An antisense oligonucleotide and its use in the preparation of an antitumor drug
By designing antisense oligonucleotides to interfere with splicing at specific binding sites of BCS1L polynucleotides and regulating the splicing pattern of BCS1L, the drug resistance problem of ovarian cancer was solved, achieving efficient inhibition and apoptosis induction of ovarian cancer cells, thus achieving an anti-tumor effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG UNIV
- Filing Date
- 2025-03-27
- Publication Date
- 2026-06-19
AI Technical Summary
There are currently no effective drugs targeting BCS1L alternative splicing. Ovarian cancer is difficult to diagnose and is prone to drug resistance and recurrence. Traditional chemotherapy drugs have limited effectiveness.
Antisense oligonucleotides capable of regulating BCS1L splicing patterns were designed and validated. By specifically binding to the GU splicing site at the junction of exon 2 and intron 2 of BCS1L polynucleotides, these oligonucleotides interfere with the splicing process, regulate the splicing pattern of BCS1L, induce tumor cell apoptosis, and inhibit cell proliferation and mitochondrial function.
It significantly inhibits the proliferation of ovarian cancer cells, increases the apoptosis rate, reduces mitochondrial ATP content, increases ROS levels, reduces basal oxygen consumption and proton leakage levels, and inhibits the function of mitochondrial complex III, thus achieving effective treatment for ovarian cancer.
Smart Images

Figure CN120118906B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology and relates to an antisense oligonucleotide and its application in the preparation of antitumor drugs. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Ovarian cancer is an insidious malignant tumor of the female reproductive system that is difficult to diagnose and prone to drug resistance and recurrence. The 5-year survival rate for ovarian cancer is approximately 50%, with the vast majority of patients diagnosed at an advanced stage with peritoneal metastasis. The mortality rate for advanced ovarian cancer is as high as 75%. Even after cytoreductive surgery and chemotherapy, a large proportion of patients still experience recurrence and develop resistance to traditional chemotherapy drugs. Therefore, effective early diagnostic criteria and treatment targets are crucial for improving the prognosis of ovarian cancer.
[0004] Eukaryotic splicing is a complex and dynamic physiological process. The spliceosome complex, composed of five small ribonucleoprotein complexes (snRNPs), removes introns from precursor mRNA and connects exons to produce mature mRNA. Over 95% of human genes combine different protein-coding regions through alternative splicing, ultimately producing proteins with different or even opposite functions, greatly increasing the diversity and complexity of the human genome and proteins. Aberrant splicing events in the transcriptome are a characteristic of cancer. Data from TCGA show that the number of splicing events in malignant tumors is about 30% higher than in normal tissues, and splicing abnormalities play an important role in the occurrence and development of various cancers. Literature reports aberrant splicing events in the CD44, BCL2L12, BAX, AIMP2, and OPN genes in ovarian cancer. Multiple studies have demonstrated that targeted alternative splicing is a promising and potential cancer treatment strategy.
[0005] The BCS1L gene encodes BCS1L (Ubiquinol-Cytochrome C Reductase Complex Chaperone), a transmembrane chaperone required for the assembly of mitochondrial respiratory chain complex III. Near the N-terminus of BCS1L is a transmembrane domain spanning the inner mitochondrial membrane, an AAA (ATPases associated with various cellular activities) domain, and a mitochondrial targeting signaling pathway. BCS1L facilitates the transport of folded iron-sulfur proteins and their inclusion in the core assembly of complex III. Mutations in the BCS1L gene can lead to Gracie syndrome or... Both syndromes are associated with a deficiency of mitochondrial complex III and affect the brain, kidneys, liver, heart, and skeletal muscle. In the current study, the inventors demonstrated that BCS1L produces two major isoforms through alternative splicing: a full-length isoform (BCS1L-L) and a truncated isoform (BCS1L-S) resulting from exon 2 skipping. Unlike BCS1L-L, BCS1L-S cannot target mitochondria due to the loss of mitochondrial targeting signals.
[0006] Compared to poorly targeted drugs or inhibitors that act on the entire complex or metabolic enzymes, antisense oligonucleotides can target highly expressed or specifically expressed splice isoforms in tumors, thereby improving the specificity of antitumor drugs and minimizing damage to normal cells. Antisense oligonucleotides (ASOs) are short chains of deoxyribonucleotide analogs, approximately 15-20 bp in length. The modified deoxyribonucleotides can competitively bind to specific splice sites, altering the splicing pattern of target genes by inhibiting RNA-RNA or splicing factor-RNA interactions. Currently, six antisense oligonucleotide drugs have been granted market authorization, and as of 2022, at least ten antisense oligonucleotides have been approved by the U.S. Food and Drug Administration (FDA). Spinraza (nusinersen) is the first FDA-approved drug for the treatment of spinal muscular atrophy (SMA). This antisense oligonucleotide alters the splicing of exon 7 of SMN2, increasing the expression of functional SMN proteins. Exondys 51 (eteplirsen) became the first drug for Duchenne muscular dystrophy (DMD) to receive accelerated approval from the FDA.
[0007] Currently, there are no effective drugs targeting BCS1L alternative splicing. Further research and development are needed in this field to explore methods and drugs that regulate BCS1L alternative splicing to control the development and progression of related diseases. Summary of the Invention
[0008] This invention, through research, discovered the aberrantly spliced mitochondrial metabolism-related gene BCS1L in various malignant tumors (including ovarian cancer), and the core transcript of BCS1L differs in exon 2, which skips to produce a long transcript (BCS1L-L) and a short transcript (BCS1L-S). Furthermore, a classic GU splicing site was found at the junction of exon 2 and intron 2. Based on this, the inventors designed and validated an effective sequence capable of regulating the BCS1L splicing pattern. This effective sequence can induce tumor cell apoptosis, inhibit cell proliferation and mitochondrial function, and ultimately serve as a drug for treating or fighting tumors.
[0009] Based on the above research findings, this invention provides an antisense oligonucleotide and its application in the preparation of antitumor drugs. The technical solution provided by this invention is as follows:
[0010] In a first aspect, an antisense oligonucleotide comprising 5-30 nucleotides having at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the BCS1L polynucleotide, wherein the antisense oligonucleotide is capable of acting on the GU splicing site at the junction of exon 2 and intron 2 of the BCS1L polynucleotide, thereby regulating the BCS1L splicing pattern.
