A recombinant microorganism and its application in the fermentative production of ectoin

Abstract

The present invention relates to the field of microbial technology, and specifically discloses a recombinant microorganism and its application in the fermentative production of ectoine. Compared with the starting strain, the recombinant microorganism of the present invention expresses the ectABC gene of Chromohalobacter salexigens, expresses the glucose facilitator gene of Zymomonas mobilis glf while reducing the ptsG gene expression, and also overexpresses glucokinase glk, preferably also overexpresses phosphoenolpyruvate carboxylase ppc, and more preferably replaces the original promoter of the isocitrate dehydrogenase gene icd with a growth-phase-dependent promoter. Without significantly affecting the growth performance of the bacterial cells, the recombinant microorganism of the present invention can significantly improve the yield and productivity of ectoine in fermentative production, thereby enhancing the efficiency of industrial production of ectoine and reducing the production cost.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and specifically, to a recombinant microorganism and its application in the fermentation production of ectoine. Background Art

[0002] Ectoine, also known as tetrahydromethylpyrimidine carboxylic acid, has a molecular formula of C6H 10 N2O2 and a molecular weight of 142.16. It is an osmoprotectant widely present in halophilic and salt-tolerant bacteria. Ectoine is a chemical substance with high added value and plays an important role in the fields of biotechnology, skin care products, and medicine. In the field of cosmetics, as a natural moisturizer and protein protectant, ectoine is widely added to skin care products, where it can play roles such as antioxidant, moisturizing the skin, and slowing down aging. In the medical field, it has currently been found that ectoine has potential medicinal value in treating human diseases such as Alzheimer's disease, pneumonia, and colitis, and is also used for the maintenance of transplanted organs due to its protective effect on cells. Ectoine can be produced by chemical synthesis. However, the complex chemical synthesis process requires high costs. The microbial fermentation method has advantages such as low cost, easy availability of raw materials, and easy expansion of production, and is currently an effective way for industrial production of ectoine. It is necessary to further study methods for more effectively producing ectoine through biological fermentation. Summary of the Invention

[0003] One of the purposes of the present invention is to provide a new and effective method for fermenting and producing ectoine.

[0004] The present invention provides a recombinant microorganism. Compared with the starting strain, the recombinant microorganism expresses the gene of Chromohalobacter salexigens ( C. salexigens ), and while expressing the glucose facilitator gene of Zymomonas mobilis ectABC , it reduces the expression of the glf gene, and also overexpresses the glucose kinase glk. ptsG

[0005] In the recombinant microorganism of the present invention, the way of reducing the expression of the glf gene while expressing the glucose facilitator gene of Zymomonas mobilis ptsG is: replacing the glf gene with the glucose facilitator gene of Zymomonas mobilis ptsG ;

[0006] And / or, the way of overexpressing the glucose kinase glk is: replacing the original promoter of the glucose kinase gene glk with the Ptrc promoter or increasing the copy number of the glucose kinase gene glk , and the sequence of the Ptrc promoter is as shown in SEQ ID No.4.​

[0007] In the recombinant microorganism of the present invention, compared with the starting strain, the recombinant microorganism further overexpresses phosphoenolpyruvate carboxylase ppc.

[0008] In the recombinant microorganism of the present invention, the method of overexpressing phosphoenolpyruvate carboxylase ppc is: ppc The original promoter was replaced by P J23110 phosphoenolpyruvate carboxylase gene ppc The copy number of the P J23110 The sequence of the promoter is shown in SEQ ID No.6.

[0009] In the recombinant microorganism of the present invention, compared with the starting strain, the recombinant microorganism further replaces the isocitrate dehydrogenase gene with a growth phase-dependent promoter. icd The original promoter of the growth phase-dependent promoter is shown in SEQ ID No.8 or SEQ ID No.60.

[0010] Those skilled in the art may also overexpress glucose kinase glk and / or phosphoenolpyruvate carboxylase ppc by other methods known in the art.

