Preparation method and application of gene modified cell medicine for expressing MCM

Abstract

The invention discloses a preparation method and application of a genetically modified cell drug for expressing MCM, and relates to the field of cell therapy, in particular to a preparation method and application of a genetically modified cell drug for expressing MCM. The methylmalonyl-coenzyme A mutase gene MUT is introduced into cells through a gene delivery vector, then multiplication culture is carried out in vitro, normal MCM can be expressed, and meanwhile, the invention discloses application of the methylmalonyl-coenzyme A mutase gene modified cell medicine in methylmalonic acidmia treatment. According to the invention, normal MCM is expressed through cells, MMA pathogenic factors are radically solved, the cell drug provided by the invention can be used as a drug factory for producing MCM, MCM can be continuously expressed for a long time, the defects of short MCM protein half-life period and frequent lifelong medication in the existing methylmalonic acidmia treatment method are solved, and the method is suitable for clinical application. And a new thought is provided for treatment of genetic diseases caused by other gene mutations.

Description

Technical Field

[0001] The present invention relates to the technical field of cell therapy, and in particular to a preparation method and application of a gene-modified cell drug expressing MCM. Background Art

[0002] Methylmalonic acidemia, also known as methylmalonic aciduria, is a typical autosomal recessive genetic metabolic disease. The incidence of MMA in Western populations is 1 / 48000-1 / 61000, and the incidence of MMA in my country is about 1 / 4000-1 / 26000. Based on my country's population base and high incidence, MMA brings a huge burden to society and families. The main cause of MMA is methylmalonyl CoA mutase deficiency or its coenzyme adenosylcobalamin metabolic defect. The existing treatments for MMA are mainly restricted diet, supportive care and liver transplantation. Restricting natural protein intake and supplementing with special milk powder that removes methionine, valine, threonine and serine is the main treatment before liver transplantation. However, restricted diet therapy cannot Despite effective control of disease progression, irreversible damage to multiple organs, including the nervous system, kidneys, and motor function, still occurs. Increasing liver MCM enzyme activity through liver transplantation has been used in the surgical treatment of MMA, especially in patients with severe disease and repeated metabolic decompensation. The circulating methylmalonic acid in transplanted patients has been significantly reduced, the rate of metabolic decompensation has been greatly reduced, and the quality of life has been improved. However, liver transplantation cannot completely cure MMA and there are many problems, such as limited organ donors, possible complications during or after surgery, the need for lifelong immunosuppressive therapy after transplantation, and uncertain long-term clinical sequelae, expensive treatment costs, etc. The treatment needs of MMA patients are still not met, and the overall long-term survival is still low. Therefore, it is extremely urgent to study new methods for the treatment of MMA.

[0003] Gene therapy for MMA based on multiple mechanisms is under development; gene delivery vectors such as recombinant adenovirus, recombinant adeno-associated virus and LNPmRNA have proven their effectiveness in the mouse MMA model; a large number of studies have shown that in preclinical models of MMA, the use of Ad5, AAV2, AAV8 or AAV9 vectors expressing the MMUT gene can rescue Mmut- / - mice to prevent death in the first few days after birth; however, due to the non-replicative nature of Ad and AAV vectors, a major problem with gene therapy in pediatric patients is vector degradation and its dilution as the child grows, which may lead to a complete loss of efficacy; another limitation of Ad and AAV in human gene therapy is the formation of high-titer neutralizing antibodies after administration, which affects repeated administration; it is also worth noting that MMA mice and wild-type control mice were observed to have a low level of mRNA expression after treatment with rAAV Genetic toxicity in the formation of hepatocellular carcinoma is similar to that observed in other studies; unlike viral vector delivery, lipid nanoparticle-mRNA gene therapy is not limited by pre-existing immunity, and because mRNA is not transported to the nucleus, the risk of insertion mutations is reduced; using lipid nanoparticles to encapsulate codon-optimized hMUTmRNA and intravenously inject MMA model mice, the study found that MCM protein expression in the liver lasted for 7 days, liver MUT activity increased, and plasma methylmalonic acid decreased by 75%-85% and was associated with increased hMUT protein expression and activity in the liver. Repeated administration of hMUTmRNA significantly increased mouse survival and body weight; however, because mRNA provides transient, half-life-dependent protein expression, the duration of mRNA-encoded protein is limited, and repeated systemic administration is required to achieve long-term efficacy;