[0011] In this invention, the BCS1L polynucleotide can be the genomic DNA of BCS1L, particularly the single strand (template strand) of the genomic DNA that serves as an RNA template. The oligonucleotide provided by this invention is inversely complementary to the mRNA sequence (including mature or immature precursor mRNA, i.e., pre-mRNA) transcribed from genomic DNA, and can recognize and bind to said mRNA (including pre-mRNA), thereby regulating (interfering with) the normal function of nucleic acids, such as splicing and translation, thereby playing an anti-tumor role.
[0012] BCS1L (Ubiquinol-Cytochrome C Reductase Complex Chaperone), a homologue of BCS1, encodes a yeast BCS1L protein involved in the assembly of mitochondrial respiratory chain complex III. Mutations in this gene are associated with mitochondrial complex III deficiency and Gracie syndrome. Due to alternative splicing of exon 2 of BCS1L, BCS1L produces a long transcript (BCS1L-L) and a short transcript (BCS1L-S).
[0013] In this invention, "oligonucleotide" refers to oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or their analogues. "Oligonucleotide" may include natural and / or modified monomers or bonded linear or cyclic oligomers, such as deoxyribonucleosides, ribonucleosides, their substituted forms and α-anomeric forms, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphate thioesters, methyl phosphonates, and their analogues. Oligonucleotides are capable of pairing with complementary sequences via Watson-Crick type bases.
[0014] Antisense oligonucleotides recognize and hybridize with "target nucleic acids." "Target nucleic acids" encompass DNA, RNA transcribed from such DNA (including precursor mRNA and mRNA), cDNA derived from such RNA, coding sequences, non-coding sequences, and sense or antisense polynucleotides. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This regulation of the target nucleic acid's function by a compound that specifically hybridizes with it is generally referred to as "antisense." DNA functions to be interfered with include, for example, replication and transcription. The overall effect of this interference with the target nucleic acid's function is to regulate the expression of the encoded product or oligonucleotide. For example, if it is an RNA oligonucleotide, it binds to another RNA target via RNA-RNA interactions and alters the activity of the target RNA. Antisense oligonucleotides can upregulate or downregulate the expression and / or function of specific polynucleotides. Such molecules include, for example, antisense RNA or DNA molecules, interfering RNA (RNAi), microRNA, bait RNA molecules, siRNA, enzymatic RNA, therapeutic editing RNA, antisense oligomers, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternative splice variants, and other oligomers that hybridize with at least a portion of the target nucleic acid. These compounds can exist in the form of single-stranded, double-stranded, partially single-stranded, or cyclic oligomers.
[0015] Target segments may include DNA or RNA sequences comprising at least five consecutive nucleotides from the 5' end of one of the preferred target segments (the remaining nucleotides being a continuous extension of the DNA or RNA that begins immediately upstream of the 5' end of the target segment and continues until the DNA or RNA contains approximately 5 to approximately 30 nucleotides). Once one or more target regions, segments, or sites are identified, those skilled in the art can select antisense compounds that are sufficiently complementary to the target, i.e., hybridize sufficiently well and with adequate specificity to obtain the desired effect, according to known methods.
[0016] In this invention, "nucleotide" encompasses both naturally occurring and non-naturally occurring nucleotides. "Nucleotide" includes not only known molecules containing purine and pyrimidine heterocycles, but also their heterocyclic analogs and tautomers. Exemplary examples of nucleotides and their analogs are molecules containing adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazoxanthine, 7-deazoguanine, N4,N4-bridged ethylidene cytosine, N6,N6-bridged ethylidene-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, and inosine.
[0017] When the binding of an antisense oligonucleotide to a target nucleic acid interferes with the normal function of the target nucleic acid, leading to regulation of function and / or activity, the compound is "specifically hybridizable" and has sufficient complementarity under the conditions of desired specific binding (i.e., physiological conditions in the case of in vivo assay or therapeutic treatment and conditions for assay in the case of in vitro assay) to avoid nonspecific binding of the antisense compound to non-target nucleic acid sequences.
[0018] The oligonucleotide sequence need not be 100% complementary to the sequence of its target nucleic acid to be specifically hybridized. Furthermore, the oligonucleotide can hybridize via one or more segments, such that intervening or adjacent segments are not involved in the hybridization (e.g., loop structures, mismatches, or hairpin structures). The oligonucleotides of the present invention comprise those having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence complementarity with the target region of the target nucleic acid sequence it targets.
[0019] In some embodiments, the sequence of the BCS1L polynucleotide is shown in SEQ ID NO:1. The nucleotide sequence of SEQ ID NO:1 is the positive strand of the BCS1L genomic DNA, that is, the sequence of a single strand of DNA identical to the transcribed mRNA sequence.
[0020] In some embodiments, the antisense oligonucleotide shares at least 50% sequence identity with the anticomplementary sequence of the polynucleotide fragment at the junction of exon 2 and intron 2 of the BCS1L polynucleotide. For example, in the polynucleotide shown in SEQ ID NO:1, exon 2 is located at positions 2197-2565, and intron 2 is located at positions 2566-2663. In one embodiment of the invention, the antisense oligonucleotide shares at least 50% sequence identity with the anticomplementary sequence of nucleotides 2536-2595 of the polynucleotide with the sequence SEQ ID NO:1.
[0021] In some embodiments, the antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the polynucleotide fragment at the junction of exon 2 and intron 2 of the following BCS1L polynucleotides: a 30-nucleotide fragment at the end of exon 2 connected to intron 2, a 30-nucleotide fragment at the end of intron 2 connected to exon 2, or a fragment including the 30-nucleotide junction of exon 2 and intron 2.
[0022] In some embodiments, the antisense oligonucleotide comprises the reverse complementary sequence of the first 5 to 20 nucleotide segments of the natural antisense sequence of the exon 2 end of the intron 2 of the BCS1L polynucleotide. Preferably, the antisense oligonucleotide comprises the reverse complementary sequence of the first approximately 5 nucleotide segments of the natural antisense sequence of the exon 2 end of the intron 2 of the BCS1L polynucleotide.
[0023] In some embodiments, the antisense oligonucleotide comprises (having) an anticomplementary sequence to any 5 to 20 consecutive nucleotides from positions 2566 to 2585 of the BCS1L polynucleotide of SEQ ID NO:1. In yet another embodiment of the invention, the antisense oligonucleotide comprises (having) an anticomplementary sequence to positions 2566 to 2570 of the BCS1L polynucleotide of SEQ ID NO:1.
