace mineral mother liquor 12.5 mL / L, trace vitamin diluent 5 mL / L, pH 6 - 8, and the solvent is deionized water; the composition of the trace mineral mother liquor: NTA 1.5 g / L, MgSO 4 3 g / L, MnSO 4 ·H 2 O 0.5 g / L, NaCl 1 g / L, FeSO 4 ·7H 2 O 0.1 g / L, CaCl 2 ·2H 2 O 0.1 g / L, CoCl 2 ·6H 2 O 0.1 g / L, ZnCl 2 0.13 g / L, CuSO 4 ·5H 2 O 0.01 g / L, AlK(SO 4 ) 2 ·12H 2O 0.01 g / L, H 3 BO 3 0.01 g / L, Na 2 MoO 4 0.025 g / L, NiCl 2 ·6H 2 O 0.024 g / L, Na 2 WO 4 ·2H 2 O 0.025 g / L, with the solvent being deionized water; among them, the trace vitamin diluent is obtained by diluting the trace vitamin stock solution 100 times. The composition of the trace vitamin stock solution: vitamin VH 0.2 g / L, folic acid VB 0.2 g / L, pyridoxine hydrochloride 1 g / L, riboflavin, thiamine VBI 0.5 g / L, nicotinic acid 0.5 g / L, pantothenic acid VB5 0.5 g / L, B-12 0.01 g / L, p-aminobenzoic acid 0.5 g / L, lipoic acid 0.5 g / L, with the solvent being deionized water.

[0033] The composition of LB solid medium: 5 g / L yeast extract, 10 g / L NaCl, 10 g / L peptone, 18 g / L agar, natural pH, with the solvent being deionized water.

[0034] The composition of LB liquid medium: 5 g / L yeast extract, 10 g / L NaCl, 10 g / L peptone, natural pH, with the solvent being deionized water.

[0035] Example 1: Isolation, purification and identification of Acinetobacter X-2.

[0036] 1. Isolation and purification of Acinetobacter X-2

[0037] Acinetobacter X-2 is a Gram-negative bacterium domesticallyated and isolated from the activated sludge in the aeration tank of a municipal sewage treatment plant. The specific steps of screening are as follows:

[0038] Add 90 mL of phosphate culture solution to a 300 mL serum bottle, add 10 mL of bacterial solution obtained from the laboratory reactor, then add 1 g / L of 2-bromoethanesulfonic acid sodium and introduce high-purity CO 2 until the solution is saturated. Place the above serum bottle in a shaker at 30 °C and 160 rpm for enrichment culture, and monitor the acetic acid accumulation amount with a gas chromatograph. When the acetic acid accumulation amount starts to decline, transfer 10 mL of the bacterial solution in the serum bottle to the next serum bottle and add fresh phosphate culture solution, 1 g / L of 2-bromoethanesulfonic acid sodium and introduce high-purity CO2 until the solution is saturated. Repeat the above process 4 - 5 times, then dilute and spread the solution enriched with microorganisms on the LB solid medium, select single colonies, and purify by streaking on the LB plate (Figure 1 )。 The obtained single colony was inoculated into a medium, and saturated CO 2 was used as the sole carbon source and energy source to screen for strain X-2. Its morphology was determined by scanning electron microscopy ( Figure 2 ).

[0039] 2. Identification of Strain X-2

[0040] (1) Characteristics of Strain X-2: The colony was light yellow, with a neat edge, opaque, smooth and moist, and easy to pick. Under scanning electron microscopy, the morphology of the bacterial cells was coccobacillus, without flagella, with a size of 755×1520 nm, and Gram-negative staining.

[0041] (2) Through 16S rRNA sequence analysis and physiological and biochemical experiments, it was determined that the strain was Acinetobacter_sp. The specific steps were as follows:

[0042] The Ezup column bacterial genomic DNA extraction and purification kit was used to extract and purify the DNA of strain X-2, and it was stored at 4°C. The purified DNA was subjected to PCR amplification using universal primers for bacteria. The primers were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as pre-denaturation at 95°C for 5 min, then denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min 30 s, for 25 cycles, and finally repair extension at 72°C for 10 min. After purification and recovery of the PCR product, it was sequenced (Shanghai Majorbio Bio-pharm Technology Co., Ltd.). The sequencing result of 16S rRNA (shown in SEQ ID NO.1) was uploaded to NCBI, and at the same time, this sequence was compared with the gene sequences in the NCBI database by Blast. It was found that it belonged to the genus Acinetobacter, and had 99% homology with Acinetobacter sp. strain VNH17, Acinetobacter sp. strain CAM121, and Acinetobacter sp. strain AAAID-1.4. Nine representative strains of Acinetobacter were selected from the results. Based on the 16S rRNA gene sequence homology, the MEGA6.0 software was used to construct a phylogenetic tree, as Figure 3 . Through genetic distance and 16S rRNA sequence comparison.