[0004] Although MMA treatment methods have been explored for decades, there is no approved drug to address the potential defects of MMA. Existing methods have certain clinical limitations, including long-term medication, high safety risks, heavy economic burden, and inability to completely control disease progression. Extending the half-life of MCM protein to reduce the frequency of dosing and improve the safety of treatment is an urgent problem that needs to be solved in MMA treatment. Using cells expressing normal genes to treat gene defect diseases is a potential strategy. For this purpose, a method for preparing a gene-modified cell drug expressing MCM and its application are provided. Summary of the invention

[0005] 1. Technical issues to be solved

[0006] In view of the deficiencies of the prior art, the present invention discloses a method for preparing a gene-modified cell drug expressing MCM and its application, so as to solve the problems raised in the above background technology.

[0007] (II) Technical solution

[0008] To achieve the above objectives, the present invention is implemented through the following technical scheme: a method for preparing a genetically modified cell drug expressing MCM, comprising the following steps: introducing the methylmalonyl-CoA mutase (MCM) gene into cells through a gene delivery vector, followed by amplification and culture in vitro to express normal MCM.

[0009] Among them, the coding gene of the methylmalonyl-CoA mutase (MCM) is the normal human MUT gene, which is amplified from human embryonic lung fibroblasts WI38 by PCR, and its nucleotide and amino acid sequences are shown at the end of the document.

[0010] The gene delivery vectors for introducing the MUT gene into cells of the present invention include, but are not limited to, viral vectors, transposons, gene knock-ins, liposomes, nanogold particles, exosomes, and the like.

[0011] Furthermore, the viral vector includes but is not limited to a lentiviral vector, a retroviral vector, and the like.

[0012] Furthermore, the lentiviral vector includes but is not limited to a three-plasmid lentiviral system and a four-plasmid lentiviral system.

[0013] Further, according to a preferred embodiment of the present invention, the lentivirus used is a four-plasmid packaging system; including a lentiviral expression plasmid carrying a target gene, lentiviral packaging plasmids pMDLg / pRRE (Kan+) and pRSV-REV (Kan+), and a lentiviral envelope plasmid pMD2.G (Kan+).

[0014] Specifically, the expression plasmid carrying the target gene is pRRLSIN-EF1α-MUT, and its construction method comprises the following steps:

[0015] S1: Extract RNA from human embryonic lung fibroblast WI38;

[0016] S2: cDNA is synthesized using RNA as a template through the reverse transcription kit RevertAidFirstStrand cDNASynthesisKit;

[0017] S3: Amplify the MUT fragment by PCR using cDNA as a template;

[0018] S4: Double digest the target fragment MUT and the vector pRRLSIN-EF1α-PAH with MluI and SalI, and recover the digestion products;

[0019] S5: the recovered enzyme digestion products are connected;

[0020] S6: The recombinant vector was identified by colony PCR, and the positive clones were further verified by sequencing. The recombinant vector with the correct sequence was named pRRLSIN-EF1α-MUT.

[0021] Furthermore, the PCR primers in S3 are MUT-F2 (MluI) / MUT-R (SalI) (the sequence of MUT-F2 (MluI) is: CGACGCGTGCCACCATGTTAAGAGCTAAGAATC AGC; the sequence of MUT-R (SalI) is: ACGCGTCGACTTATACAGATTGCTGCTTCT TT).

[0022] Furthermore, the pRRLSIN-EF1α-MUT plasmid was extracted using an endotoxin-free plasmid extraction kit (Extract 1α-MUT plasmid and store it in a -20°C refrigerator.

[0023] Furthermore, the four lentiviral plasmids were co-transfected into HEK293T cells, and the lentivirus was packaged and purified.

[0024] Furthermore, the transfection reagent is PEI.

[0025] The host cells of the present invention include but are not limited to stem cells and peripheral blood mononuclear cells; preferably, the host cells are stem cells.

