Application of SNP (Single Nucleotide Polymorphism) genetic marker influencing chicken tibia in chicken genetic breeding

Abstract

The invention provides application of an SNP genetic marker influencing chicken shin girth in chicken genetic breeding, and belongs to the technical field of chicken genetic breeding and biology.The SNP genetic marker influencing chicken shin girth comprises SCtag4, the SCtag4 corresponds to the 75909527th site of the physical position of a chromosome 4 of chicken reference genome bGa < l1 >. Mat.broi ler.GRCg7b version sequence information published in NCBI, belongs to the 8th intron sequence of a gene LDB2, and belongs to the technical field of chicken genetic breeding. The basic group is T or C. The SNP genetic marker is beneficial to heredity improvement of the shank girth, and is beneficial to improvement of the shank girth of laying hens and reduction of the incidence frequency of osteoporosis when being applied to genetic breeding of chickens, so that a high-quality laying hen variety is obtained.

Description

Technical Field

[0001] The invention belongs to the field of chicken genetic breeding and biotechnology, and particularly relates to the application of a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding. Background Art

[0002] Shank circumference is a common indicator for laying hen breeding. It can be used to evaluate bone development and measure the uniformity of body size. Bone is the main source of calcium for eggshells. According to statistics from Muir et al., the calcium deposited in the eggshell of a commercial laying hen throughout its life is approximately equal to its body weight. Light laying hens, including Leghorn chickens and green-shell laying hens, often face the problem of osteoporosis near the end of their egg-laying period. The main reason is that the structural bone and medullary bone lose their dynamic balance, resulting in the loss of integrity of the structural bone. The harm of osteoporosis to laying hen production is mainly reflected in three aspects: first, it causes fractures, paralysis and even death in laying hens; second, it reduces egg-laying performance; and third, it causes animal welfare problems caused by fractures and long-term illness. In order to reduce the harm of osteoporosis to light and high-yielding laying hens, it is necessary to improve the bone quality of laying hens, including the selection of shank circumference. The shank circumference trait is regulated by micro-effect multi-genes, and conventional breeding methods are difficult to make effective genetic progress. The only way is to clarify the genetic structure of shank circumference and improve its breeding accuracy through genomic selection to achieve the goal of genetically improving the size of shank circumference. Summary of the invention

[0003] In order to meet the needs of the laying hen industry to reduce the harm of osteoporosis and select for tibia circumference traits, the present invention provides an application of a SNP genetic marker that affects the tibia circumference of chickens in chicken genetic breeding. The SNP genetic marker that affects the tibia circumference of chickens includes SC_tag4. The SNP genetic marker helps to genetically improve the tibia circumference. Applying it to chicken genetic breeding is beneficial to improving the tibia circumference of laying hens and reducing the frequency of osteoporosis, thereby obtaining high-quality laying hen varieties.

[0004] The present invention is achieved through the following technical solutions:

[0005] The present invention provides an application of a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding. The SNP genetic marker affecting chicken shank circumference comprises SC_tag4, and the SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C.

[0006] Based on the same inventive concept, the present invention provides an early selection method for chicken shank girth traits, the early selection method comprising performing early selection on chicken shank girth traits based on the genotype of SNP genetic marker SC_tag4;

[0007] The SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C.

[0008] Furthermore, the early selection method specifically includes:

[0009] Detecting the genotype of the SC_tag4 genetic marker in the chicken genome to be tested;

[0010] Perform early selection on the chicken shank girth trait to be tested based on the genotype of the SC_tag4;

[0011] Among them, the tibial circumference of the TT genotype individual of SC_tag4 is greater than the tibial circumference of the CC and CT genotype individuals.

[0012] Further, the detection of the genotype of the SC_tag4 genetic marker in the chicken genome to be tested specifically includes:

[0013] The genomic DNA of the chicken to be tested was amplified by PCR using Pr_sc4f and Pr_sc4r as primers;

[0014] The PCR amplification product was sequenced to obtain the genotype of position 75909527 of the positive strand of the tested chicken chromosome 4;

[0015] Among them, the nucleotide sequence of the Pr_sc4f is shown as SEQ ID NO.1, and the nucleotide sequence of the Pr_sc4r is shown as SEQ ID NO.2.