[0043] Example 2 Obtaining of Acinetobacter X-2 Resting Cells

[0044] (1) Slant culture:

[0045] Acinetobacter sp. X-2 was inoculated into LB liquid medium and cultured at 30 °C and 160 rpm for 2 days. Then, the activated bacteria were streaked on a solid LB plate and cultured in an incubator at 30 °C. Single colonies were picked and streaked on the plate again to detect the purity of the bacteria, and then stored in a conventional LB test tube slant at 4 °C.

[0046] (2) Subculture:

[0047] The slant bacteria in step (2) were inoculated into LB liquid medium and cultured at 30 °C and 160 rpm for 12 h to obtain a subculture solution. After centrifugation, the wet bacteria were collected and washed with sterile water to obtain the resting cells of Acinetobacter sp. X-2.

[0048] Example 3 Acetic acid accumulation of Acinetobacter sp. X-2 at OD 600 = 0.03

[0049] Phosphate buffer solution was dispensed into shake flasks with a volume of 330 mL each, 100 mL per flask, and sterilized at 110 °C for 40 min. After sterilization, it was left at room temperature for 2 days to ensure no contamination. The resting cells of Acinetobacter sp. X-2 obtained by the method of Example 2 with OD 600 = 0.03 were added, and then excessive CO 2 was introduced as the sole carbon source. After the shake flasks were sealed with PTFE stoppers, they were cultured on a shaker at 30 °C and 160 rpm, and a blank control without bacteria was set up. The acetic acid concentration in the shake flasks was measured at regular intervals, and the acetic acid accumulation curve of the strain for different days was plotted. The results are shown in Figure 4 Figure. The results showed that when Acinetobacter sp. X-2 reached the 200th hour, the acetic acid accumulation reached a maximum of 28.07 mg / L.

[0050] Example 4 Acetic acid accumulation of Acinetobacter sp. X-2 at different concentrations of Fe 2+

[0051] Phosphate buffer solutions containing 2 mg / L, 4 mg / L, 10 mg / L, and 50 mg / L Fe 2+ were dispensed into shake flasks with a volume of 330 mL each, 100 mL per flask, and sterilized at 110 °C for 40 min. After sterilization, it was left at room temperature for 2 days to ensure no contamination. The resting cells of Acinetobacter sp. X-2 obtained by the method of Example 2 with OD 600 = 0.03 were added, and then excessive CO 2 was introduced as the sole carbon source. After the shake flasks were sealed with PTFE stoppers, they were cultured on a shaker at 30 °C and 160 rpm. The acetic acid concentration in the shake flasks was measured at regular intervals, and the acetic acid accumulation curve of the strain at different times for different initial concentrations of Fe 2+ concentration was plotted. The results are shown in Figure 5 Figure. The results showed that when Acinetobacter sp. X-2 was at Fe 2+At a concentration of 4 mg / L, the maximum cumulative amount of acetic acid reached 30.39 mg / L.

Claims

1. An Acinetobacter X-2, characterized in that Deposited in China Center for Type Culture Collection, deposit date: June 20, 2024, deposit number: CCTCC M 20241327.

2. Use of Acinetobacter X-2 according to claim 1 in reducing carbon dioxide to produce acetic acid.

3. The use according to claim 2, characterized in that Specifically include: The resting cells obtained by expanding the culture of Acinetobacter X-2 are added to a phosphate culture medium at pH = 6-8, sodium 2-bromoethane sulfonate is added, and CO2 is passed through to achieve biosynthesis of acetic acid from CO2.

4. The use according to claim 3, characterized in that The culture was carried out at 25-35°C and 160 rpm.

5. The use according to claim 3, characterized in that The dosage ratio of the sodium 2-bromoethane sulfonate to the phosphate culture solution is 0.8-1.2 g:1L.

6. The use according to claim 3, characterized in that The phosphate culture solution consists of:

7. The use according to claim 6, characterized in that The contents of the components in the mineral mother liquor are as follows:

8. The use according to claim 6, characterized in that The contents of the components in the vitamin diluent are as follows:

9. The use according to claim 6, characterized in that The resting cells obtained by expanding the culture of Acinetobacter X-2 are prepared as follows: (1) Slant culture: Inoculate Acinetobacter X-2 onto an LB plate containing LB solid medium and culture at 25-35°C to obtain slant cells; (2) Expansion culture: inoculate the slant cells from step (1) into LB liquid culture medium, culture at 25-35°C and 140-180 rpm for 10-14 h to obtain expansion culture solution, centrifuge, collect wet cells, wash with phosphate buffer, and obtain resting cells.

10. The use according to claim 9, characterized in that In step (1), the LB solid culture medium consists of: 4-6 g / L yeast extract, 8-12 g / L NaCl, 8-12 g / L peptone, 15-20 g / L agar, and the solvent is deionized water; In step (2), the LB liquid culture medium consists of: 4-6 g / L yeast extract, 8-12 g / L NaCl, 8-12 g / L peptone, and the solvent is deionized water.

Images