[0026] Furthermore, the type of stem cells includes but is not limited to mesenchymal stem cells, hematopoietic stem cells, induced pluripotent stem cells, etc.; optimally, the type of stem cells is mesenchymal stem cells.

[0027] Furthermore, the mesenchymal stem cells include but are not limited to umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells, and dental pulp mesenchymal stem cells.

[0028] Further, according to a preferred embodiment of the present invention, the umbilical cord mesenchymal stem cells are separated from umbilical cord Wharton's jelly, comprising the following steps:

[0029] S1: The umbilical cord of a full-term healthy fetus was collected, immersed in a centrifuge tube containing 1% penicillin and streptomycin in PBS, and transported to the laboratory at low temperature (2-8°C).

[0030] S2: Cut the umbilical cord into several small pieces and wash them;

[0031] S3: Separate Wharton's jelly and cut it into 1mm3 tissue blocks and wash with saline;

[0032] S4: Add the chopped Wharton's jelly into a culture bottle containing serum-free medium, culture in a 37°C, 5% CO2 incubator, and perform a half-medium change after 5-7 days of culture;

[0033] S5: Continue to culture and long spindle cells grow from the edge of the tissue block. When the cells cover about 50% of the bottom of the bottle, discard the culture medium and tissue block in the culture bottle, and add physiological saline to wash;

[0034] S6: add trypsin for digestion and subculture;

[0035] S7: Cryopreserve cells and establish an umbilical cord mesenchymal cell bank.

[0036] Furthermore, the serum-free culture medium described in S4 was purchased from Youkang Biotechnology.

[0037] Preferably, a method for expressing methylmalonyl-CoA mutase (MCM) in MSC cells comprises the following steps: subculturing MSC cells in a resuscitation cell bank, inoculating MSCs in good growth state into a culture bottle, and after overnight culture, adding pRRLSIN-EF1α-MUT lentivirus and polybrene to infect the cells. After 24 hours of lentivirus infection, the medium is replaced, serum-free medium is added, and the amplification culture is continued.

[0038] Furthermore, the MOI of lentivirus infection is 5.

[0039] Furthermore, the concentration of polybrene added to the lentiviral infection is 6 μg / mL.

[0040] Preferably, the gene-modified cell drug expressing MCM is used to treat methylmalonic acidemia (MMA).

[0041] Furthermore, the methylmalonic acidemia is caused by a mutation in the methylmalonyl-CoA mutase gene (MUT) in the body.

[0042] Furthermore, the genetically modified cell medicine can continuously express methylmalonyl-CoA mutase (MCM).

[0043] Further, according to a specific embodiment of the present invention, the gene-modified cell medicine still expresses MCM at a relatively high level on the 6th day.

[0044] The present invention discloses a preparation method and application of a gene-modified cell drug expressing MCM, which has the following beneficial effects:

[0045] 1. The preparation method and application of the gene-modified cell drug expressing MCM, which introduces the normal human MUT gene into cells through a gene delivery vector, can express normal MCM in the cells, and solve the pathogenic factors of MMA from the root.

[0046] 2. The preparation method and application of the gene-modified cell drug expressing MCM provide a methylmalonyl-CoA mutase gene-modified cell drug, which can be used as a "drug factory" for producing MCM and can continuously express MCM for a long time, thereby solving the drawbacks of the short half-life of MCM protein and frequent lifelong medication in existing treatment methods. In addition, the present invention modifies cells in vitro and is a safer and more effective MMA treatment drug.

