An RNAi recombinant vector resistant to both whitefly and tomato yellow leaf curl virus, its construction method and application

By constructing an RNAi recombinant vector in tomatoes and using the DNAβ promoter specifically expressed in the phloem to target key sequences of whiteflies and TYLCV, the problem of whitefly and TYLCV control was solved, and highly efficient insect and disease resistance was achieved.

CN119662725BActive Publication Date: 2025-11-14INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411916612.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-11-14
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control whiteflies and the tomato yellow leaf curl virus (TYLCV) they transmit. Furthermore, whiteflies have developed resistance to pesticides, making control difficult.

Method used

An RNAi recombinant vector resistant to both whitefly and tomato yellow leaf curl virus was constructed. A hairpin structure targeting the key sequences of the whitefly genes BtACTB and TYLCV was driven by the phloem-specific expression of the geminivirus DNAβ promoter. The vector was then introduced into tomatoes via Agrobacterium-mediated transformation to obtain transgenic plants resistant to both whitefly and TYLCV.

Benefits of technology

It significantly reduces the survival rate of whiteflies and inhibits TYLCV infection, providing highly effective insect- and disease-resistant materials with genetic traits and simple operation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662725B_ABST
    Figure CN119662725B_ABST
Patent Text Reader

Abstract

This invention discloses an RNAi recombinant vector resistant to both whitefly and tomato yellow leaf curl virus (TYLCV), its construction method, and its applications. The method involves constructing a DNAβ promoter associated with a geminivirus expressed in the phloem into the RNAi vector pCambia1391, obtaining a 1391::DNAβpro vector backbone. RT-PCR is used to amplify a partial fragment of the whitefly key gene BtACTB, a key region of TYLCV (including the intergenic spacer region for viral replication initiation, some coat proteins, and replication-related proteins), and its inverted repeat sequences. This constructs a recombinant vector with an inverted hairpin structure driven by the phloem promoter, simultaneously targeting key sequences of both whitefly and TYLCV. The constructed recombinant vector is then introduced into tomatoes via Agrobacterium-mediated transformation. Screening yields tomato plants that reduce whitefly survival and inhibit TYLCV infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an RNAi recombinant vector that simultaneously targets the whitefly and the tomato yellow leaf curl virus it transmits, its construction method, and its application in insect and disease resistance in tomatoes. Background Technology

[0002] The whitefly, a piercing-sucking insect, is known as a "super pest" due to its wide distribution, rapid reproduction, and broad host range. It is one of the most important pests in subtropical and tropical agriculture and greenhouse production systems worldwide. Whiteflies not only directly feed on plant phloem sap, causing damage, but also widely transmit plant viruses, resulting in a dual threat to plant production. Recent studies have found that tomato yellow leaf curl virus (TYLCV), transmitted by whiteflies, is the most widespread and damaging plant virus in my country and even globally. TYLCV belongs to the genus Begomovirus in the family Geminiviridae. Infection in tomatoes causes symptoms such as yellowing and curling of new leaves, stunted growth, and significantly reduced leaf size, causing substantial losses to various crops globally, especially tomatoes, with yield losses reaching 100% in severe cases. TYLCV is transmitted by whiteflies in a persistent, cyclical manner, and its prevalence is closely related to the whitefly population. Therefore, effective control of whiteflies is the most important means of controlling geminiviruses. Currently, whitefly control relies primarily on chemical methods. However, the improper use of insecticides has led to pesticide resistance in whiteflies, posing significant challenges to their control. Therefore, developing an effective strategy to control whiteflies and block the spread of TYLCV is a major need in agricultural production.

[0003] RNA silencing is a highly conserved, sequence-specific gene expression regulation mechanism in eukaryotes and a key pathway for plants to cope with various viral infections. Due to its high conservation and sequence specificity, RNA silencing is widely used in genetic engineering to regulate the expression of target sequences. This invention targets key genes and sequences of the whitefly and TYLCV, and, taking advantage of the fact that whiteflies and TYLCV are confined to the phloem, constructs a recombinant vector that simultaneously targets whiteflies and TYLCV driven by a phloem promoter. A transgenic tomato exhibiting dual resistance to whiteflies and TYLCV was obtained, providing an important strategy for effectively controlling whiteflies and the viral diseases they transmit. Summary of the Invention

[0004] The purpose of this invention is to provide an RNAi recombinant vector resistant to both whitefly and tomato yellow leaf curl virus (TYLCV), its construction method, and its applications. This invention constructs a phloem-specific geminitroviral DNA β promoter on the RNAi vector pCambia1391, driving the expression of hairpin structures simultaneously targeting key genes in whitefly and key regions of TYLCV. The recombinant vector is then transformed into tomatoes, and through screening, transgenic tomatoes resistant to both whitefly and TYLCV are obtained.