[0024] Introns are the portions of eukaryotic DNA located between two coding regions, namely exons. The RNA transcribed from introns and exons is called "primary transcript, mRNA precursor (or pre-mRNA)." Introns are removed from pre-mRNA to produce native proteins encoded by exons (native proteins refer to naturally occurring, wild-type, or functional proteins). During splicing, introns are removed from pre-mRNA, and exons are joined together. Splicing is a series of reactions on RNA mediated by splicing factors, occurring after transcription but before translation. Therefore, pre-mRNA is RNA containing both introns and exons. mRNA is RNA in which introns have been removed, exons are sequentially linked, and it can be transcribed into proteins by ribosomes.
[0025] Introns typically contain one or more splicing elements. Splicing elements are relatively short, conserved segments of RNA that bind to various splicing factors that perform the splicing response. Generally, introns are defined by a 5' splice site, a 3' splice site, and a segment in between. Splicing elements are typically "blocked" when antisense oligonucleotides completely or partially overlap with the splicing element, or bind to pre-mRNA very close to the element, thereby disrupting the binding and function of splicing factors that mediate specific splicing responses on the element.
[0026] In some embodiments, the antisense oligonucleotide comprises one or more modifications selected from: at least one modified sugar moiety, at least one modified nucleotide, at least one modified nucleotide, and combinations thereof. In one embodiment of the invention, one or more nucleotides in the antisense oligonucleotide are modified nucleotides. In one embodiment of the invention, the one or more modifications include at least one modified nucleotide selected from: thiophosphate, 2'-O-methoxyethyl (MOE), 2'-fluoro, alkyl phosphate, dithiophosphate, alkyl thiophosphonate, aminophosphate, carbamate, carbonate, triphosphate, glycine, carboxymethyl ester, and combinations thereof. Using modified nucleotides can give the antisense oligonucleotide of the present invention higher target binding affinity and / or nuclease resistance.
[0027] In some embodiments, the antisense oligonucleotide has a nucleotide sequence as shown in SEQ ID NO:2 or SEQ ID NO:3.
[0028] In some implementations, the antisense oligonucleotide is:
[0029] C*C*A*C*C*T*T*ACCAGA*T*A*A*A*A*T*G*G; or
[0030] C*T*C*C*C*T*A*G*C*TCCCC*A*C*C*T*T*A*C;
[0031] * indicates thiophosphate modification.
[0032] Secondly, a pharmaceutical composition comprising the aforementioned antisense oligonucleotide, and a pharmaceutically acceptable diluent or carrier.
[0033] The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be local, pulmonary (e.g., by inhalation or blowing of powders or aerosols, including via nebulizers), tracheal, nasal, epidermal, and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial (e.g., intrathecal or intraventricular) administration.
[0034] The pharmaceutical compositions provided by this invention can be prepared into desired formulations using conventional techniques well-known in the pharmaceutical industry. These techniques include steps of binding the active ingredient to a pharmaceutical carrier or excipient. Generally, formulations are prepared by uniformly and tightly binding the active ingredient to a liquid carrier or a finely fragmented solid carrier, or both, followed by (if necessary) shaping the product.
[0035] Thirdly, the use of one of the above-mentioned antisense oligonucleotides or pharmaceutical compositions in the preparation of antitumor drugs.
[0036] In some embodiments, the tumors include, but are not limited to: meningioma, melanoma, acoustic neuroma, oligodendroglioma, neuroblastoma, chordoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, retinoblastoma, small cell lung tumor, primary brain tumor, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, gastric cancer, colon cancer, malignant pancreatic islet tumors, cervical cancer, endometrial cancer, adrenocortical carcinoma, breast cancer, ovarian cancer, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, and prostate cancer. Adenocarcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, neuroblastoma, breast cancer, rhabdomyosarcoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, malignant carcinoid tumor, pre-malignant skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, urogenital tract cancer, malignant hypercalcemia, choriocarcinoma, seminoma, embryonal carcinoma, nephroblastoma, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal tumor, hemangioblastoma, essential thrombocytosis, essential macroglobulinemia. Preferably, the antitumor drug of the present invention is suitable for treating BCS1L-related diseases such as ovarian cancer, gastric cancer, pancreatic cancer, breast cancer, lung cancer, liver cancer, kidney cancer, prostate cancer, glioma, adrenocortical carcinoma, melanoma, sarcoma, and especially ovarian cancer.
[0037] In some embodiments, the antitumor drug is administered to mammals. The mammals described in this invention can be any mammal, including but not limited to rodents (such as mice and rats), lagomorphs (rabbits), carnivores (fels and canines), even-toed ungulates (bovids and suidae), perissodactyls (equines), or primates and apes (humans or monkeys). Humans are preferred.
[0038] In some embodiments, the antitumor drug has the following effects:
[0039] Inhibit the proliferation rate of cancer cells; and / or,
[0040] Inducing apoptosis in cancer cells; and / or,
[0041] Reduce the ATP content in the mitochondria of cancer cells; and / or,
[0042] Increase the level of reactive oxygen species (ROS) in cancer cells; and / or,
[0043] Reduce the basal oxygen consumption of cancer cells; and / or,
[0044] Reduce proton leakage levels in cancer cells; and / or,
[0045] Reduce the reserve respiratory capacity of cancer cells; and / or,
[0046] Inhibits the function of mitochondrial complex III in cancer cells.
