Non-heading Chinese cabbage U6 promoter and application thereof

Abstract

The invention discloses a non-heading Chinese cabbage U6 promoter and application thereof. According to the invention, a specific primer is designed by taking genome DNA (Deoxyribonucleic Acid) of the non-heading Chinese cabbage as a template, and PCR (Polymerase Chain Reaction) amplification is carried out on the genome DNA of the non-heading Chinese cabbage through the specific primer, so that a BrU6P3 promoter with a DNA nucleotide sequence as shown in SEQ ID NO: 1 or a BrU6P3-3 promoter with a DNA nucleotide sequence as shown in SEQ ID NO: 2 is obtained. The non-heading Chinese cabbage U6 promoter provides a new tool for gene editing and genetic improvement of non-heading Chinese cabbage and related crops.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a non-heading Chinese cabbage U6 promoter and application thereof. Background Art

[0002] Genetic transformation technology has played an important role in improving crop traits, including yield, quality, and resistance to biotic and abiotic stresses. Among them, gene editing technology based on CRISPR / Cas9 has become an emerging technology for crop genetic improvement due to its advantages of simple operation, high editing efficiency, support for multi-target editing, and diverse editing forms. It has played an important role in improving many crop traits. At present, the CRISPR / Cas9 gene editing technology of non-heading cabbage is still immature, and one of the important factors affecting the efficiency of gene editing is the gene editing vector. In dicotyledons, the sgRNA on the gene editing vector is usually driven by the U6 promoter, and the U6 promoter sequences used in different species are not the same. At present, the gene editing vector constructed using the U6 promoter of Arabidopsis is widely used in dicotyledons. Therefore, cloning the endogenous U6 promoter of non-heading cabbage with high transcriptional activity and as short a sequence length as possible is conducive to the construction of CRISPR / Cas9 gene editing vectors and the improvement of the system, which has important research significance and application value for the study of functional genes and genetic breeding of non-heading cabbage. Summary of the invention

[0003] In order to overcome the shortcomings and deficiencies of the prior art, the object of the present invention is to provide a non-heading Chinese cabbage U6 promoter and application thereof.

[0004] The present invention is achieved by providing a non-heading cabbage U6 promoter, which is a BrU6P3 promoter or a BrU6P3-3 promoter truncated on the basis of BrU6P3, wherein the DNA nucleotide sequence of the BrU6P3 promoter is shown in SEQ ID NO: 1, and the DNA nucleotide sequence of the BrU6P3-3 promoter is shown in SEQ ID NO: 2. The promoter is used in molecular breeding of non-heading cabbage.

[0005] The present invention further discloses a method for cloning the non-heading Chinese cabbage U6 promoter, which comprises the following steps:

[0006] (1) Design specific primers using non-heading Chinese cabbage genomic DNA as a template; wherein the specific primer for the BrU6P3 promoter is:

[0007] BrU6P3-F: 5'-TGGTCACTGGAGCAGCCTGCAGCGTC-3';

[0008] BrU6P3-R: 5'-TGCTAATCTTCTCTGTATCGTTCCAA-3';

[0009] The specific primers for the BrU6P3-3 promoter are:

[0010] BrU6P3-3-F: 5'-TACTAAAAGTAATGTACACTAAATAA-3';

[0011] BrU6P3-3-R: 5'-TGCTAATCTTCTCTGTATCGTTCCAA-3';

[0012] (2) PCR amplification of non-heading cabbage genomic DNA was performed using the above-mentioned specific primers to obtain the non-heading cabbage U6 promoter BrU6P3 or BrU6P3-3.

[0013] The invention further discloses the application of the non-heading cabbage U6 promoter in molecular breeding of non-heading cabbage.

[0014] Compared with the shortcomings and deficiencies of the prior art, the present invention has the following beneficial effects: in the present invention, BrU6P3 and BrU6P3-3 are respectively fused with the GUS gene to construct the pBI121 vector, and the callus tissue of non-heading cabbage is infected with Agrobacterium. After GUS staining, it is confirmed that both BrU6P3 and BrU6P3-3 have promoter activity, and the promoter activity of BrU6P3-3 is higher than that of BrU6P3. The non-heading cabbage U6 promoter (BrU6P3-3) provides a new tool for gene editing and genetic improvement of non-heading cabbage and related crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 These are the electrophoresis images of PCR amplification of the U6 promoter of non-heading Chinese cabbage, where Figure a is the BrU6P3 promoter, with a size of 740 bp, and Figure b is the BrU6P3-3 promoter, with a size of 252 bp;

[0016] Figure 2 This is the GUS staining of non-heading cabbage callus, and the control group is transiently infected with Agrobacterium GV3101 containing an empty vector. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0018] 1. BrU6P3 and BrU6P3-3 promoter sequence amplification

[0019] PCR amplification was performed using genomic DNA from leaves of non-heading Chinese cabbage (Baiyuqing No. 1) as template and specific primers.

[0020] The primer sequences are:

[0021] BrU6P3-F: 5'-TGGTCACTGGAGCAGCCTGCAGCGTC-3';

[0022] BrU6P3-R: 5'-TGCTAATCTTCTCTGTATCGTTCCAA-3'.

[0023] BrU6P3 DNA was used as template and specific primers were used for PCR amplification.

[0024] The primer sequences are:

[0025] BrU6P3-3-F: 5'-TACTAAAAGTAATGTACACTAAATAA-3';

[0026] BrU6P3-3-R: 5'-TGCTAATCTTCTCTGTATCGTTCCAA-3'.