[0005] Specifically, the technical solution adopted in this invention is as follows:

[0006] A method for constructing an RNAi recombinant vector resistant to both whitefly and tomato yellow leaf curl virus involves using a DNA β promoter derived from a geminivirus specifically expressed in the phloem to insert key genes for whitefly growth and development at a multiple cloning site.

[0007] The key sequences of BtACTB and TYLCV were prepared; wherein, the sequence of the DNA β promoter is shown in SEQ ID NO:1, and the key sequences of the whitefly BtACTB and TYLCV are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0008] Specifically, the following steps are included:

[0009] (1) The RNAi vector pCambia1391 was digested with HindIII and EcoRI to purify and recover the DNA fragment;

[0010] (2) Using primer pairs DNAβ-F and DNAβ-R, as shown in SEQ ID NO: 4-5, the DNAβ promoter was amplified using the TYLCCNV beta satellite infectious clone as a template, and the DNA fragment was purified and recovered.

[0011] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0012] DNAβ-R: ATGGTGGACTCCTCTTAGAATTCGTTTATTTGTTGTGGATGATA

[0013] (3) The DNA β fragment was ligated into the linearized pCambia1391 vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro.

[0014] (4) The target vector 1391::DNAβpro was digested with SmaI enzyme to purify and recover the DNA fragment;

[0015] (5) Using primer pairs BtACT-F and BtACT-R, as shown in SEQ ID NO: 6-7, the BtACTB gene of the whitefly was amplified, and using primer pairs TYLCV-F and TYLCV-R, as shown in SEQ ID NO: 8-9, the key sequence of TYLCV was amplified, and the DNA fragment was purified and recovered.

[0016] BtACT-F: ATGTGTGACGATGATGTAGCAGCCTT

[0017] BtACT-R: CTCTCTTGGACTGGGCTTCGTCAC

[0018] TYLCV-F:GAGCTCGACGACAAGACCCGGGGTTCCCTGCAGATTCTGATGAAT

[0019] TYLCV-R: AATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0020] (6) By homologous recombination, the key sequences of BtACTB and TYLCV were constructed into the linearized 1391::DNAβpro vector to obtain the recombinant plasmid 1391::DNAβpro-BtACT-TYLCV with the target fragment inserted in the forward direction.

[0021] (7) The target vector 1391::DNAβpro-BtACT-TYLCV was digested with MluI and SalI enzymes to purify and recover the DNA fragments;

[0022] (8) Using primer pairs BtACT / TYLCV-RNAi-F and BtACT / TYLCV-RNAi-R, as shown in SEQ ID NO:10-11, the key sequences of the reverse fusion of BtACT and TYLCV were amplified, and the DNA fragments were purified and recovered.

[0023] BtACT / TYLCV-RNAi-F:GAGCTCGACGACAAGACCCGGGATGTGTGACGATGATGTAGCAGCCTT

[0024] BtACT / TYLCV-RNAi-R: ATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0025] (9) The key sequences of the reverse fusion of BtACT and TYLCV were constructed into the linearized 1391::DNAβpro-BtACT-TYLCV vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with reverse insertion of the target fragment.

[0026] The RNAi recombinant vector constructed in this invention can be used for transgenic tomato breeding and resistance analysis, reducing the survival rate of whiteflies and inhibiting the pathogenicity of tomato yellow leaf curl virus.

[0027] This invention also provides a method for cultivating transgenic tomatoes that inhibit whiteflies and the tomato yellow leaf curl virus they transmit. The method involves introducing the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV into tomatoes via Agrobacterium transformation, and then selecting transgenic tomatoes that simultaneously inhibit whiteflies and tomato yellow leaf curl virus.

[0028] Specifically, the following steps are included:

[0029] (1) Mix 1 μg of recombinant plasmid with 100 μL of Agrobacterium competent cells, transform Agrobacterium by freeze-thaw method, and after recovery culture for 2 hours, spread it on the corresponding resistance medium. After culturing at 28℃ for 48 hours, Agrobacterium carrying the 1391::DNAβpro-hpBtACTB-TYLCV recombinant plasmid was obtained by screening.