[0047] 3. The preparation method and application of the gene-modified cell drug expressing MCM provide a cell drug for the treatment of methylmalonic acidemia, and provide a new idea for the treatment of genetic metabolic diseases caused by other gene mutations, which has huge economic value and social significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is a diagram of the PCR amplification product of the MUT fragment detected by agarose gel electrophoresis of the present invention;

[0049] Figure 2 This is a diagram of the pRRLSIN-EF1α-PAH digestion product detected by agarose gel electrophoresis of the present invention;

[0050] Figure 3 This is a colony PCR identification of the lentiviral expression vector pRRLSIN-EF1α-MUT of the present invention;

[0051] Figure 4 This is a plasmid map of the lentiviral expression vector pRRLSIN-EF1α-MUT of the present invention;

[0052] Figure 5 This is a diagram of MSC cell phenotype detected by flow cytometry of the present invention;

[0053] Figure 6 This is a graph of the expression of MCM in methylmalonyl-CoA mutase gene-modified cells detected by western blotting at different time points in the present invention. DETAILED DESCRIPTION

[0054] The present invention discloses a method for preparing a gene-modified cell drug expressing MCM and its application, such as Figure 1-6 As shown, in order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the drawings in the present invention and by way of example.

[0055] Example 1. Production of lentivirus pRRLSIN-EF1α-MUT

[0056] 1. Construction of lentiviral expression vector pRRLSIN-EF1α-MUT

[0057] RNA of human embryonic lung fibroblast WI38 was extracted, and cDNA was synthesized by reverse transcription kit Revert Aid First Strand cDNA Synthesis Kit; the coding gene sequence MUT of methylmalonyl-CoA mutase (MCM) was amplified by PCR, and MUT was inserted between the MluI and SalI restriction sites of pRRLSIN-EF1α-PAH. The constructed recombinant lentiviral vector was named pRRLSIN-EF1α-MUT. The specific process was as follows: first, the synthesized cDNA was used as a template, MUT-F2 (MluI) / MUT-R (SalI) were used as primers (the sequence of MUT-F2 (MluI) was: CGACGCGTGCCACCATGTTAAGAGCTAAGAATCAGC; the sequence of MUT-R (SalI) was: ACGCGTCGACTTATACAGATTGCTGCTTCTTT), and the MUT fragment was amplified. The results were as follows. Figure 1 As shown, lane 1 and lane 2 are MUT fragments; the target fragment MUT and the vector pRRLSIN-EF1α-PAH were double-digested with MluI and SalI, wherein the MluI-MUT-SalI digestion product was directly recovered, and the vector pRRLSIN-EF1α-PAH digestion product was recovered after agarose gel electrophoresis. The results are shown in Figure 2 As shown, lane1 is the vector restriction fragment; the recovered target fragment and the vector restriction product are connected, and the connection product is transformed into TransStbl3 chemical competent cells; 10 single colonies are picked and identified by colony PCR, and the results are shown as follows Figure 3 As shown in the figure, clone 9 amplified the target band and the band was obvious, indicating that it might be a positive clone. After shaking the bacteria, the plasmid was extracted and the plasmid was sequenced by Sanger, and the sequence was found to be correct. The above results show that the lentiviral expression vector pRRLSIN-EF1α-MUT was successfully constructed. The plasmid map is shown in the figure Figure 4 As shown; the plasmid was extracted with an endotoxin-free plasmid extraction kit and stored in a -20℃ refrigerator;

[0058] Gene delivery vectors include but are not limited to viral vectors, transposons, gene knock-in, liposomes, nanogold particles, exosomes, etc.; viral vectors include but are not limited to lentiviral vectors, retroviral vectors, etc.; lentiviral vectors include but are not limited to three-plasmid lentiviral systems and four-plasmid lentiviral systems;

[0059] Host cells include but are not limited to stem cells and peripheral blood mononuclear cells; types of stem cells include but are not limited to mesenchymal stem cells, hematopoietic stem cells, induced pluripotent stem cells, etc.; mesenchymal stem cells include but are not limited to umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells, and dental pulp mesenchymal stem cells.