[0027] Prime STAR high-fidelity enzyme was used for PCR reaction, and the reaction system was as follows: 98°C denaturation for 10 s, 55°C annealing for 5 s, 72°C extension for 5 s, 34 cycles, and final extension for 10 min.

[0028] The amplified products were subjected to electrophoresis, and the results were as follows. Figure 1 shown.

[0029] The amplified product was purified and cloned into the pMD18-T vector to obtain BrU6P3-T and BrU6P3-3-T plasmids, which were transformed into Escherichia coli for sequencing analysis, and finally a complete BrU6P3 promoter sequence of 740 bp and a BrU6P3-3 promoter sequence of 252 bp were obtained.

[0030] 2. The BrU6P3 promoter sequence was constructed by seamless cloning into the pBI121 vector containing GUS. The 35S promoter at the front end of the GUS on the original vector was replaced with BrU6P3. The primers used are as follows. The underlined sequence is the homologous sequence to the pBI121 vector:

[0031] pBI-BrU6P3-F:5'- TCAGAAGACCAAAGGGCAAT TGGTCACTGGAGC AGCCTGC-3′;

[0032] pBI-BrU6P3-R:5'- GGATCCTCTAGAGTCCCCCGTGCTAATCTTCTCT GTATCG-3'.

[0033] Using BrU6P3-T plasmid as template, pBI-BrU6P3 sequence with homology arms at both ends was obtained by Hieff The recombination reaction system (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.) was used to construct BrU6P3 into a vector named BrU6P3-GUS.

[0034] The BrU6P3-3 promoter sequence was constructed by seamless cloning into the pBI121 vector containing GUS. The 35S promoter at the front end of the GUS on the original vector was replaced with BrU6P3-3. The primers used are as follows. The underlined sequence is the homologous sequence to the pBI121 vector:

[0035] pBI-BrU6P3-3-F:5'- TCAGAAGACCAAAGGGCAAT TACTAAAAGTAA TGTACACT-3′;

[0036] pBI-BrU6P3-3-R:5'- GGATCCTCTAGAGTCCCCCG TGCTAATCTTCTC TGTATCG-3'.

[0037] Using BrU6P3-3-T plasmid as template, pBI-BrU6P3-3 sequence with homology arms at both ends was obtained by Hieff The recombination reaction system (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.) was used to construct BrU6P3-3 into a vector and named BrU6P3-3-GUS.

[0038] 3. The plasmids containing BrU6P3-GUS and BrU6P3-3-GUS were transferred into Agrobacterium GV3101 respectively. The preparation process was as follows: the positive colonies were inoculated into 5 mL LB liquid medium (containing 50 μg / mL Kan, 20 μg / mL Rif antibiotics), 28°C, 200 rpm, and after overnight culture, the bacterial solution was transferred to 50 mL LB liquid medium (containing 50 μg / mL Kan, 20 μg / mL Rif antibiotics, 20 μM acetosyringone) at a ratio of 1%, and the Agrobacterium concentration was continued to reach OD 600 = 0.4-0.6, 5000 rpm, room temperature, centrifuge for 10 min to collect the bacteria, resuspend the bacteria in MS liquid medium (containing 10 mM MgCl2, 150 μM acetosyringone), and adjust the Agrobacterium concentration to OD 600=0.8, and then allowed to stand at 28°C for 2h, the prepared suspension was used to infect the non-heading cabbage callus. After 2d of co-culture, the callus was stained with GUS, and stained overnight in a 37°C shaker in the dark. The staining solution was discarded, and the callus was decolorized with 95% alcohol to observe the GUS staining. The non-heading cabbage callus infected with the empty GV3101 Agrobacterium was used as a control. The staining was as follows: Figure 2 As shown, the results showed that both BrU6P3 and BrU6P3-3 had promoter activity, and the activity of BrU6P3-3 was higher than that of BrU6P3.

[0039] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A non-heading cabbage U6 promoter, characterized in that The non-heading Chinese cabbage U6 promoter is a BrU6P3 promoter or a BrU6P3-3 promoter, wherein the DNA nucleotide sequence of the BrU6P3 promoter is shown in SEQ ID NO:1, and the DNA nucleotide sequence of the BrU6P3-3 promoter is shown in SEQ ID NO:

2.

2. The method for cloning the non-heading Chinese cabbage U6 promoter according to claim 1, characterized in that: The method comprises the following steps: (1) Design specific primers using non-heading Chinese cabbage genomic DNA as a template; wherein the specific primer for the BrU6P3 promoter is: BrU6P3-F: 5'-TGGTCACTGGAGCAGCCTGCAGCGTC-3'; BrU6P3-R: 5'-TGCTAATCTTCTCTGTATCGTTCCAA-3'; The specific primers for the BrU6P3-3 promoter are: BrU6P3-3-F: 5'-TACTAAAAGTAATGTACACTAAATAA-3'; BrU6P3-3-R: 5'-TGCTAATCTTCTCTGTATCGTTCCAA-3'; (2) PCR amplification of non-heading cabbage genomic DNA was performed using the above-mentioned specific primers to obtain the non-heading cabbage U6 promoter BrU6P3 or BrU6P3-3.

3. Use of the non-heading Chinese cabbage U6 promoter according to claim 1 in molecular breeding of non-heading Chinese cabbage.

Images