[0011] In the recombinant microorganism of the present invention, the ectABC The gene is shown in SEQ ID No. 25, glf The gene is shown in SEQ ID No. 2, ptsG The gene is shown in SEQ ID No. 1;

[0012] And / or, the starting strain is Escherichia coli.

[0013] The present study found that icodine can be formed in Escherichia coli using glucose as the raw material, through the reaction of phosphoenolpyruvate (PEP) and oxaloacetate (OAA), with aspartate as the precursor, and through exogenously introduced enzyme-catalyzed reactions. In E. coli, glucose uptake is primarily through the phosphotransferase system (PTS). Although the PTS is highly efficient in transporting glucose, this system consumes PEP. At the same time, when glucose is transported too quickly, it accumulates in the form of pyruvate, producing byproducts such as acetate. OAA also participates in the tricarboxylic acid (TCA) cycle, which prevents glucose from fully flowing into icodine production. Directly knocking out genes related to the TCA cycle leads to a severe decrease in bacterial growth activity. Therefore, it is necessary to further study methods for the production of icodine through biofermentation.

[0014] In view of the problems of PEP consumption, excessive glucose transport leading to the production of by-product acetic acid, and the pathway flux of the precursor aspartic acid mentioned above, through repeated experiments, the present invention finally provides a strategy for enhancing the production of ectoine, including 1) expressing the glucose facilitator gene of Zymomonas mobilis in Escherichia coli glf and overexpressing glucokinase glk while reducing the expression of ptsG gene; preferably, it further includes 2) enhancing the coding gene phosphoenolpyruvate carboxylase of PEP to OAA ppc (overexpressing phosphoenolpyruvate carboxylase ppc ), enhancing the pathway flux of the production of aspartic acid; more preferably, it further includes 3) simultaneously controlling the expression of the key growth gene isocitrate dehydrogenase icd and replacing the original promoter of icd with a growth-phase-dependent promoter. Through the transformation method of the present invention, the production efficiency of ectoine can be improved, and the cost of industrial production of ectoine can be reduced.

[0015] The present invention also provides the application of the above recombinant microorganism in the fermentation production of ectoine, in the microbial genetic breeding for the production of ectoine, or in increasing the yield of biochemically synthesized ectoine.

[0016] The present invention also provides a method for fermenting and producing ectoine, which includes the step of culturing the above recombinant microorganism.

[0017] The present invention also provides a method for constructing a recombinant microorganism for producing ectoine, which includes making the starting strain express the ectABC gene of Chromohalobacter salexigens, expressing the glucose facilitator gene of Zymomonas mobilis glf while reducing the expression of ptsG gene, and further overexpressing glucokinase glk;

[0018] Preferably, it further includes the step of making the starting strain overexpress phosphoenolpyruvate carboxylase ppc;

[0019] More preferably, it further includes the step of replacing the original promoter of the isocitrate dehydrogenase gene icd of the starting strain with a growth-phase-dependent promoter, and the sequence of the growth-phase-dependent promoter is as shown in SEQ ID No.8 or SEQ ID No.60.

[0020] In the method of the present invention, the method of expressing the glucose facilitator gene of Zymomonas mobilis glf while reducing the expression of ptsG gene is: replacing the glf gene with the glucose facilitator gene of Zymomonas mobilis ptsG gene;

[0021] And / or, the method for overexpressing glucose kinase glk is: replacing the original promoter of the glucose kinase gene glk with the Ptrc promoter or increasing the copy number of the glucose kinase gene glk , and the sequence of the Ptrc promoter is shown in SEQ ID No.4;

[0022] And / or, the method for overexpressing phosphoenolpyruvate carboxylase ppc is: replacing the original promoter of the phosphoenolpyruvate carboxylase gene ppc with the P J23110 promoter or increasing the copy number of the phosphoenolpyruvate carboxylase gene ppc , and the sequence of the P J23110 promoter is shown in SEQ ID No.6;

[0023] And / or, the starting strain is Escherichia coli.