[0047] The beneficial effects of this invention are as follows:
[0048] Experiments show that the antisense oligonucleotides provided in this invention not only exhibit high inhibitory activity against cancer cells, especially ovarian cancer cells, but also inhibit cancer cell proliferation and increase the proportion of early and late apoptosis induced in cancer cells. In experiments on the effects of antisense oligonucleotides on mitochondrial function in ovarian cancer, the antisense oligonucleotides provided in this invention significantly reduced mitochondrial ATP content and significantly increased ROS levels in cancer cells; simultaneously, they also reduced basal oxygen consumption, proton leakage levels, and reserve respiration capacity in ovarian cancer cells, and inhibited the function of mitochondrial complex III. In summary, the antisense oligonucleotides provided in this invention can achieve tumor treatment by inducing tumor cell apoptosis and inhibiting cell proliferation and mitochondrial function, and can therefore be applied to the preparation of antitumor drugs. Attached Figure Description
[0049] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0050] Figure 1This document presents the structure, expression, and validation of the long transcript (BCS1L-L) and short transcript (BCS1L-S) of BCS1L in Example 1. A shows a schematic diagram of the sequences of the long and short BCS1L transcripts, where the yellow area represents the coding region, the TMD (trans-membrane domain) is the transmembrane region, the MTS (mitochondrial targeting sequence) is the mitochondrial targeting sequence, and the IAS (import auxiliary sequence) is the upper membrane accessory region; B shows the protein structure diagram of the long and short BCS1L transcripts predicted by SWISS-MODEL; C shows the Western blot diagram... Blotting was used to detect the protein expression of BCS1L long and short transcripts in normal human fallopian tube cell line FTE187 and human ovarian cancer cell lines (A2780, HEY, SKOV3, OV90, HOC7, OVCAR3, OVCAR8, CAOV3). Figure D shows the bioinformatics analysis of the expression of major BCS1L transcripts in ovarian cancer specimens from the TCGA database and normal ovarian specimens from the GTEx database. In ovarian cancer, the proportion of BCS1L-L is high and the proportion of BCS1L-S is low. E shows the BCS1L long and short transcript expression ratio analysis of 374 ovarian cancer samples from the TCGA database and 180 normal ovarian tissues from the GTEx database; F shows the expression of BCS1L in ovarian cancer and fallopian tube fimbriae clinical samples verified by real-time quantitative PCR; G shows the expression of BCS1L in 10 normal ovarian tissues and 14 fresh ovarian cancer tissues verified by immunohistochemical scoring; H shows the expression of BCS1L-L and BCS1L-S in all tumor tissues in the TCGA database through bioinformatics analysis.
[0051] Figure 2The subcellular localization and function differences of the long transcript (BCS1L-L) and short transcript (BCS1L-S) of BCS1L in Example 2. In this study, A shows the subcellular localization of the long and short BCS1L transcripts in A2780 and HeLa cell lines detected by Western blotting; B shows the protein pathway map enriched by proteins bound to BCS1L-L or BCS1L-S as detected by mass spectrometry; C shows the subcellular localization of the long and short BCS1L transcripts detected by immunofluorescence after exogenous overexpression of the two transcripts with red fluorescent m-Cherry signals, BCS1L-L and BCS1L-S, in the ovarian cancer A2780 cell line, with Pearson's correlation coefficient used to describe the fluorescence co-localization correlation between the long and short BCS1L transcripts and the Mito-tracker; D shows the subcellular localization of the long and short BCS1L transcripts detected by immunofluorescence after exogenous overexpression of the two transcripts with red fluorescent m-Cherry signals, BCS1L-L and BCS1L-S, in the cervical cancer HeLa cell line, with Pearson's correlation coefficient used to describe the correlation between the long and short BCS1L transcripts and the Mito-tracker. The coefficient was used to describe the fluorescence co-localization correlation between BCS1L long and short transcripts and the Mito-tracker; E shows the effect of BCS1L-L or BCS1L-S overexpression on mitochondrial function in A2780 ovarian cancer cells detected using Seahorse XFe24 and a mitochondrial stress kit, including mitochondrial basal oxygen consumption (Basal), ATP production (ATP), maximum oxygen consumption (Maximal), reserve respiratory capacity (SC), proton leakage, and non-mitochondrial oxygen consumption (Non-Mito); F shows the flow cytometry plot of the effect of BCS1L-L or BCS1L-S overexpression on mitochondrial membrane potential detected using the JC-1 probe under 500 μM hydrogen peroxide induction; G shows the flow cytometry plot of apoptosis detected after BCS1L-L or BCS1L-S overexpression under 500 μM hydrogen peroxide induction.
[0052] Figure 3The diagram shows the effects of antisense oligonucleotides in the junctional site region between the variable exon 2 and intron 2 of BCS1L on exon skipping and the expression of long and short transcripts of BCS1L. Specifically, A is a schematic diagram of the specific design sites of the two antisense oligonucleotides; BC is a diagram of the regulation of the alternative splicing pattern of BCS1L gene RNA by the two antisense oligonucleotides in ovarian cancer cell lines A2780 and HEY using semi-quantitative PCR; DE is a diagram of the quantitative regulation of the alternative splicing pattern of BCS1L gene RNA by the two antisense oligonucleotides in ovarian cancer cell lines A2780 and HEY using real-time quantitative PCR; and FG is a diagram showing the determination of the IC50 of the antisense oligonucleotide ASO3 on ovarian cancer cells A2780 and HEY.
[0053] Figure 4 Figure 1 shows the effect of antisense oligonucleotides on inhibiting cell proliferation and inducing apoptosis. Figures AB show the proportion of proliferating cells in ovarian cancer cell lines A2780 and HEY after treatment with antisense oligonucleotide ASO3 at different time gradients (0, 24, 48, 72, 96 h) using the MTT assay and the Incucyte S3 Live Cell Analysis Instrument. Figure C shows the proportion of apoptotic cells in ovarian cancer cell lines A2780 and HEY induced by antisense oligonucleotide ASO3, as detected by flow cytometry.
[0054] Figure 5 Figure 1 shows the effect of antisense oligonucleotides on mitochondrial function in ovarian cancer cells. Specifically, AB shows the ATP content in ovarian cancer cell lines A2780 and HEY after treatment with antisense oligonucleotide ASO3; CD shows the reactive oxygen species (ROS) content in A2780 and HEY ovarian cancer cell lines after treatment with antisense oligonucleotide ASO3 using flow cytometry; EF shows the effect of antisense oligonucleotide ASO3 treatment on mitochondrial function in A2780 and HEY ovarian cancer cells using Seahorse XFe96 and a mitochondrial stress assay kit; and G shows the inhibition of mitochondrial complex III function in ovarian cancer cell lines by antisense oligonucleotide ASO3 using the OROBOROS O2K cell energy metabolism analysis system.
[0055] Figure 6In Example 4, an in vivo experiment was conducted using a nude mouse tumorigenesis model to verify the inhibition of ovarian cancer growth by antisense oligonucleotide ASO3. A represents the subcutaneous tumor formation of the A2780 cell line in NOD SCID mice; B represents the tumor weight statistics of the A2780 cell line in NOD SCID mice; and C represents the tumor volume statistics of the A2780 cell line in NOD SCID mice. After intratumoral injection of antisense oligonucleotide ASO3 twice, on days 11 and 16, the tumor volume and weight decreased, indicating that ovarian cancer growth was inhibited. Detailed Implementation
[0056] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0057] Example 1: Structure, expression, and subcellular localization of BCS1L long and short transcripts
[0058] Figure 1 A is a schematic diagram of the gene sequence and structure of BCS1L and its two main transcripts: the long transcript (BCS1L-L) and the short transcript (BCS1L-S). It shows the transmembrane domain, mitochondrial targeting region, helper membrane region, and AAAATPase functional region of BCS1L. BCS1L-S lacks the crucial N-terminal mitochondrial targeting region, preventing it from entering the mitochondria.