[0030] (2) Agrobacterium carrying recombinant plasmids was used to infect tomato leaves, and callus tissue was obtained through differentiation culture. T0 generation seedlings were obtained through rooting culture and then transferred for further culture.

[0031] (3) After the seedlings have been cultured and grown stably, DNA was extracted from the plant leaves using the CTAB method. Using primer pairs DNAβ-F and TYLCV-R, as shown in SEQ ID NO:4 and SEQ ID NO:9, PCR amplification was performed using the extracted DNA as a template to confirm that the recombinant plasmid had been introduced into the plant. Seeds of the offspring of the above positive transgenic plants were collected.

[0032] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0033] TYLCV-R: AATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0034] Compared with the prior art, the outstanding effect of the present invention is as follows:

[0035] (1) This invention constructs a DNAβ promoter associated with a geminivirus expressed in the phloem into the RNAi vector pCambia1391, obtaining a 1391::DNAβpro vector backbone. Using RT-PCR, a partial fragment of the key whitefly gene BtACTB, a key TYLCV region (including the intergenic spacer region for viral replication initiation, some coat proteins, and replication-related proteins), and its inverted repeat sequences are amplified, constructing a recombinant vector with an inverted hairpin structure driven by the phloem promoter and simultaneously targeting key sequences of both whiteflies and tomato yellow leaf curl virus. The constructed recombinant vector is then introduced into tomatoes via Agrobacterium-mediated transformation. Screening yields tomato plants that reduce whitefly survival rates and inhibit TYLCV infection. This invention provides a highly efficient insect- and disease-resistant material, offering an important technical means for controlling whiteflies and the viruses they transmit.

[0036] (2) The plasmid provided by this invention can successfully transform the natural host of whiteflies and TYLCV, tomatoes, to produce transgenic plants with excellent traits that can be inherited.

[0037] (3) The expression vector provided by the present invention has multiple enzyme cleavage sites, has a wide range of applications, and is easy to operate.

[0038] The following description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the RNAi recombinant vector, its construction method, and its application that are resistant to both whitefly and tomato yellow leaf curl virus as described in this invention. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of a recombinant expression vector driven by the DNA β promoter.

[0040] Figure 2 To analyze the resistance of transgenic tomatoes transformed with recombinant vectors to whiteflies. (A) Whitefly feeding diagram, scale bar 2cm. (B) Whitefly mortality statistics, wild-type tomatoes served as a negative control. The results showed that the mortality rate of whiteflies feeding on transgenic tomatoes transformed with recombinant vectors was significantly higher than that of the control group.

[0041] Figure 3 To analyze the resistance of transgenic tomatoes transformed with the recombinant vector to TYLCV. (A) Phenotypic image of whiteflies 28 days after inoculation, scale bar 4cm; (B) Disease index statistics; (C) qPCR detection of TYLCV accumulation level; (D) Western blot detection of TYLCV CP protein accumulation. The results showed that transgenic tomatoes transformed with the recombinant vector significantly inhibited TYLCV infection. Detailed Implementation

[0042] Example 1: Construction of a dual-resistance recombinant vector

[0043] By using gene recombination, a portion of the actin gene required for the growth and development of whiteflies and a key region of tomato yellow leaf curl virus were simultaneously constructed into the high-efficiency RNAi expression vector pCambia1391, which can simultaneously target whiteflies and the TYLCV they transmit.

[0044] (1) Extraction of total RNA from whiteflies

[0045] The total RNA extraction kit (TTR150-50) from Tianmo Company was used. Approximately 30–50 whitefly individuals were placed in a sample tube, and 600 μL of RNA lysis buffer was added. The mixture was centrifuged at 60 Hz for 45–60 s, and repeated once. After complete lysis, the mixture was centrifuged at 12000 g for 1 min at 4 °C. The supernatant was transferred to another clean 1.5 mL centrifuge tube, and an equal volume (95–100%) of anhydrous ethanol was added. The mixture was mixed, and the solution was added dropwise to a C1 purification column on a collection tube. The column was centrifuged for 1 min, and the filtrate was removed. 400 μL of RNA pre-wash buffer was added to the C1 purification column, and the column was centrifuged for 1 min. The filtrate was removed. This process was repeated once, and then 400 μL of RNA washing buffer was added to the C1 purification column, and the column was centrifuged for 2 min. The filtrate was removed. Finally, the column was centrifuged empty for 2 min to remove residue, and the residue was washed with 15 μL of DNase / RNase-free water. The column was then stored at -80 °C.