[0060] 2. Lentivirus packaging and purification

[0061] The frozen HEK293T cells were revived and subcultured with DMEM complete medium (DMEM medium + 10% FBS); HEK293T cells were inoculated into 10-layer cell factories, DMEM complete medium was added, and the cells were cultured overnight to allow the cells to reach 80-90% fusion, and plasmid transfection was performed; lentiviral packaging plasmids (expression plasmid pRRLSIN-EF1α-MUT, lentiviral packaging plasmids pMDLg / pRRE (Kan+) and pRSV-REV (Kan+), lentiviral envelope plasmid pMD2.G (Kan+)) and PEI were added to serum-free DMEM, mixed, and allowed to stand for 5 minutes; the latter was added to the former, mixed thoroughly, and allowed to stand for 2 0min, forming a DNA-PEI complex; adding the DNA-PEI complex to 1L DMEM culture medium containing 5% FBS, mixing thoroughly, replacing the culture medium in the 10-layer cell factory, and placing in a 37°C, 5% CO2 incubator for culture; collecting the culture supernatant 48h and 72h after transfection and storing in a refrigerator at 2-8°C; mixing the collected culture supernatants, and using a capsule filter (Sartorius) to remove cells and cell debris; concentrating the clarified filtered lentiviral supernatant 10-15 times through a Spectrum tangential flow filtration system; filtering through a 0.45μm filter membrane, and then performing chromatography purification; sterilizing and filtering the purified lentivirus through a 0.22μm filter, aliquoting, and storing in a -80°C refrigerator.

[0062] Example 2: Isolation and culture of mesenchymal stem cells

[0063] The umbilical cord of a full-term healthy fetus was collected, immersed in a centrifuge tube containing 1% penicillin and streptomycin in PBS, and transported to the laboratory at low temperature (2-8°C); the umbilical cord was taken out and placed in a 10 cm culture dish, cut into several small pieces, and washed three times with saline containing double antibody and saline respectively; the washed umbilical cord was placed in a new 10 cm culture dish, the artery and vein were removed, the Wharton's jelly was separated and fully cut into 1 mm3 tissue blocks, and washed twice with saline by centrifugation (500g, 5min); the cut Wharton's jelly was added to serum-free culture medium In the culture flask, shake gently to evenly disperse the tissue block, and place it in a 37°C, 5% CO2 incubator for culture; change the medium halfway after 5-7 days of culture, and continue to culture in the incubator until long spindle cells grow from the edge of the tissue block; when the cells cover about 50% of the bottom of the flask, discard the culture medium and tissue block in the culture flask, add physiological saline to wash twice; add trypsin to digest, and subculture, marked as P1; when the adherent cells cover 90% of the bottom of the flask, add trypsin to digest, subculture at a ratio of 1:5, and detect the phenotype by flow cytometry. The results are as follows Figure 5As shown, CD105, CD73, and CD90 on the surface of MSC cells were positive and the positive rates were all above 95%, and CD34 was negative, indicating that MSC cells were successfully isolated; the cells were frozen with freezing fluid, an umbilical cord mesenchymal cell bank was established, and the corresponding generations were marked.

[0064] Example 3: Genetically modified cells expressing methylmalonyl-CoA mutase can continuously express MCM

[0065] MSC cells were taken from the cell bank, revived, and added to serum-free medium for subculture; MSCs in good growth state were inoculated into 6-well plates and placed in a 37°C, 5% CO2 incubator; after overnight culture, pRRLSIN-EF1α-MUT lentivirus purified in Example 1 (MOI=5) and polybrene (final concentration 6 μg / mL) were added; centrifugal infection, 700g, 1.5h, and cultured in a 37°C, 5% CO2 incubator; the medium was changed 6h after lentivirus infection, and the culture was continued in the incubator, and the culture supernatants were collected at 24h, 48h, 72h, 96h, and 120h after lentivirus infection; the expression of methylmalonyl-CoA mutase (MCM) at different times after lentivirus infection was detected by western blotting, and the results were as follows: Figure 6 As shown in the figure, lane1 is the expression of MCM in the supernatant of MSC cells, and lanes 2-6 are the expression of MCM in the supernatant of MSC cells 24h, 48h, 72h, 96h, and 120h after pRRLSIN-EF1α-MUT lentivirus infection. The results showed that no target band was detected in the supernatant of MSC cells not infected with lentivirus, and the target band was detected in the supernatant of MSC infected with lentivirus at all time points and the size was in line with expectations, and the protein expression level increased with time, and maintained at a high level at 120h. No attenuation trend was observed, indicating that after MSCs were infected with pRRLSIN-EF1α-MUT lentivirus, normal human MCM was expressed and could be continuously secreted outside the cells; therefore, methylmalonyl-CoA mutase gene-modified cells can be used as a therapeutic drug for methylmalonic acidemia (MMA), acting as a "drug factory" for producing MCM in the body, continuously producing methylmalonyl-CoA mutase (MCM), thereby compensating for the accumulation of methylmalonic acid and related organic acids caused by MUT gene mutations, and solving the shortcomings of existing treatments, such as the short half-life of MCM protein and frequent lifelong medication.