[0059] The protein structures of BCS1L-L and BCS1L-S were predicted using SWISS-MODEL, and the structures are as follows: Figure 1 As shown in B.
[0060] Using normal human fallopian tube cell line FTE187 and human ovarian cancer cell lines (A2780, HEY, SKOV3, OV90, HOC7, OVCAR3, OVCAR8, CAOV3) collected by the inventors' research group, the protein expression levels of BCS1L long and short transcripts were verified by Western blotting.
[0061] The main experimental steps of Western blotting for protein immunoblotting are as follows:
[0062] 1. Sample preparation for loading: Prepare 30 μg of protein sample that has been fully lysed and centrifuged with total cell protein lysis buffer. Dilute the sample with 5×SDS, heat at 95℃ for 10 min to denature, and cool on ice.
[0063] 2. Polyacrylamide gel electrophoresis (SDS-PAGE): Load 2.5 μL of protein marker, and control the loading volume of each well to within 25 μL. Perform electrophoresis at 60-80V.
[0064] 3. Transfer (wet transfer): Cut a PVDF membrane similar in shape and size to the gel. After activation with methanol, equilibrate in transfer buffer for 10-15 minutes. Use a sandwich arrangement method: place the PVDF membrane on the SDS-PAGE gel, with sponges attached to both sides. Securely place the membrane, and then place the fixed plate into the transfer tank. Place the transfer tank in an ice-water bath and transfer at 200mA for 60-90 minutes.
[0065] 4. Blocking: Block in TBST solution containing 5% skim milk on a shaker for 1 hour.
[0066] 5. For primary antibody incubation, add BCS1L (ABclonal, A7647) primary antibody diluted 1:1000 using Western primary antibody dilution buffer (Shanghai Beyotime Biotechnology Co., Ltd.), and then flip the PVDF membrane containing the protein sample onto the primary antibody.
[0067] 6. Secondary antibody incubation: Wash the membrane three times in TBST solution with 1% Tween 20 added, 10 min each time. Dilute the secondary antibody (Jackson, 115-025-003) with blocking buffer at a ratio of 1:5000 and incubate on a shaker at room temperature for 1 h. Wash three times in TBST solution, 10 min each time.
[0068] 7. Chemiluminescence: Prepare the colorimetric solution A and solution B freshly in a 1:1 ratio, add the appropriate colorimetric solution and drop it evenly onto the membrane, and image it using an ECL chemiluminescence system.
[0069] The results are as follows Figure 1 As shown in C, BCS1L-L is expressed less in normal fallopian tube epithelial cell lines and more in ovarian cancer cell lines, while BCS11L-S is expressed in the opposite way.
[0070] Based on the UCSC Xena data platform, further analysis of expression profiles of ovarian cancer samples from the TCGA database and normal ovarian specimens from the GTEx database showed that the proportion of BCS1L-L in ovarian cancer was significantly higher than that of the short transcript BCS1L-S. The results are as follows: Figure 1 As shown in D.
[0071] A detailed analysis was performed on the expression of two BCS1L transcripts in ovarian cancer. Information from 180 normal GTEx-ovary ovarian tissues and 374 TCGA-OV ovarian cancer tissues were used in the database. Results are as follows: Figure 1 As shown in Figure E, BCS1L-L / BCS1L-S expression is significantly increased in ovarian cancer.
[0072] Using 47 ovarian cancer samples and 22 normal fallopian tube fimbriae collected by the inventors' research group, real-time quantitative PCR was performed to measure the expression of BCS1L-L and BCS1L-S, and their relative expression was compared using the ΔCT method (e.g., Figure 1 (as shown in F).
[0073] The specific primers for BCS1L-L and BCS1L-S are:
[0074] BCS1L-LF:TTTGGTGTTTCCCTTTCAAGAT
[0075] BCS1L-LR:CAGGGAGCAGGGAAGACATC
[0076] BCS1L-SF: AGAGTCACGGCGGTATCGGGGGAAAT
[0077] BCS1L-SR: GGATGTTGAAGAAAACCTTTCG
[0078] The inventors' research group collected fallopian tube fimbriae (10 cases) and ovarian cancer samples (14 cases) from Qilu Hospital of Shandong University. Ovarian cancer samples were obtained from patients with primary ovarian cancer who had not undergone any surgery or chemotherapy. In addition, normal fallopian tube fimbriae samples were obtained from patients who underwent total hysterectomy and bilateral salpingo-oophorectomy due to uterine diseases or benign tumors and adnexal pathological changes. This study was approved by the Ethics Committee of Shandong University (SDULCLL2019-1-09), and all patients provided written informed consent.
[0079] The expression level of the BCS1L gene was further verified using immunohistochemical scoring. The specific steps of immunohistochemistry and scoring are as follows:
[0080] (1) Dewaxing: Tissue sections fixed in formalin and embedded in paraffin were dewaxed in xylene, treated with a series of ethanol solutions of different concentrations, and then hydrated. The steps were the same as above.
[0081] (2) Antigen retrieval: Microwave the EDTA antigen retrieval solution on high for 10 minutes, then immediately place the dehydrated slides in the solution and microwave on low for 15 minutes. Cool to room temperature, which takes about 1 hour. Wash with PBS three times for 3 minutes each time.
[0082] (3) Membrane disruption: Disrupt the membrane with 0.2% PBST solution for 15 min, then wash with PBS on a shaker 3 times for 3 min each time;
[0083] (4) Removal of peroxidase: Incubate in a humidified chamber with 3% hydrogen peroxide (peroxidase remover) for 10-15 min, then wash with PBS three times for 10 min each time.
[0084] (5) Blocking and antibody incubation: Tissue slides were blocked with 1.5% normal goat serum or EZ-Buffer BlockBSAin PBS for 1 h and then discarded; and incubated overnight at 4°C with primary antibody against BCS1L (1:200 dilution, ABclonal, A7647).
[0085] (6) Reaction enhancement: Remove primary antibody, wash 3 times with PBS on a shaker for 3 min. Add 100 μL of tissue enhancement solution to each tissue, incubate at room temperature for 20 min, and wash 3 times with PBS on a shaker for 3 min.
[0086] (7) Secondary antibody: The slides were then incubated with 100 μL of secondary antibody mixture (enhanced enzyme-labeled goat anti-rabbit IgG polymer) for 20 min, and washed 3 times with PBS for 3 min on a shaker.