[0046] 2. Amplify the target fragment and ligate it into a vector.

[0047] Using the infectious clone of DNAβ associated with TYLCCNV as a template, the DNAβ promoter sequence was amplified with primer pairs DNAβ-F and DNAβ-R; whitefly RNA was reverse transcribed into cDNA, and a conserved fragment of the whitefly actin gene was amplified with primer pairs BtACT-F and BtACT-R; using DNA from diseased leaves infected with TYLCV as a template, a conserved region of TYLCV was amplified with primer pairs TYLCV-F and TYLCV-R.

[0048] RNA was reverse transcribed into cDNA using the TaKaRa reverse transcription kit PrimeScript. TM RT reagent kit with gDNA Eraser (Catalog No.: RR047A).

[0049] The PCR amplification system consisted of: 32 μL ddH2O, 10 μL 5×TransStart FastPfu Buffer, 4 μL 2.5 mM dNTPs, 1 μL each of forward and reverse primers (10 μM), 1 μL cDNA template, and 1 μL TransStart FastPfu DNA Polymerase, with a total reaction volume of 50 μL. The reaction conditions for each fragment were: 95℃ for 1 min; 95℃ for 20 s, 55℃ for 20 s, 72℃ for 1.5 min, for 40 cycles; and 72℃ for 5 min.

[0050] Both single and double digestion systems of the vector were performed in 40 μL volumes. The single digestion consisted of 4 μL of 10×FastDigestGreen Buffer, 2 μL of FastDigest SmaI, and 34 μL of vector plasmid. The double digestion consisted of 4 μL of 10×FastDigestGreen Buffer, 2 μL each of FastDigest MluI and XbaI, and 32 μL of vector plasmid.

[0051] The homologous recombination reaction uses a 20 μL reaction system, which includes 4 μL of 5×CEⅡBuffer, approximately 150 ng of SmaI-digested vector or MluI and XbaI-digested linearized cloning vector, approximately 80 ng of fusion fragment, 2 μL of Exnase Ⅱ, and ddH2O to adjust the system to 20 μL.

[0052] After purification, the amplified PCR product is converted into a vector that has been digested with the appropriate enzymes via homologous recombination to obtain the target vector. Figure 1 ).

[0053] The specific steps are as follows:

[0054] (1) The RNAi vector pCambia1391 was digested with HindIII and EcoRI to purify and recover the DNA fragment;

[0055] (2) Using primer pairs DNAβ-F and DNAβ-R, as shown in SEQ ID NO: 4-5, the DNAβ promoter was amplified using the TYLCCNV beta satellite infectious clone as a template, and the DNA fragment was purified and recovered.

[0056] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0057] DNAβ-R: ATGGTGGACTCCTCTTAGAATTCGTTTATTTGTTGTGGATGATA

[0058] (3) The DNA β fragment was ligated into the linearized pCambia1391 vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro.

[0059] (4) The target vector 1391::DNAβpro was digested with SmaI enzyme to purify and recover the DNA fragment;

[0060] (5) Using primer pairs BtACT-F and BtACT-R, as shown in SEQ ID NO: 6-7, the BtACTB gene of the whitefly was amplified, and using primer pairs TYLCV-F and TYLCV-R, as shown in SEQ ID NO: 8-9, the key sequence of TYLCV was amplified, and the DNA fragment was purified and recovered.

[0061] BtACT-F: ATGTGTGACGATGATGTAGCAGCCTT

[0062] BtACT-R: CTCTCTTGGACTGGGCTTCGTCAC

[0063] TYLCV-F:GAGCTCGACGACAAGACCCGGGGTTCCCTGCAGATTCTGATGAAT

[0064] TYLCV-R: AATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0065] (6) By homologous recombination, the key sequences of BtACTB and TYLCV were constructed into the linearized 1391::DNAβpro vector to obtain the recombinant plasmid 1391::DNAβpro-BtACT-TYLCV with the target fragment inserted in the forward direction.

