A method and application for detecting the GPR107 gene associated with duck egg weight trait

Abstract

This invention relates to a method and application for detecting the GPR107 gene, which is associated with duck egg weight traits, and belongs to the field of biotechnology. This invention detects the genotype of the GPR107 gene at position 7909242 on chromosome 18, determining that individuals with the T / T genotype have higher egg weights than those with the T / C and C / C genotypes. Specifically, individuals with the T / C genotype have higher egg weights than those with the C / C genotype. Using this method to screen for high-quality laying ducks offers the advantages of efficient and rapid identification of duck egg weight traits, improving selection accuracy, accelerating breeding progress, and reducing breeding and production costs. Furthermore, the detection method disclosed in this invention is simple and easy to operate, can be carried out in a laboratory, and can also be applied to genomic breeding technology.

Description

Technical Field

[0001] This invention relates to a method and application for detecting the GPR107 gene, which is associated with the weight trait of duck eggs, and belongs to the field of biotechnology. Background Technology

[0002] In poultry production, egg production performance is an extremely important primary economic trait for both laying hens and meat poultry. Breeds with superior egg production performance have a greater advantage in improving the supply capacity of breeding poultry, reducing breeding costs, increasing commercial production capacity, and enhancing economic benefits. Egg production performance is mainly influenced by multiple factors such as genetics, environment, and nutrition, and is a low-heritability quantitative trait controlled by multiple genes with minor effects. In the past, the selection of poultry egg production performance mainly relied on conventional phenotypic selection. After nearly a century of selection, significant improvements have been made in important egg production performance indicators such as egg quantity and egg weight, especially in laying hens, where indicators such as egg count have approached their limits. With the improvement of poultry egg production performance and the development of breeding techniques, traditional phenotypic selection is far from meeting the genetic selection requirements for egg production performance indicators such as egg weight; especially for waterfowl, limited understanding of their biological characteristics such as their preference for water and mating has led to waterfowl breeding remaining in a state of large-scale selective breeding, which has become one of the bottlenecks hindering the progress of waterfowl egg production performance selection.

[0003] Egg weight has a significant impact on the economic value of duck egg production. In the market, duck eggs are typically sold as various processed products such as salted duck eggs and preserved eggs. Their prices are generally related to their weight; heavier eggs indicate a higher product grade, resulting in higher prices and greater economic benefits. Furthermore, egg weight also affects hatchability and duckling birth weight. Studies have shown that appropriate egg weight can significantly improve fertilization and hatchability; duckling birth weight is significantly positively correlated with egg weight. Egg weight in ducks exhibits complex genetic characteristics and is controlled by multiple genes. Research indicates that the heritability of egg weight traits can reach 45-55%, meaning that selective breeding based on genetic markers is possible. However, current traditional breeding techniques for egg weight are progressing slowly, necessitating the development of new associated genes to provide multiple pathways for breeding egg weight traits. Summary of the Invention

[0004] The purpose of this invention is to address the shortcomings of existing technologies by proposing a method and application for detecting the GPR107 gene associated with duck egg weight traits, which can rapidly and accurately identify duck egg weight traits.

[0005] This invention measured the egg weight of Jinding female ducks at 43 weeks of age, used whole-genome resequencing technology for SNP genotyping, and screened for the GPR107 gene molecular marker, which is significantly associated with duck egg weight, through genome-wide association analysis. This provides new gene and molecular marker resources for breeding ducks with egg weight traits. The GPR107 gene is a member of the G protein-coupled receptor (GPCR) family. GPCRs are a class of receptors widely distributed in organisms and are core to the function of the HPG axis. In the hypothalamus, GPCRs can respond to different neurotransmitters and hormones, such as dopamine, norepinephrine, and serotonin, affecting the activity of hypothalamic neurons, regulating the release of GnRH, promoting the secretion of LH and FSH, and ultimately affecting reproductive function and regulating egg production traits.

[0006] This invention solves the technical problem through the following technical solution: This invention first provides a method for detecting the GPR107 gene, which is related to the weight trait of duck eggs, including the following steps:

[0007] The first step is to perform PCR on the duck DNA sample to be tested using duck DNA-specific primers.

[0008] Amplification yields the amplification product;

[0009] The second step is to perform Sanger sequencing on the amplified products.

[0010] The third step is to determine the SNP molecular markers of the target site based on the sequencing results from the second step.

[0011] genotype.

[0012] In the first step of the above method, the deoxyribonucleotide sequence of the duck DNA-specific primer pair is determined by the upstream primer: 5'-CCCAGACACCCGAAATAG-3' (SEQ ID NO: 1).