[0024] The beneficial effects of the present invention are at least as follows:

[0025] The present invention provides a recombinant microorganism that can significantly improve the yield and yield rate of ectoine without significantly affecting the growth performance of the bacterial cells. Using this recombinant microorganism for the production of ectoine can improve the industrial production efficiency and reduce the production cost of ectoine. Detailed implementation manners

[0026] The preferred implementation manners of the present invention will be described in detail below in conjunction with the embodiments. It should be understood that the following embodiments are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0027] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources or prepared according to conventional methods in the art unless otherwise specified.

[0028] Example 1 Expression of Zymomonas mobilis in Escherichia coli glf , overexpression of the glucose kinase gene glk while reducing the expression of ptsG gene, and establishing a metabolic pathway for ectoine production

[0029] In this example, the key enzyme gene ptsG of the phosphotransferase system (PTS) of Escherichia coli MG1655 ATCC 700926 (the sequence is shown in SEQ ID No.1) was replaced with the glucose facilitator gene of Zymomonas mobilisglf (the sequence is shown as SEQ ID No. 2); meanwhile, the original promoter of the glucokinase gene glk (NCBI sequence number is 946858) (the sequence is shown as SEQ ID No. 3) was replaced with the Ptrc promoter (the sequence is shown as SEQ ID No. 4) to overexpress glucokinase glk .

[0030] 1. Using the genome of Escherichia coli MG1655 as a template, with primers ptsG -U-F (ttcagttcatgggccaacatcttcc, SEQ ID No. 9) and ptsG -U-R (agggctagtcgcgtgactagaccctgactgctcattccgtaagacgttggggagact, SEQ ID No. 10) as primers for PCR, a gene fragment ptsG -UP about 1000 bp was obtained and the PCR product was purified. Using the genome of Zymomonas mobilis Zymomonas mobilis 29191, purchased from ATCC) as a template, with primers glf -F (atctggctgccttagtctccccaacgtcttacggaatgagcagtcagggtctagtcac, SEQ ID No. 11) and glf -R (taaaaaaagcacccatactcaggagcactctcaattctacttctgggagcgccacatc, SEQ ID No. 12) as primers for PCR, a gene fragment glf (SEQ ID No. 2) about 1500 bp was obtained and the PCR product was purified. Using the genome of Escherichia coli MG1655 as a template, with primers ptsG -D-F (tgaaatcgaggagatgtggcgctcccagaagtagaattgagagtgctcctgagtatgggt, SEQ ID No. 13) and ptsG -D-R (accggttcctcatctttaagagagaca, SEQ ID No. 14) as primers for PCR, a gene fragment ptsG -DOWN about 1100 bp was obtained and the PCR product was purified. The fragments ptsG -UP, glf , ptsG -DOWN were subjected to overlap PCR to obtain the targeting fragment.

[0031] Using plasmid pTarget (see Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81: 2506–2514.) as a template, with primers ptsG -N20-F (cagtggcatgtttgcaaagagttttagagctagaaatagcaagttaaaataaggct, SEQ ID No.15) and ptsG -N20-R (tctttgcaaacatgccactgactagtattatacctaggactgagctagctgtcaag, SEQ ID No.16) for amplification to obtain pTarget- ptsG .

[0032] Using an electroporator (Bio-Rad), the targeting fragment, plasmid pTarget- ptsG and plasmid pCas9 were electrotransformed into Escherichia coli MG1655. The electroporation conditions were voltage 2.5 KV, resistance 200 Ω, capacitance 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf .

[0033] 2. Using the genome of Escherichia coli MG1655 as a template, with primers glk -U-F (tctcatccagccctttaaacagcgaaa, SEQ ID No.17) and glk -U-R (tcttaaacattatacgagccggatgattaattgtcaatttcagcaccaattgcagcgatg, SEQ ID No.18) for PCR to obtain a gene fragment glk -UP of about 1000 bp and purifying the PCR product. Using the genome of Escherichia coli MG1655 as a template, with primers glk -D-F (tcgtataatgtttaagaaggagatatacatatgacaaagtatgcattagtcggtgatgtg, SEQ ID No.19) and glkPCR was performed using -D-R (ctattcggcgcaaaatcaacgtgaccgcctt, SEQ ID No. 20) as the primer to obtain a gene fragment glk -DOWN of approximately 1100 bp and the PCR product was purified. The fragment glk -UP and glk -DOWN were subjected to overlap PCR to obtain the targeting fragment.