[0066] (7) The target vector 1391::DNAβpro-BtACT-TYLCV was digested with MluI and SalI enzymes to purify and recover the DNA fragments;

[0067] (8) Using primer pairs BtACT / TYLCV-RNAi-F and BtACT / TYLCV-RNAi-R, as shown in SEQ ID NO:10-11, the key sequences of the reverse fusion of BtACT and TYLCV were amplified, and the DNA fragments were purified and recovered.

[0068] BtACT / TYLCV-RNAi-F:GAGCTCGACGACAAGACCCGGGATGTGTGACGATGATGTAGCAGCCTT

[0069] BtACT / TYLCV-RNAi-R: ATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0070] (9) The key sequences of the reverse fusion of BtACT and TYLCV were constructed into the linearized 1391::DNAβpro-BtACT-TYLCV vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with reverse insertion of the target fragment.

[0071] Example 2: Transgenic Tomato Cultivation Using Recombinant Vectors

[0072] (1) Mix 1 μg of recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with 100 μL of Agrobacterium competent cells, transform Agrobacterium by freeze-thaw method, and after recovery culture for 2 hours, plate onto the corresponding resistance medium. After incubation at 28℃ for 48 hours, Agrobacterium carrying the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV was screened.

[0073] (2) Agrobacterium carrying recombinant plasmids was used to infect tomato leaves, and callus tissue was obtained through differentiation culture. T0 generation seedlings were obtained through rooting culture and then transferred for further culture.

[0074] (3) After the seedlings stabilized during cultivation, DNA was extracted from the plant leaves using the CTAB method. Using primer pairs DNAβ-F and TYLCV-R (as shown in SEQ ID NO:4 and SEQ ID NO:9), PCR amplification was performed using the extracted DNA as a template to confirm the introduction of the recombinant plasmid into the plant. Seeds of the offspring from the positive transgenic plants were then collected. The primer sequences used are as follows:

[0075] DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA

[0076] TYLCV-R: AATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA

[0077] Example 3: Detection of the effects of transgenic tomatoes transformed with recombinant vectors on whiteflies and the transmission of TYLCV.

[0078] Whiteflies carrying TYLCV virus particles, which emerged simultaneously, were released onto transgenic and wild-type tomato plants, with 100 whiteflies per tomato plant. Observations 3-7 days after feeding revealed that the mortality rate of whiteflies feeding on transgenic tomatoes was significantly higher than that of the control group. Figure 2After 28 days, observation revealed that compared to the control, the transgenic plants had significantly fewer whiteflies and milder symptoms. Primers TYLCV-qF and TYLCV-qR were designed, as shown in SEQ ID NO:12-SEQ ID NO:13; primers 25S rRNA-qF and 25S RNA-qR were designed to amplify the internal reference gene, as shown in SEQ ID NO:14-SEQ ID NO:15. qPCR detection was performed, and combined with Western blot analysis, it was found that the virus accumulation was even lower. Figure 3 ).

[0079] TYLCV-qF:GCTGCTGTCCCCATTGTCCAA

[0080] TYLCV-qR:CCAGATCCACGAGTAACATCACT

[0081] 25S rRNA-qF:ATAACCGCATCAGGTCTCCA

[0082] 25S RNA-qR:CCGAAGTTACGGATCCATTT

[0083] The above results indicate that the transgenic tomatoes transformed by the recombinant vector driven by the DNA β promoter and simultaneously targeting whiteflies and TYLCV constructed in this invention can effectively resist the harm caused by whiteflies and the TYLCV they transmit.