[0016] Preferably, the breeds of chickens to be tested include Dongxiang green-shell laying hens and / or White Leghorn chickens.

[0017] Based on the same inventive concept, the present invention provides primers for detecting SNP genetic marker SC_tag4, wherein the SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C;

[0018] The primers include Pr_sc4f and Pr_sc4r, the nucleotide sequence of Pr_sc4f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc4r is shown in SEQ ID NO.2.

[0019] Based on the same inventive concept, the present invention provides the use of primers for detecting SNP genetic marker SC_tag4 in chicken genetic breeding.

[0020] Based on the same inventive concept, the present invention provides a kit for detecting the SNP genetic marker SC_tag4, wherein the kit comprises the above-mentioned primers for detecting the SNP genetic marker SC_tag4.

[0021] Based on the same inventive concept, the present invention provides a kit for detecting SNP genetic marker SC_tag4 and its application in chicken genetic breeding.

[0022] Based on the same inventive concept, the present invention also provides the application of SNP genetic marker SC_tag4 in predicting the shank circumference of chickens at 40 weeks of age. The SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C.

[0023] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0024] The present invention discloses an application of a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding. The SNP genetic marker affecting chicken shank circumference includes SC_tag4. Individuals with a beneficial genotype (TT) of SC_tag4 have a higher shank circumference. Applying the SNP genetic marker to chicken genetic breeding helps to genetically improve the shank circumference of laying hens at 40 weeks of age, thereby obtaining laying hens with stronger legs and better uniformity of body size, which is beneficial to reducing the frequency of osteoporosis, thereby obtaining high-quality laying hen varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 This is the Manhattan plot of the tibial circumference GWAS analysis of the resource population in Example 2 of the present invention;

[0027] Figure 2 This is the QQ graph of the tibial circumference GWAS analysis of the resource population in Example 2 of the present invention;

[0028] Figure 3 This is a box plot of the shin circumference of individuals with different genotypes in Example 3 of the present invention, in which the median is replaced by the mean shin circumference. DETAILED DESCRIPTION

[0029] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0032] The application of a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding will be described in detail below in combination with examples and experimental data.

[0033] Example 1

[0034] Resource group building

[0035] The laying hen resource population was constructed based on the F2 design. Dongxiang green-shell laying hens and white Leghorn chickens were used as parents, and the F1 generation was obtained by positive and negative crosses, and then the F2 generation was bred with the F1 as parents. The experimental chickens were individually winged and raised in single cages in a fully enclosed chicken house. Artificial light was supplemented for 16 hours during the laying period, and fans and wet curtains were used for cooling. Routine immunization was carried out according to the immunization program formulated by the Jiangsu Poultry Research Institute. The feed came from COFCO, and the laying hen feed components included 16.5% crude protein and 11511 kJ / kg feed metabolizable energy. During the laying period, the chickens were fed freely, water was supplied by nipple drinkers, feed was supplied by a driving feeder, and manure was removed by a chicken manure conveyor belt. The tibia circumference, that is, the circumference of the middle part of the tibia, was measured at 40 weeks of age.

[0036] The tibia circumference data were preliminarily screened, and after removing the obviously wrong and repeated data, the outliers were removed and sorted into an Excel table. After data cleaning, 1512 records remained in the resource population F2 generation tibia circumference data set. Using I BMSPSS21.0 software, QQ plot observation, kurtosis skewness statistics and Kolmogorov-Smirnov test, it was determined that the tibia circumference data distribution was basically not skewed, which can be used for the next GWAS analysis and analyze its genetic structure.

[0037] Example 2

[0038] GWAS analysis of tibia circumference at 40 weeks of age

[0039] The experimental chickens were from the F2 generation adult hens of the laying hen resource group constructed in Example 1. About 0.5 ml of blood samples were collected from the wing vein of the experimental chickens, placed in BD anticoagulant tubes (Suzhou BD Medical Instruments Co., Ltd.), and stored at -70°C. Genomic DNA was extracted, detected by 0.8% agarose electrophoresis and ultraviolet spectrophotometry, and the DNA samples were diluted to 50±5 ng / μl after passing the test for gene chip typing.