[0034] Using plasmid pTarget as the template (Jiang, et al. 2015), with primers glk -N20-F (tttctcacactgtaaataccgttttagagctagaaatagcaagttaaaataaggct, SEQ ID No. 21) and glk -N20-R (ggtatttacagtgtgagaaaactagtattatacctaggactgagctagctgtcaag, SEQ ID No. 22) for amplification to obtain pTarget- glk . Using an electroporator (Bio-Rad), the targeting fragment, plasmid pTarget- glk and plasmid pCas9 were electrotransformed into Escherichia coli MG1655-Δ ptsG :: glf . The electroporation conditions were voltage 2.5 KV, resistance 200 Ω, capacitance 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant bacteria were screened and the strain was named MG1655-Δ ptsG :: glf -P trc - glk .

[0035] 3. Using the genome of Chromohalobacter salexigens ( Chromohalobacter salexigens BAA-138, purchased from ATCC) as the template, with primers ectA -F (atggcccttcctgcacgctccgat, SEQ ID No. 23) and ectC -R (tcaaggggcttcacgtaacgc, SEQ ID No. 24) for PCR to obtain a gene fragment ectABC (SEQ ID No. 25). This fragment was ligated to the vector pTrc99a, and the name of the obtained recombinant plasmid was pTrc99a- ectABC . The recombinant plasmid pTrc99a- ectABC was electrotransformed (conditions as above) into MG1655 and MG1655-Δ ptsG :: glf -Ptrc - glk , the obtained recombinant strains were respectively named MG1655 / pTrc99a- ectABC and MG1655-Δ ptsG :: glf -P trc - glk / pTrc99a- ectABC .

[0036] Example 2 Increasing the copy number of the glucokinase gene glk

[0037] In this example, in Escherichia coli expressing the Zymomonas mobilis glf gene and reducing the ptsG gene expression, the glucokinase gene glk was overexpressed by increasing the copy number of the glucokinase gene glk , and a metabolic pathway for ectoine production was established. Specifically as follows:

[0038] In this example, the glucokinase gene glk of Escherichia coli MG1655 ATCC 700926 was replaced at the pseudogene yjiT (the sequence is shown in SEQ ID No. 42) locus to increase one copy of the glk gene.

[0039] Using the genome of Escherichia coli MG1655 as a template, with primers yjiT -U-F (gttcaagctgttcagcctgtgct, SEQ ID No. 43) and yjiT -U-R (ccgcccacatcaccgactaatgcatactttgtcatcaaaacagcattacagccagcagga, SEQ ID No. 44) as primers for PCR, a gene fragment yjiT -UP of about 1000 bp was obtained and the PCR product was purified. Using the genome of Escherichia coli MG1655 as a template, with primers glk -F (cagtacttcctgctggctgtaatgctgttttgatgacaaagtatgcattagtcggtgatg, SEQ ID No. 45) and glk -R (gaaaaaatagttgttgccgcctgagtaactatacttacagaatgtgacctaaggtctggc, SEQ IDNo. 46) as primers for PCR, a gene fragment glk ​Approximately 1000 bp and purify the PCR product. Using the genome of Escherichia coli MG1655 as a template, with primers yjiT -D-F (ttacgccagaccttaggtcacattctgtaagtatagttactcaggcggcaacaactattt, SEQ ID No.47) and yjiT -D-R (cgacaaaataacccgaacgcgg, SEQ ID No.48) as primers for PCR to obtain the gene fragment yjiT -DOWN approximately 1100 bp and purify the PCR product. Overlap PCR was performed on the fragments yjiT -UP, glk , yjiT -DOWN to obtain the targeting fragment.