[0087] (8) DAB color development: Add an appropriate amount of freshly prepared diaminobenzidine (DAB) color development solution for 3-6 min, stain with hematoxylin, soak in hydrochloric acid alcohol for 2 s, rinse with ammonia water for 7-10 s; dehydrate, the steps are the same as above.
[0088] Immunohistochemical staining results were scored, considering both the intensity of positive staining and the proportion of tumor cells. A positive reaction was defined as a brown signal of BCS1L in the cytoplasm, and the staining index (0-12) was defined as the product of staining intensity and the stained area. Staining intensity scores were assigned as follows: negative 0 points; weak 1 point; moderate 2 points; strong positive 3 points. The frequency of positive cells was defined as: less than 5%, 0 points; 5%-25%, 1 point; 26%-50%, 2 points; 51%-75%, 3 points; greater than 75%, 4 points. High expression (score ≥7) and low expression (score <7) in each sample were determined by two pathologists based on the staining intensity and extent of the tissue sections. Results are as follows: Figure 1 As shown in G, BCS1L is highly expressed in ovarian cancer.
[0089] Based on gene expression profile data from the TCGA and GTEx databases, the expression of BCS1L in various tumors was analyzed.
[0090] RNA expression levels were measured using TPM (Transcripts Per Million), and the average expression level across all samples was calculated. The expression of BCS1L in 15 normal tissues and tumors was then examined. Results are as follows: Figure 1 As shown in H. The results showed that the proportion of BCS1L-L transcripts was increased in various tumors.
[0091] Example 2: Differences in BCS1L transcripts and their expression
[0092] Mitochondria and cytoplasm of ovarian cancer cell line A2780 and cervical cancer cell line HeLa were isolated using a mitochondrial isolation kit (Wuhan Yacoin Biotechnology Co., Ltd.). Western blotting was used to verify the subcellular protein localization of BCS1L long and short transcripts. Figure 2 As shown in Figure A.
[0093] The steps for mitochondrial isolation are as follows:
[0094] 1. Cell collection: For adherent cells, wash twice with 10 mL of pre-cooled PBS, scrape off with 1 mL of PBS, and centrifuge at 500 g for 10 min.
[0095] 2. Reagent-based method for mitochondrial isolation: Add 0.75 mL of Lysis Buffer A (1X), vortex the cells at half maximum speed for 10 s, add 10 μL of Lysis Buffer B, vortex at maximum speed for 5 s, and incubate on ice for 5 min; add 250 μL of Lysis Buffer C, mix, and centrifuge at 600 g for 10 min; collect the supernatant in a new tube and centrifuge at 11000 g for 10 min.
[0096] 3. Lysis of mitochondria: After centrifugation, the supernatant is the cytoplasm, and the precipitate is the mitochondria. Add RIPA lysis buffer to the precipitate, lyse on ice for half an hour, centrifuge at 12,000 rpm for 15 minutes, and take the supernatant, which is the mitochondrial protein.
[0097] The main experimental steps of Western blotting for protein immunoblotting are as follows:
[0098] 1. Sample preparation: Prepare 30 μg of protein sample that has been fully lysed and centrifuged with cytoplasmic and mitochondrial protein lysis buffer. Dilute the sample with 5×SDS, heat at 95℃ for 10 min to denature, and cool on ice.
[0099] 2. Polyacrylamide gel electrophoresis (SDS-PAGE): Load 2.5 μL of protein marker, and control the loading volume of each well to within 25 μL. Perform electrophoresis at 60-80V.
[0100] 3. Transfer (wet transfer): Cut a PVDF membrane similar in shape and size to the gel. After activation with methanol, equilibrate in transfer buffer for 10-15 minutes. Use a sandwich arrangement method: place the PVDF membrane on the SDS-PAGE gel, with sponges attached to both sides. Securely place the membrane, and then place the fixed plate into the transfer tank. Place the transfer tank in an ice-water bath and transfer at 200mA for 60-90 minutes.
[0101] 4. Blocking: Block in TBST solution containing 5% skim milk on a shaker for 1 hour.
[0102] 5. For primary antibody incubation, add BCS1L (ABclonal, A7647) and Tom20 (Proteintech, 11802-1-AP) primary antibodies diluted 1:1000 using Western primary antibody dilution buffer (Shanghai Beyotime Biotechnology Co., Ltd.). Then, flip the PVDF membrane containing the protein sample onto the primary antibody.
[0103] 6. Secondary antibody incubation: Wash the membrane three times in TBST solution with 1% Tween 20 added, 10 min each time. Dilute the secondary antibody (Jackson, 115-025-003) with blocking buffer at a ratio of 1:5000 and incubate on a shaker at room temperature for 1 h. Wash three times in TBST solution, 10 min each time.
[0104] 7. Chemiluminescence: Prepare the colorimetric solution A and solution B freshly in a 1:1 ratio, add the appropriate colorimetric solution and drop it evenly onto the membrane, and image it using an ECL chemiluminescence system.
[0105] The results are as follows Figure 2 As shown in Figure A, BCS1L-L is mainly expressed in mitochondria, while BCS1L-S is only expressed in the cytoplasm and cannot enter the mitochondria.
[0106] Figure 2 B involves using protein immunoprecipitation to detect the proteins bound by BCS1L-L or BCS1L-S overexpressed proteins using mass spectrometry, and studying their functional differences.
[0107] The steps for co-immunoprecipitation (Co-IP) are as follows:
[0108] 1. Cell lysis: Wash adherent cells 2-3 times with pre-cooled PBS to remove culture medium or impurities. Add an appropriate amount of lysis buffer (containing protease inhibitors and phosphatase inhibitors) and lyse on ice for 30 min. After lysis, centrifuge at 4°C and 12,000 rpm for 15 min and collect the supernatant (i.e., total protein extract).
[0109] 2. Pre-cleaning magnetic beads: To reduce non-specific binding, protein A / G magnetic beads can be used to pre-clean the sample. Take an appropriate amount of protein A / G magnetic beads and wash them 2-3 times with PBS; mix the magnetic beads with the total protein extract and incubate at 4°C for 1 hour by rotation; after centrifugation, retain the supernatant and remove the magnetic beads.
[0110] 3. Antibody incubation: Add Flag (Sigma-Aldrich, F1804) antibody to the total protein extract and incubate at 4°C for 2 hours to overnight.