[0040] Affymetrix GeneChip 600K Chicken Genotyping Array was used for genotyping. Data quality control was performed according to the chip manual, including: using APT software for quality control before typing; using PLINK for quality control, removing SNP markers with a detection rate lower than 0.97 and deviating from Hardy-Weinberg equilibrium; using metrics.R, SNP_filter.R and SNP, CR, and FLD information analysis to screen SNPs; and using BEAGLE for genotype filling. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0041] Before the genome-wide association analysis, a multidimensional principal component analysis was performed to eliminate false positives and population structure. The first five principal components were added to the genetic model as covariate parameters, and the chicken house effect was placed in the model fixed effect. The R script "simpleM" method was used to calculate the independent test estimate of each SNP site, and 59,308 independent markers were obtained. Using multiple corrections, the genome significance threshold was 8.43×10 -7 The recommended threshold for genome size is 1.69×10 -5 The mixed linear model was used to analyze the shank circumference of the 40-week-old eggs, and the significance test P value of each SNPs marker was obtained. The matrix expression of the linear model is:

[0042] y=Wα+xβ+Gu+ε

[0043] Where y represents the sample phenotypic value vector; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the marker, β is the effect value of the marker; G is the genetic relationship matrix constructed based on the chip, u is the random effect vector (here is the breeding value); ε is the residual.

[0044] After GWAS screening, SC_tag4 was obtained that was associated with shank circumference at 40 weeks of age (Table 1). A genome-wide association analysis was performed on shank circumference of 1512 chickens at 40 weeks of age. The results are as follows Figure 1 , Figure 2 As shown. Figure 1(Manhattan plot) shows that there is a genome-significant level marker on chicken chromosome 4, and there are 29 SNPs around it that exceed the genome-significant level and 24 SNPs that exceed the genome-recommended level, which can be used as evidence to support SC_tag4. The QQ plot further verifies that the GWAS results are reliable. Figure 2 (QQ graph) It can be seen that the vast majority of SNPs that did not deviate from the oblique line were affected by genetic drift, and the SNPs at the tail of the QQ graph were affected by artificial selection. The expansion coefficient was calculated to be 0.989, indicating that there was no obvious population stratification in the tibia trait of the resource population. The genetic parameters were analyzed using the pedigree genetic relationship matrix, and the heritability of tibia circumference at 40 weeks of age was 0.24±0.035, of which the SC_tag4 genetic marker could explain 3.33% of the phenotypic variance.

[0045] Table 1 SC_tag4 genetic markers associated with tibial circumference

[0046]

[0047] Wherein: the physical position of the marker chromosome refers to the whole chicken genome (bGalGal1.mat.broiler.GRCg7b). T (minor) indicates that the frequency of the T allele is in a minor position.

[0048] Example 3

[0049] Detection and validation of genetic markers

[0050] The above SNP genetic markers were used to conduct candidate gene association analysis on the Dongxiang green-shell laying hen-white Leghorn chicken resource population. The specific steps are as follows:

[0051] 1) PCR primers: Download DNA template sequence information from NCBI website and design PCR primers using Primer Premier 6.0 software.

[0052] Amplification primers, primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0053] Table 2 Amplification primers used to detect genetic markers of shank circumference of chickens at 40 weeks of age

[0054]

[0055] 2) Genomic DNA extraction: Genomic DNA of 1512 blood samples was extracted by phenol imitation method, and PCR amplification was performed after passing the ultraviolet spectrophotometer and agarose electrophoresis tests.

[0056] 3) PCR amplification process:

[0057] ① Reaction system: 10 μl system includes 50 ng DNA template of identification material, 10 ng of forward and reverse primers, 5 μl 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0058] ② Reaction procedure: first, denaturation at 94°C for 30 s, annealing at 52.5°C for 30 s, and extension at 72°C for 30 s, for a total of 5 cycles; then denaturation at 94°C for 30 s, annealing at 52.5°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0059] 4) The amplified product is sent to a sequencing company for sequence polymorphism detection.