[0040] Using the plasmid pTarget as a template (Jiang, et al. 2015), with primers yjiT -N20-F (catcgtcgttggtgaaacgggttttagagctagaaatagcaagttaaaataaggct, SEQ ID No.49) and yjiT -N20-R (ccgtttcaccaacgacgatgactagtattatacctaggactgagctagctgtcaag, SEQ ID No.50) for amplification to obtain pTarget- yjiT [[ID=ID=21]]. Using an electroporator (Bio-Rad), the targeting fragment, plasmid pTarget- yjiT and plasmid pCas9 were electrotransformed into Escherichia coli MG1655-Δ ptsG :: glf prepared in Example 1. The electroshock conditions were voltage 2.5 KV, resistance 200 Ω, capacitance 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant strain was screened and named MG1655-Δ ptsG :: glf -Δ yjiT :: glk .

[0041] The recombinant plasmid pTrc99a- ectABC prepared in Example 1 was electrotransformed (conditions as above) into MG1655-Δ ptsG :: glf -Δ yjiT :: glk . The obtained recombinant strain was named MG1655-Δ ptsG :: glf -Δ yjiT:: glk / pTrc99a- ectABC 。

[0042] Example 3 Overexpression of phosphoenolpyruvate carboxylase ppc

[0043] In this example, the original promoter (the sequence is shown as SEQ ID No.5) of the phosphoenolpyruvate carboxylase gene of Escherichia coli MG1655 ATCC 700926 ppc (NCBI accession number: 948457) was replaced with the P J23110 promoter (the sequence is shown as SEQ ID No.6) to overexpress the phosphoenolpyruvate carboxylase gene ppc 。

[0044] Using the genome of Escherichia coli MG1655 as a template, with primers ppc -U-F (tggaaacacggtttatcaagcccacc, SEQ ID No.26) and ppc -U-R (aaagctagcattgtacctaggactgagctagccgtaaattttataaagccacgtaaaagcggtgacgt, SEQ ID No.27) as primers for PCR to obtain a gene fragment ​ -UP about 600bp and purify the PCR product. Using the genome of Escherichia coli MG1655 as a template, with primers ​ -D-F (tcctaggtacaatgctagctttaagaaggagatatacatatgaacgaacaatattccgcattgcgt, SEQ ID No.28) and ​ -D-R (ggcttggacgcagcttacgg, SEQ ID No.29) as primers for PCR to obtain a gene fragment ​ -DOWN about 600bp and purify the PCR product. Overlap PCR was performed on the fragments ​ -UP, ​ -DOWN to obtain the targeting fragment. Using plasmid pTarget as a template (Jiang, et al. 2015), with primers ​ -N20-F (ttcgcgccaatgcgacgtgagttttagagctagaaatagcaagttaaaataaggct, SEQ ID No.30) and ​-N20-R (tcacgtcgcattggcgcgaaactagtattatacctaggactgagctagctgtcaag, SEQ ID No.31) was amplified to obtain pTarget- ​ . The targeting fragment, plasmid pTarget- ​ and plasmid pCas9 were electrotransformed into Escherichia coli MG1655-Δ ​ :: ​ -P trc - ​ prepared in Example 1 by electroporation. The electroporation conditions were voltage 2.5 KV, resistance 200 Ω, capacitance 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant bacteria were screened and the strain was named MG1655-Δ ​ :: ​ -P trc - ​ -P J23110 - ​ .

[0045] The recombinant plasmid pTrc99a- ​ was electrotransformed (conditions as above) into MG1655-Δ ​ :: ​ -P trc - ​ -P J23110 - ​ to obtain the recombinant strain named MG1655-Δ ​ :: ​ -P trc - ​ -P J23110 - ​ / pTrc99a- ​ .

[0046] Example 4 Increasing the copy number of phosphoenolpyruvate carboxylase ​

[0047] In this example, the phosphoenolpyruvate carboxylase gene of Escherichia coli MG1655 ATCC 700926 ​ was replaced at the pseudogene ​ (the sequence is shown in SEQ ID No.51) locus to increase one copy of the ​ gene.