[0013] Downstream primer: 5'-AGCAAAGAAGAGCGAGGA-3' (SEQ ID NO: 2), the molecular marker corresponding to the duck DNA-specific primer is located at base 7909242 on chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0, with a base mutation of T or C, and the genotypes are T / T, T / C and C / C.

[0014] The final concentration of the PCR reaction system is 25 μl:

[0015] 50 ng of duck DNA to be tested

[0016] 2 x Accurate Taq Master Mix 12.5μl

[0017] upstream primer 1 μl

[0018] 1 μl of downstream primer

[0019] Add sterile water to 25 μl.

[0020] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 20℃.

[0021] The amplification product is 190 bp in length and contains the 7909242nd base on chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The sequence of the amplification product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0022] In the third step, the criteria for judgment are that ducks with the SNP site T / T genotype have higher egg weight than ducks with the SNP site T / C genotype and ducks with the SNP site C / C genotype, and ducks with the SNP site T / C genotype have higher egg weight than ducks with the SNP site C / C genotype.

[0023] The present invention further provides an application of a method for detecting the GPR107 gene associated with duck egg weight traits, used to detect the weight traits of 43-week-old duck eggs from Jinding ducks.

[0024] This invention detects the genotype of the GPR107 gene at position 7909242 on chromosome 18, revealing that individuals with the T / T genotype have a higher egg weight at 43 weeks of age than those with the T / C and C / C genotypes, with the T / C genotype individuals having a higher egg weight than the C / C genotype individuals. Using the genomic DNA of the ducks to be tested as a template, PCR amplification is performed using specific primer pairs. The PCR amplification products are then subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of these SNP molecular markers, selection of duck egg production performance can be achieved. In breeding, depending on the breeding objectives, individuals with the T / C genotype can be eliminated, while those with the T / T or C / C genotypes are retained for screening high-quality duck egg weight indicators. The beneficial effects are that it can efficiently and rapidly identify duck egg weight traits, providing a scientific basis for early selection of high-quality ducks, helping to accelerate breeding progress, improve breeding accuracy, and reduce breeding and production costs. It has significant application and breeding value for high-quality ducks. Furthermore, the detection method disclosed in this invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genome breeding technology. Attached Figure Description

[0025] Figure 1 This is a Manhattan plot of duck egg weight GWAS analysis at 43 weeks of age.

[0026] Figure 2These are Sanger sequencing results of PCR amplification products from three genotypes.

[0027] Figure 3 This is a phenotypic distribution map of individuals with three genotypes of the chr18:7909242 molecular marker. Detailed Implementation

[0028] Suitable for breeding Jinding ducks.

[0029] Example 1

[0030] In this embodiment, egg weight was measured in Jinding female ducks at 43 weeks of age. SNP genotyping was performed using whole-genome resequencing technology, and the GPR107 gene molecular marker significantly associated with egg weight was identified through genome-wide association analysis. The results are as follows: Figure 1 As shown.

[0031] This embodiment uses the following experiments to identify and apply the molecular marker of the GPR107 gene related to duck egg weight.

[0032] 1. Phenotyping and Genotyping

[0033] (1) Experimental materials and determination of egg weight phenotype

[0034] Five hundred and thirty-six female Jinding ducks were selected as experimental animals and raised under the same conditions, with free access to food and water throughout the process. At 43 weeks of age, the egg weight of each duck was recorded sequentially as phenotypic data of egg weight.

[0035] (2) Extraction of genomic DNA

[0036] Blood was collected from the subwing vein of the individuals to be tested, and after anticoagulation, the blood was lysed, digested with proteinase K, extracted using the saturated sodium chloride method, dissolved in TE, and stored at -20°C.

[0037] (3) PCR amplification

[0038] Using the extracted genomic DNA as a template, the fragment containing the SNP molecular marker at position 7909242 of duck chromosome 18 was amplified.

[0039] Upstream primer: 5'-CCCAGACACCCGAAATAG-3' (SEQ ID NO: 1)

[0040] Downstream primer: 5'-AGCAAAGAAGAGCGAGGA-3' (SEQ ID NO: 2)

[0041] The final concentration of the reaction system (25 μl) is:

[0042] DNA to be tested 50 ng

[0043] 2 x Accurate Taq Master Mix 12.5 μl

[0044] upstream primer 1 μl

[0045] 1 μl of downstream primer

[0046] Add sterile water to a final volume of 25 μl.