[0060] The sequence of the amplified fragment is as follows:

[0061] >SC_tag4

[0062] GAGGACTATGATGAGATGTGA AAGATAACCATTTTCCTCTAGAAGGTGTTTACTCTGAAACCTAATTAAAATGTCAGTTCTGTTTCTACAGATCATTTCAACACAAATGGCAGTCTGATGTTTTTGTCTTGGAGGTAGTGACCATTACTGTGGAGGGCAACAGTGGGGCTCTAAGTAATTAATATTTTTTTGTGGCAAGGAGT TACAAAGCCAATTATTAAAATAATCACCACTAACACTACAAAAGTAAGGAGGAGATACCTTTCTTTCTTTTGCCTTGGCACTTACAGATGTGCTGGCTGCTAAAACTTGTGCAACTTTCAGTC[C / T]TTGGAGTGTGAGGCTTGTTTAAAACGTCTACTTGACAGTTTCAGGTGTTTTTAGTT ATCTCAGGCTTGTGAAGCACTGTTTGTGTACTTCTGAGGACTGTGACACCTGAGCTGGATTACATATTAACAAAGCAAATTAACAACAAAGCAAAACGAAATAGCAAAGCAAAGATGGCAGGCATTGGCATGGGGAATTTTACATTGCTCACTGTTTTTTG TAACCTCCAGATAGCAGTAAG

[0063] In the sequence, the ones marked with [] are mutation sites, those in brackets are allele variations, and the primer sequences are shown in bold and underlined at the beginning and end of the sequence.

[0064] 5) Association analysis: All subjects had genotypes and 40-week-old tibial circumferences, and then a significance test was performed. Figure 3 As shown, the tibia circumference of individuals with CC genotype at 40 weeks of age was 3.42±0.14cm, the tibia circumference of individuals with CT genotype at 40 weeks of age was 3.46±0.18cm, and the tibia circumference of individuals with TT genotype at 40 weeks of age was 3.56±0.21cm. By using genotyping technology, increasing the frequency of TT genotype can significantly improve the tibia circumference of laying hens.

[0065] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0066] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0067] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An application of a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding, characterized in that: The SNP genetic markers affecting chicken shank circumference include SC_tag4, which corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C.

2. An early selection method for chicken shank girth traits, characterized in that: The early selection method comprises performing early selection on the chicken shank girth trait based on the genotype of the SNP genetic marker SC_tag4; The SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C.

3. The early selection method for chicken shank girth traits according to claim 2, characterized in that: The early selection method specifically includes: Detecting the genotype of the SC_tag4 genetic marker in the chicken genome to be tested; Perform early selection on the chicken shank girth trait to be tested based on the genotype of the SC_tag4; Among them, the tibial circumference of the TT genotype individual of SC_tag4 is greater than the tibial circumference of the CC and CT genotype individuals.

4. The early selection method for chicken shank girth traits according to claim 3, characterized in that: The genotype of the SC_tag4 genetic marker in the chicken genome to be tested is specifically detected by: The genomic DNA of the chicken to be tested was amplified by PCR using Pr_sc4f and Pr_sc4r as primers; The PCR amplification product was sequenced to obtain the genotype of position 75909527 of the positive strand of the tested chicken chromosome 4; Among them, the nucleotide sequence of the Pr_sc4f is shown as SEQ ID NO.1, and the nucleotide sequence of the Pr_sc4r is shown as SEQ ID NO.

2.

5. The early selection method for chicken shank girth traits according to claim 3 or 4, characterized in that: The breeds of chickens to be tested include Dongxiang green-shell laying hens and / or white Leghorn chickens.

6. A primer for detecting a SNP genetic marker SC_tag4, characterized in that: The SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 8th intron sequence of gene LDB2, where the base is T or C; The primers include Pr_sc4f and Pr_sc4r, the nucleotide sequence of Pr_sc4f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc4r is shown in SEQ ID NO.

2.

7. Use of the primer for detecting SNP genetic marker SC_tag4 as claimed in claim 6 in chicken genetic breeding.

8. A kit for detecting SNP genetic marker SC_tag4, characterized in that: The kit comprises the primers for detecting the SNP genetic marker SC_tag4 as described in claim 6.

9. Use of the kit for detecting SNP genetic marker SC_tag4 as claimed in claim 8 in chicken genetic breeding.

10. Application of SNP genetic marker SC_tag4 in predicting shank circumference of chickens at 40 weeks of age, characterized in that: The SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C.

Images