[0048] Using the genome of Escherichia coli MG1655 as a template, with primers ​ -U-F (acattagactgcttgcatcagccag, SEQ ID No.52) and ​-U-R (acattactacgcaatgcggaatattgttcgttcattgtaggttctgaaccggttctagcg, SEQ ID No.53) was used as a primer for PCR to obtain a gene fragment ​ -UP of approximately 1000 bp and the PCR product was purified. Using the genome of Escherichia coli MG1655 as a template, with primers ​ -F (tcacaaccccgctagaaccggttcagaacctacaatgaacgaacaatattccgcattgcg, SEQ ID No.54) and ​ -R (gaaatataggggcaaatccaccttgtgctgatatgttagccggtattacgcatacctgcc, SEQ ID No.55) as primers for PCR, a gene fragment ​ of approximately 1000 bp was obtained and the PCR product was purified. Using the genome of Escherichia coli MG1655 as a template, with primers ​ -D-F (ccgggattgcggcaggtatgcgtaataccggctaacatatcagcacaaggtggatttgcc, SEQ ID No.56) and ​ -D-R (aggaagtcttactgctgtcgcc, SEQ ID No.57) as primers for PCR, a gene fragment ​ -DOWN of approximately 1100 bp was obtained and the PCR product was purified. The fragments ​ -UP, ​ , ​ -DOWN were subjected to overlap PCR to obtain a targeting fragment.

[0049] Using plasmid pTarget as a template (Jiang, et al. 2015), with primers ​ -N20-F (catcgtcgttggtgaaacgggttttagagctagaaatagcaagttaaaataaggct, SEQ ID No.58) and ​ -N20-R (ccgtttcaccaacgacgatgactagtattatacctaggactgagctagctgtcaag, SEQ ID No.59) for amplification to obtain pTarget- ​ . Using an electroporator (Bio-Rad), the targeting fragment, plasmid pTarget- ​And plasmid pCas9 were transformed into Escherichia coli MG1655-Δ prepared in Example 2 by electroporation ​ :: ​ -Δ ​ :: ​ with the electroporation conditions of voltage 2.5 KV, resistance 200 Ω, and capacitance 25 μF (the width of the electroporation cuvette is 2 mm). The recombinant bacteria were screened and the strain was named MG1655-Δ ​ :: ​ -Δ ​ :: ​ -Δ ​ :: ​ 。

[0050] The recombinant plasmid pTrc99a-prepared in Example 1 ​ was transformed into MG1655-Δ by electroporation (conditions as above) ​ :: ​ -Δ ​ :: ​ -Δ ​ :: ​ to obtain the recombinant strain named MG1655-Δ ​ :: ​ -Δ ​ :: ​ -Δ ​ :: ​ / pTrc99a- ​ 。

[0051] Example 5 Replacement of the original promoter of Escherichia coli with a growth-phase-dependent promoter ​ of Escherichia coli

[0052] In this example, the original promoter of the isocitrate dehydrogenase gene of Escherichia coli MG1655 ATCC 700926 ​ (NCBI sequence number is 945702) (the sequence is shown in SEQ ID No.7) was respectively replaced with the P rpsL promoter (the sequence is shown in SEQ ID No.8) and the P rpsJ promoter (the sequence is shown in SEQ ID No.60).