[0111] 4. Protein A / G magnetic bead capture: Take an appropriate amount of protein A / G magnetic beads and wash them 2-3 times with PBS; add the magnetic beads to the antibody-protein mixture and incubate at 4°C for 2 hours by rotation; the magnetic beads will bind to the antibody, thereby capturing the target protein and its interacting proteins.
[0112] 5. Washing: Wash the magnetic beads 3-4 times with pre-cooled lysis buffer, centrifuging or separating the beads using a magnetic rack after each wash. The purpose of washing is to remove unbound proteins and non-specific binders.
[0113] 6. Elution: Add an appropriate amount of 1×SDS loading buffer, boil for 5-10 min to elute the protein from the magnetic beads; collect the supernatant after centrifugation for subsequent mass spectrometry analysis.
[0114] Mass spectrometry results showed that BCS1L-L proteins were mainly enriched in biological metabolic pathways such as mitochondrial sugar metabolism and nucleotide metabolism, while BCS1L-S could not be enriched in the corresponding proteins.
[0115] To further verify the subcellular localization of BCS1L-L and BCS1L-S, exogenous overexpression plasmids of BCS1L-L and BCS1L-S with m-Cherry red fluorescent tags were constructed and transfected. Figure 2 As shown in CD, after staining with Mito-tracker and cell nuclei, live-cell fluorescence imaging was performed using a confocal microscope (Dragonfly 200).
[0116] The main experimental steps of live-cell fluorescence imaging are as follows:
[0117] (1) Take cells in the logarithmic growth phase and seed them in a 6-well plate with cell spreaders. After culturing overnight, transfect them with exogenous overexpression plasmids for 72 hours.
[0118] (2) After processing, remove the culture medium and wash twice with PBS (if phosphatase is being tested, phosphatase inhibitors need to be added);
[0119] (3) Dilute Mito-tracker at a ratio of 1:50000 and Hoechst at a ratio of 1:100 in PBS preheated to 37℃, and add to a six-well plate for staining for 20 min;
[0120] (4) Wash cells with PBS 3 times, 5 min each time; fluorescent images were taken on the Andor Revolution confocal microscope system.
[0121] To further investigate the functions of elevated and decreased BCS1L-S expression in ovarian cancer, we conducted related mitochondrial function experiments.
[0122] Specific experimental steps for determining cellular oxygen consumption rate on a Seahorse XFe24 microarray using a mitochondrial stress assay kit:
[0123] 1. Turn on and preheat the detection system the day before the experiment. Turn on the instrument host and controller, open the Wave software, wait for the controller to connect successfully to the instrument host, and heat up to 37℃ (the Seahorse XFe96 detection system should be turned on at least 5 hours in advance);
[0124] 2. Seedling cells. Collect cells and count them at a ratio of (5-10) × 10⁻⁶. 3 Seed cells at a density of 80 μL / well into XFe96-well plates. Leave one well at each of the four corners of the plate, adding 80 μL of cell growth medium as a background correction well. Place the plate in a clean bench and let it stand for 1 hour to allow the cells to settle naturally, thereby reducing edge effects and ensuring even cell distribution. After standing, place the plate in a 37°C, 5% CO2 incubator. The next day, the cell density should be approximately 80-90% before incubation.
[0125] 3. Hydration of the probe plate. Remove the cap and probe plate from the hydration plate and place it upside down on a clean bench (to protect the receptors on the probe plate from damage). Add 200 μL of sterile 3DW to each well of the hydration plate. Replace the cap and probe plate back onto the hydration plate, ensuring all receptors are submerged in sterile water. Incubate the entire probe plate overnight at 37°C in a CO2-free incubator.
[0126] 4. On the second day, discard the sterile water and add 200 μL of XF hydration solution to each well of the hydration plate. Place the probe plate device in a 37°C, CO2-free incubator and hydrate for 1-2 hours, while waiting for the medication to be prepared.
[0127] 5. Cell washing. Remove cells from the incubator and observe their state and density under a microscope, ensuring good adhesion, adequate confluence, and no contamination. Use a pipette to aspirate 60 μL of growth medium from all wells of the culture plate, leaving 20 μL. Then add 200 μL of test solution to all wells, aspirate another 200 μL, and repeat this process once more, leaving 20 μL of test solution in each well. Add 160 μL of test solution to all wells, bringing the final volume to 180 μL. Place the culture plate in a 37°C, CO2-free incubator and incubate for 1 hour before analysis.
[0128] 6. Prepare the drug and add it to the dosing well of the probe plate. Resuspend the drug and dilute it to prepare a working solution. Dilute and dissolve the drug according to the instructions, mix well and set aside. Dilute the prepared drug to the working concentration (10×) according to the instructions and add the diluted drug to the dosing well of the probe plate.
[0129] 7. On-machine operation and testing. First, place the probe plate and hydration plate into the instrument for calibration. After calibration, remove the hydration plate, place the cell culture plate in it, and start the energy metabolism detection phase. After the entire program is completed, remove the cell plate and probe plate, save the data, and close the program and the instrument.
[0130] The results are as follows Figure 2 As shown in E, compared with the control, overexpression of BCS1L-L significantly increased basal oxygen consumption, ATP production, maximum oxygen consumption, reserve respiration and proton leakage in the ovarian cancer cell line A2780, while overexpression of BCS1L-S had no effect.
[0131] The ability of BCS1L-L or BCS1L-S overexpression to resist hydrogen peroxide-induced apoptosis was examined under 500 μM hydrogen peroxide induction.
[0132] JC-1 (5,5',6,6'-Tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide) is a commonly used fluorescent dye for detecting mitochondrial membrane potential (ΔΨm). JC-1 forms polymers (J-aggregates) and emits red fluorescence when the mitochondrial membrane potential is high; while at a low membrane potential, it exists as a monomer and emits green fluorescence. Changes in the ratio of red to green fluorescence can be assessed by detecting these changes. The procedure for detecting mitochondrial membrane potential using flow cytometry is as follows:
[0133] 1. Cell preparation: Seed cells in culture plates or dishes and culture to an appropriate density (usually 70-80% confluence). Digest adherent cells with trypsin without EDTA and collect the cell suspension; wash cells 2-3 times with PBS to remove serum from the culture medium (serum may affect JC-1 staining).
[0134] 2. JC-1 staining: Add diluted JC-1 working solution (5-10 μM) to completely cover the cells. Incubate at 37°C in the dark for 20 minutes. After incubation, wash the cells 2-3 times with PBS to remove unbound JC-1 dye.