[0084] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing an RNAi recombinant vector resistant to both whitefly and tomato yellow leaf curl virus, characterized in that: The mixture was prepared by inserting key sequences of the whitefly growth and development genes BtACTB and TYLCV into the multiple cloning site, driven by a DNAβ promoter derived from a geminivirus specifically expressed in the phloem; wherein the sequence of the DNAβ promoter is shown in SEQ ID NO:1, and the key sequences of TYLCV and whitefly BtACTB are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. Includes the following steps: (1) The RNAi vector pCambia1391 was digested with HindIII and EcoRI to purify and recover the DNA fragment; (2) Using primer pairs DNAβ-F and DNAβ-R, as shown in SEQ ID NO: 4-5, the DNAβ promoter was amplified using the TYLCCNV beta satellite infectious clone as a template, and the DNA fragment was purified and recovered. DNAβ-F: GTTGGGCCCGGCGCGCCAAGCTTATACATATATATACGTATTCAAATA DNAβ-R: ATGGTGGACTCCTCTTAGAATTCGTTTATTTGTTGTGGATGATA (3) The DNA β fragment was ligated into the linearized pCambia1391 vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro. (4) The target vector 1391::DNAβpro was digested with SmaI enzyme to purify and recover the DNA fragment; (5) Using primer pairs BtACT-F and BtACT-R, as shown in SEQ ID NO: 6-7, the BtACTB gene of the whitefly was amplified, and using primer pairs TYLCV-F and TYLCV-R, as shown in SEQ ID NO: 8-9, the key sequence of TYLCV was amplified, and the DNA fragment was purified and recovered. BtACT-F: ATGTGTGACGATGATGTAGCAGCCTT BtACT-R: CTCTCTTGGACTGGGCTTCGTCAC TYLCV-F:GAGCTCGACGACAAGACCCGGGGTTCCCTGCAGATTCTGATGAAT TYLCV-R: AATAATTATTTCCTTAACCCCGGGGCCCTTACAACAGATATAAGA (6) By homologous recombination, the key sequences of BtACTB and TYLCV were constructed into the linearized 1391::DNAβpro vector to obtain the recombinant plasmid 1391::DNAβpro-BtACT-TYLCV with the target fragment inserted in the forward direction. (7) The target vector 1391::DNAβpro-BtACT-TYLCV was digested with MluI and SalI enzymes to purify and recover the DNA fragments; (8) Using primer pairs BtACT / TYLCV-RNAi-F and BtACT / TYLCV-RNAi-R, as shown in SEQ ID NO:10-11, the key sequences of the reverse fusion of BtACT and TYLCV were amplified, and the DNA fragments were purified and recovered. BtACT / TYLCV-RNAi-F:GAGCTCGACGACAAGACCCGGGATGTGTGACGATGATGTAGCAGCCTT BtACT / TYLCV-RNAi-R: ATAATTATTTCCTTAACCCGGGGCCCTTACAACAGATATAAGA (9) The key sequences of the reverse fusion of BtACT and TYLCV were constructed into the linearized 1391::DNAβpro-BtACT-TYLCV vector by homologous recombination to obtain the recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV with reverse insertion of the target fragment.

2. The RNAi recombinant vector that is resistant to both tobacco whitefly and tomato yellow leaf curl virus obtained by the construction method of claim 1.

3. The application of the RNAi recombinant vector according to claim 2 in the cultivation and resistance analysis of transgenic tomatoes, reducing the survival rate of whiteflies and inhibiting the pathogenicity of tomato yellow leaf curl virus.

4. A method for cultivating transgenic tomatoes that inhibit whiteflies and the tomato yellow leaf curl virus they transmit, characterized in that: The RNAi recombinant vector described in claim 2, namely recombinant plasmid 1391::DNAβpro-hpBtACT-TYLCV, was introduced into tomatoes using Agrobacterium-mediated transformation. Transgenic tomatoes that simultaneously inhibit whitefly and tomato yellow leaf curl virus were obtained through screening.

5. The method for cultivating transgenic tomatoes according to claim 4, characterized in that, Includes the following steps: (1) Mix 1 μg of recombinant plasmid with 100 μL of Agrobacterium competent cells, transform Agrobacterium by freeze-thaw method, and after recovery culture for 2 hours, spread it on the corresponding resistance medium. After culturing at 28℃ for 48 hours, Agrobacterium carrying the 1391::DNAβpro-hpBtACTB-TYLCV recombinant plasmid was obtained by screening. (2) Agrobacterium carrying recombinant plasmids was used to infect tomato leaves, and callus tissue was obtained through differentiation culture. T0 generation seedlings were obtained through rooting culture and then transferred for further culture. (3) After the seedlings have been cultured and grown stably, DNA was extracted from the plant leaves using the CTAB method. Using primer pairs DNAβ-F and TYLCV-R, as shown in SEQ ID NO:4 and SEQ ID NO:9, PCR amplification was performed using the extracted DNA as a template to confirm that the recombinant plasmid had been introduced into the plant. Seeds of the offspring of the above positive transgenic plants were collected.

Citation Information

Patent Citations

  • Method for controlling soot lice by silencing two resistance genes

    CN102690837A

  • TYLCV and ToCV bivalent RNAi expression vector established through Gateway technology and application of expression vector

    CN110295192A

  • Phloem specific expressing promoter

    CN1614021A

  • Rnai strategies for control of whitefly

    US20200080105A1