[0053] Using the genome of Escherichia coli MG1655 as a template, with primers ​ -U-F (gtaatcacccatcgcatagc, SEQID No.32) and ​ -U-R (agccaagcttgcatgcctgcaggtcaccaggttaagcgattcag, SEQ ID No.33) as primers for PCR to obtain the gene fragment​ -UP was about 1000 bp and the PCR product was purified. Using the genome of Escherichia coli MG1655 as a template, with primers ​ -F (acctgcaggcatgcaagcttggcttcgtcagacttacggttaagc, SEQ ID No.34) and ​ -R (ggatcctttctcctctttgaattctatgaggacgccgaatttta, SEQ IDNo.35); ​ -F (acctgcaggcatgcaagcttggctgtgtcaaaaatgcactgaacga, SEQ ID No.36) and ​ -R (ggatcctttctcctctttgaattcaactacgacaagcccgcgcattata, SEQ ID No.37) for PCR, gene fragments ​ 、 ​ about 110 bp were obtained and the PCR products were purified. Using the genome of Escherichia coli MG1655 as a template, with primers ​ -D-F (gaattcaaagaggagaaaggatccatggaaagtaaagtagttgt, SEQ IDNo.38) and ​ -D-R (catctcttcacgcaggaatt, SEQ ID No.39) for PCR, gene fragment ​ -DOWN about 600 bp was obtained and the PCR product was purified. Fragments ​ -UP, ​ 、 ​ -DOWN, and ​ -UP, ​ 、 ​ -DOWN were subjected to overlap PCR to obtain the targeting fragments ​ - ​ and ​ - ​ .

[0054] Using plasmid pTarget as a template (Jiang, et al. 2015), with primers ​ -N20-F (ataacgcgcatctttcatgagttttagagctagaaata, SEQ ID No.40) and ​-N20-R (tcatgaaagatgcgcgttatactagtattatacctaggac, SEQ ID No. 41) was amplified to obtain pTarget- ​ . The targeting fragment ​ - ​ / ​ - ​ , plasmid pTarget- ​ and plasmid pCas9 were electrotransformed into Escherichia coli MG1655-Δ ​ :: ​ -P trc - ​ -P J23110 - ​ prepared in Example 3 and MG1655-Δ ​ :: ​ -Δ ​ :: ​ -Δ ​ :: ​ . The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). Recombinant bacteria were obtained by screening, and the strains were named MG1655-Δ ​ :: ​ -P trc - ​ -P J23110 - ​ -P rpsL - ​ , MG1655-Δ ​ :: ​ -P trc - ​ -P J23110 - ​ -P rpsJ - ​ , MG1655-Δ ​ :: ​ -Δ ​ :: ​ -Δ ​ :: ​ -P rpsL - ​ and MG1655-Δ ​ :: ​ -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsJ - icd .

[0055] The recombinant plasmid pTrc99a-prepared in Example 1 was ectABC transformed into the above-mentioned recombinant strains by electrotransformation (conditions as above), and the obtained recombinant strains were named MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsL - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsJ - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsL - icd / pTrc99a- ectABC and MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsJ - icd / pTrc99a- ectABC 。

[0056] Example 6 Fermentation and Culture of Recombinant Escherichia coli to Produce Ectoin

[0057] The recombinant strains MG1655 / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc -glk -P J23110 - ppc / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsL - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsJ - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsL - icd / pTrc99a- ectABC and MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsJ - icd / pTrc99a- ectABC Cultivate overnight on Amp plates. Inoculate a single colony from this fresh plate into an LB test tube containing 5 ml of Amp and culture at 37 °C and 200 rpm for 12 hours.

[0058] Inoculate at an inoculation amount of 5% into a 500-ml baffled shake flask containing 50 ml of fermentation medium and culture at 37 °C and 200 rpm until OD 600 reaches 0.6, then add 0.1 mM IPTG and co-culture for 48 h.

[0059] The formula of each liter of fermentation medium includes: 20 g of glucose, 0.8 g of magnesium sulfate heptahydrate, 4 g of diammonium hydrogen phosphate, 6.67 g of potassium dihydrogen phosphate, 1.35 g of potassium citrate, 20.9 g of 3-morpholinopropanesulfonic acid, 2.5 g of yeast powder, 50 mg of ferrous sulfate heptahydrate, 10 mg of calcium chloride dihydrate, 11 mg of zinc sulfate heptahydrate, 2.5 mg of manganese sulfate tetrahydrate, 5 mg of copper sulfate pentahydrate, 0.5 mg of ammonium molybdate, and 0.1 mg of sodium borate decahydrate.