[0047] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; storage at 20℃; 10 μl was used for agarose gel assay, and an amplification product with a single target band length of 190 bp was obtained, containing base position 7909242 of duck chromosome 18, the sequence of which is as follows:

[0048] SEQ ID NO: 3

[0049] CCCAGACACCCGAAATAGGGGAGAAAAGAAAGGAGGCACCAAAGCCAGCTTGTGGCAGCCAGTGACAGCCACACTGAGCCCGAAACTGCTCACCCAGCCCCAAAACCCACAGGATTTGGTCAAACTCCGAGGGAACATTTCCAAAGGAAACCCCATCCACCTCCACACCCACCTCCTCGCTCTTCTTTGCT

[0050] SEQ ID NO: 4

[0051] CCCAGACACCCGAAATAGGGGAGAAAAGAAAGGAGGCACCAAAGCCAGCTTGTGGCAGCCAGTGACAGCCACACTGAGCCCGAAACTGCTCACCCAGCCCCAAAACCCACAGGATTTGGTCAAACTCCGAGGGAACATTTCCAAAGGAAACCTATCCACCTCCACACCCACCTCCTCGCTCTTCTTTGCT

[0052] (4) Sequencing verification and genotyping

[0053] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagram is shown below. Figure 2 As shown.

[0054] 2. Results Analysis

[0055] Correlation analysis was performed on 514 Jinding female ducks at 43 weeks of age with clear egg weight phenotype records. Statistical tests were conducted using the t.test function in R 4.0 software. Pairwise comparison of means was used to statistically analyze the genotype and egg weight of the experimental duck flock. P < 0.05 indicated significant differences, and P < 0.01 indicated extremely significant differences. The results are shown in Table 1 and... Figure 3 As shown, among the tested individuals, there were 289 individuals with the T / T genotype, 126 with the T / C genotype, and 99 with the C / C genotype. The egg weight at 43 weeks of age differed significantly among the three genotypes (p<0.01). The average egg weight at 43 weeks of age for individuals with the T / T genotype was 78.48 g, significantly higher than that of individuals with the T / C and C / C genotypes (p<0.01), by 3.6 g and 7.87 g, respectively. The average egg weight for individuals with the T / C genotype was 74.88 g, significantly higher than that of individuals with the C / C genotype (p<0.01), and 4.27 g, respectively. These results indicate that the duck GPR107 gene molecular marker is significantly correlated with duck egg weight. Depending on the actual breeding goals, individuals with the T / T genotype can be selected to increase egg weight, or individuals with the C / C genotype can be selected to decrease egg weight, thus meeting different market requirements for egg weight and improving breeding efficiency.

[0056] Table 1. Association analysis between the molecular marker at position 7909242 on chromosome 18 and egg weight.

[0057] genotype Quantity / piece Egg weight at 43 weeks of age Standard deviation CV T / T 289 <![CDATA[78.48 a ]]> 2.2 2.80% T / C 126 <![CDATA[74.88 b ]]> 1.9 2.54% C / C 99 <![CDATA[70.61 c ]]> 2.1 2.97%

[0058] Note: Data with the same subtitle in the same column indicate no significant difference, while data with different subtitles indicate significant difference (P<0.05).

[0059] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. An application of a method for detecting SNP molecular markers related to weight traits in duck eggs, characterized in that: The method for detecting the weight trait of 43-week-old duck eggs from Jinding ducks includes the following steps: First, the duck DNA sample to be tested is amplified by PCR using duck DNA-specific primers to obtain the amplification product; Second, the amplification product is subjected to Sanger sequencing. The third step is to determine the SNP molecular marker genotype of the target site based on the sequencing results of the second step. The SNP molecular marker is located at the 7909242nd base on chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The base mutation is T or C, and the genotypes are T / T, T / C and C / C.

2. The application of the SNP molecular marker detection method related to the weight trait of duck eggs according to claim 1, characterized in that: In the first step, the deoxyribonucleotide sequence of the duck DNA-specific primer pair consists of the upstream primer SEQ ID NO: 1 and the downstream primer SEQ ID NO:

2.

3. The application of the SNP molecular marker detection method related to the weight trait of duck eggs according to claim 2, characterized in that: The final concentration of the PCR reaction system is 25 μl: 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl upstream primer 1 μl 1 μl of downstream primer Add sterile water to 25 μl. The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 20℃.

4. The application of the SNP molecular marker detection method related to the weight trait of duck eggs according to claim 3, characterized in that: The amplification product is 190 bp in length and contains the 7909242nd base on chromosome 18 of the duck reference genome GCF_015476345.1_ZJU1.0 version. The sequence of the amplification product is shown in SEQ ID NO: 3 and / or SEQ ID NO:

4.

5. The application of the SNP molecular marker detection method related to the weight trait of duck eggs according to claim 2, characterized in that: In the third step, the criterion is that ducks with the SNP site T / T genotype have a higher egg weight than ducks with the SNP site T / C genotype and C / C genotype, and ducks with the SNP site T / C genotype have a higher egg weight than ducks with the SNP site C / C genotype.

Images