[0066] The nucleotide sequence of the gene encoding methylmalonyl-CoA mutase (MCM) is;

[0067]

[0068] The amino acid sequence of the methylmalonyl-CoA mutase (MCM) encoding gene is as follows;

[0069] MLRAKNQLFLLSPHYLRQVKESSGSRLIQQRLLHQQQPLHPEWAALAKKQLKGKNPEDLIWHTPEGISIKPLYSKRDTMDLPEELPGVKPFTRGPYPTMYTFRPWTIRQYAGFSTVEESNKFYKDNIKAGQQGLSVAFDLATHRGYDSDNPRVRGDVGMAGVAIDTVEDTKILFDGIPLEKMSVSMTMNGAVIPVLANFIVTGEEQGVPKEKLTGTIQNDILKEFMVRNTYIFPPEPSMKIIADIFEYTAKHMPKFNSISISGYHMQEAGADAILELAYTLADGLEYSRTGLQAGLTIDEFAPRLSFFWGIGMNFYMEIAKMRAGRRLWAHLIEKMFQPKNSKSLLLRAHCQTSGWSLTEQDPYNNIVRTAIEAMAAVFGGTQSLHTNSFDEALGLPTVKSARIARNTQIIIQEESGIPKVADPWGGSYMMECLTNDVYDAALKLINEIEEMGGMAKAVAEGIPKLRIEECAARRQARIDSGSEVIVGVNKYQLEKEDAVEVLAIDNTSVRNRQIEKLKKIKSSRDQALAERCLAALTECAASGDGNILALAVDASRARCTVGEITDALKKVFGEHKANDRMVSGAYRQEFGESKEITSAIKRVHKFMEREGRRPRLLVAKMGQDGHDRGAKVIATGFADLGFDVDIGPLFQTPREVAQQAVDADVHAVGISTLAAGHKTLVPELIKELNSLGRPDILVMCGGVIPPQDYEFLFEVGVSNVFGPGTRIPKAAVQVLDDIEKCLEKKQQSV;

[0070] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for preparing a genetically modified cell drug expressing MCM, characterized in that: The methylmalonyl-CoA mutase MCM gene is introduced into host cells through a gene delivery vector, and then amplified and cultured in vitro and can express normal MCM for a long time.

2. The method for preparing a genetically modified cell drug expressing MCM according to claim 1, characterized in that: The methylmalonyl-CoA mutase encoding gene is normal human MUT, which is amplified from human embryonic lung fibroblast WI38 by PCR.

3. The method for preparing a genetically modified cell drug expressing MCM according to claim 1, characterized in that: The gene delivery vector is a viral vector.

4. The method for preparing a genetically modified cell drug expressing MCM according to claim 3, characterized in that: The viral vector is a lentiviral vector.

5. The method for preparing a genetically modified cell drug expressing MCM according to claim 4, characterized in that: The lentiviral vector uses a four-plasmid system.

6. The method for preparing a genetically modified cell drug expressing MCM according to claim 5, characterized in that: The host cell is a stem cell.

7. The method for preparing a genetically modified cell drug expressing MCM according to claim 6, characterized in that: The type of stem cells is mesenchymal stem cells.

8. The method for preparing a genetically modified cell drug expressing MCM according to claim 7, characterized in that: The mesenchymal stem cells are umbilical cord mesenchymal stem cells, which are infected with a four-plasmid lentiviral vector to make them express normal MCM, and then cultured and amplified in vitro to obtain a gene-modified cell drug expressing normal MCM.

9. The use of a genetically modified cell drug expressing MCM according to any one of claims 1 to 8, characterized in that: The cell medicine is used for treating methylmalonic acidemia, and the cells can express and secrete MCM in vivo.

Images