[0060] During the fermentation process, the product concentration was detected by liquid chromatography, and the growth of the strain was tested. The results are shown in Table 1 and Table 2. As can be seen from Table 1 and Table 2, after respectively introducing glf , reducing ptsG expression, overexpressing glk and further overexpressing ppc , replacing icd the original promoter, the obtained recombinant bacteria, compared with the control strain MG1655 / pTrc99a- ectABC , without affecting the bacteria, the yield and production efficiency of ectoin have been greatly improved.

[0061] Table 1 Growth conditions of different strains (OD 600 )

[0062]

[0063] Table 2 Ectoin yield of different strains (g / L)

[0064]

[0065] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A recombinant microorganism, characterized in that, Compared with the starting strain, the recombinant microorganism expresses the ectABC gene of Chromohalobacter salexigens, expresses the glucose facilitator gene of Zymomonas mobilis glf while reducing the ptsG gene expression, and also overexpresses the glucokinase glk; Compared with the starting strain, the recombinant microorganism also overexpresses phosphoenolpyruvate carboxylase ppc, and replaces the original promoter of the isocitrate dehydrogenase gene with a growth-phase-dependent promoter icd The sequence of the growth-phase-dependent promoter is as shown in SEQ ID No.8 or SEQ ID No.60; The starting strain is Escherichia coli.

2. The recombinant microorganism according to claim 1, wherein The glucose-promoting gene of *Zymomonas mobilis* expressed glf while reducing ptsG the expression of the gene is as follows: using the glucose-promoting gene of *Zymomonas mobilis* glf to replace ptsG the gene; And / or, the method for overexpressing glucokinase glk is: replacing the original promoter of the glucokinase gene glk with the Ptrc promoter or increasing the copy number of the glucokinase gene glk , and the sequence of the Ptrc promoter is as shown in SEQ ID No.

4.

3. The recombinant microorganism according to claim 2, characterized in that, The method for overexpressing phosphoenolpyruvate carboxylase ppc is as follows: replacing the original promoter of the phosphoenolpyruvate carboxylase gene ppc with the P J23110 promoter or increasing the copy number of the phosphoenolpyruvate carboxylase gene ppc , and the sequence of the P J23110 promoter is as shown in SEQ ID No.

6.

4. The recombinant microorganism according to any one of claims 1-3, characterized in that The said ectABC The gene is as shown in SEQ ID No. 25, glf The gene is as shown in SEQ ID No. 2, ptsG The gene is as shown in SEQ ID No.

1.

5. Use of the recombinant microorganism according to any one of claims 1-4 in fermentation production of ectoine, in microbial genetic breeding for production of ectoine, or in increasing the yield of bioproduction of ectoine.

6. A method for fermentatively producing ectoin, characterized in that, It includes the step of culturing the recombinant microorganism according to any one of claims 1-4.

7. A method for constructing a recombinant microorganism for producing ecdysterone, characterized in that, Including a step of causing a starting strain to express the genes of Chromohalobacter salexigens ectABC and express the glucose facilitator gene of Zymomonas mobilis glf while reducing ptsG the expression of the gene, and further overexpressing the glucose kinase glk; It also includes the steps of overexpressing phosphoenolpyruvate carboxylase ppc in the starting strain and replacing the original promoter of the isocitrate dehydrogenase gene icd in the starting strain with a growth-phase-dependent promoter, and the sequence of the growth-phase-dependent promoter is as shown in SEQ ID No.8 or SEQ ID No.60; The starting strain is Escherichia coli.

8. The method according to claim 7, wherein The glucose facilitator gene of Zymomonas mobilis glf while reducing ptsG the expression of the gene in the following manner: using the glucose facilitator gene of Zymomonas mobilis glf to replace ptsG the gene; And / or, the way of overexpressing glucokinase glk is: replacing the original promoter of the glucokinase gene glk with the Ptrc promoter or increasing the copy number of the glucokinase gene glk , and the sequence of the Ptrc promoter is shown in SEQ ID No. 4.

Images