[0135] 3. Positive control setup: To verify the reliability of the experiment, a positive control group can be set up: Before JC-1 staining, treat cells with a mitochondrial membrane potential uncoupling agent (such as 10 μM CCCP) for 20-30 min. Then perform JC-1 staining as described above.
[0136] 4. Flow cytometry: Resuspend cells in PBS and filter to remove cell clumps. Detect fluorescence signals using flow cytometry: excitation wavelength: 488 nm; green fluorescence (monomer): emission wavelength 530 nm (FITC channel); red fluorescence (polymer): emission wavelength 590 nm (PE channel). Analyze changes in the red-green fluorescence ratio to assess mitochondrial membrane potential.
[0137] The Annexin V-PE / 7-AAD Apoptosis Staining Kit (Nanjing Novizan Biotechnology Co., Ltd.) is a commonly used flow cytometry method for distinguishing between live cells, early apoptotic cells, late apoptotic cells, and necrotic cells. Annexin V binds to phosphatidylserine (PS) on the cell surface, while 7-AAD (7-Aminoactinomycin D) is a nucleic acid dye that can penetrate damaged cell membranes into dead cells. The combination of these two dyes allows for accurate differentiation of cells in different states. Specific experimental procedures are as follows:
[0138] 1. Cell collection: Collect 5 × 10⁶ cells. 5 For each adherent cell, digest the cells with trypsin without EDTA. After digestion is stopped, collect the cells, centrifuge at 1000 rpm and 4℃ for 5 min, and discard the supernatant.
[0139] 2. Washing cells: Wash cells twice with pre-cooled PBS, centrifuging at 1000 rpm and 4°C for 5 min each time, and discard the supernatant.
[0140] 3. Resuspend cells: Add 100 μL of 1×Binding Buffer and gently mix until a single-cell suspension is formed.
[0141] 4. Cell staining: Add 5 μL Annexin V-PE and 5 μL 7-AAD Staining Solution and mix well; incubate at room temperature (20-25℃) for 10 min; add 400 μL 1× Binding Buffer and mix well.
[0142] 5. Samples were analyzed by flow cytometry within 1 hour after staining: normal cells were double negative (Annexin V-PE). ﹣
[0143] / 7-AAD ﹣ Early apoptotic cells were Annexin V-PE single positive (Annexin V-PE) ﹢ / 7-AAD ﹣ Late-stage apoptotic cells were double-positive for Annexin V-PE and 7-AAD (Annexin V-PE). ﹢ / 7-AAD ﹢ ).
[0144] The results are as follows Figure 2 As shown in FG, overexpression of BCS1L-L can resist hydrogen peroxide-induced mitochondrial membrane potential abnormalities and apoptosis, while BCS1L-S has a poor ability to resist oxidative stress.
[0145] Example 3: Antisense oligonucleotides targeting exon 2 of BCS1L and their effects
[0146] The inventors of this application discovered that the core transcript of BCS1L differs in exon 2, and found a classic GU splicing site at the junction of exon 2 and intron 2 surrounding BCS1L. The inventors designed and prepared antisense oligonucleotides located in the junction region of exon 2 and intron 2 of BCS1L:
[0147] CCACCTTACCAGATAAAATGG(SEQ ID NO:2);
[0148] CTCCCTAGCTCCCCACCTTAC (SEQ ID NO: 3).
[0149] By inhibiting the splicing of immature precursor RNA of downstream target genes by complementary base pairing, BCS1L splicing is interfered with and changes in the splicing pattern of exon 3 are caused.
[0150] The following antisense oligonucleotides were synthesized by Beijing Qingke Biotechnology Co., Ltd.:
[0151] BCS1L-ASO-2:
[0152] C*C*A*C*C*T*T*ACCAGA*T*A*A*A*A*T*G*G
[0153] BCS1L-ASO-3:
[0154] C*T*C*C*C*T*A*G*C*TCCCC*A*C*C*T*T*A*C
[0155] BCS1L-NC (negative control):
[0156] C*C*T*C*T*T*A*C*C*TCAGTTA*C*A*A*T*T*T*A*T*A.
[0157] In this context, * represents thiophosphate modification.
[0158] Figure 3Figure A shows the binding sites of the antisense oligonucleotides BCS1L-ASO-2 and BCS1L-ASO-3. As shown in the figure, BCS1L-ASO-3 is inversely complementary to the 5' end sequence of intron 3 of the immature precursor mRNA of BCS1L.
[0159] BCS1L-ASO-2 is simultaneously reverse complementary to the binding sites of exon 3 and intron 3 of the immature precursor mRNA of BCS1L and the sequences flanking them.
[0160] 150 nM of the above antisense oligonucleotides were transiently transfected into ovarian cancer cell lines A2780 and HEY using jetPRIME. Cellular RNA was collected after 48 h. RNA alterations were verified using semi-quantitative PCR and real-time fluorescence PCR. Total RNA was extracted using a total RNA extraction kit (Chengdu Fuji Biotechnology Co., Ltd.). Reverse transcription was performed using HiScript IIQ SelectRT SuperMix for qPCR (Nanjing Novizan Biotechnology Co., Ltd., R232-01) at 37℃ for 15 min, followed by 85℃ for 5 s. The reversed cDNA was amplified using semi-quantitative PCR primers (as shown below) and 2×Taq Plus Master Mix (Dye Plus) (Nanjing Novizan Biotechnology Co., Ltd., P212-01). The products were imaged and photographed using 1.5% agarose gel electrophoresis at 110V for 30 min.
[0161] BCS1L-L-F5'-GCGCCATTACATGATCACAC-3'
[0162] BCS1L-L-R5'-CTTCGTTCTACCCGAATCCA-3'
[0163] BCS1L-S-F5'-AGAGTCACGGCGGTATCGGGGGAAAT-3'
[0164] BCS1L-S-R5'-GGATGTTGAAGAAAACCTTTCG-3'.
[0165] The results are as follows Figure 3 B and Figure 3 As shown in C. Transient transfection of ovarian cancer cell lines with ASO2 and ASO3 resulted in more BCS1L-S. In semi-quantitative PCR, the splicing pattern of BCS1L RNA levels was quantitatively calculated using the Percent Spliced In (PSI) index. ImageJ was used to perform grayscale analysis on the agarose gel electrophoresis images.
[0166] Splice Insertion Percentage Index (PSI) = Gray level of exon retained bands / (Gray level of exon retained bands + Gray level of exon skipped bands)
[0167] This embodiment further utilizes real-time fluorescence PCR to quantitatively detect the amplitude of the exon skipping effects of ASO2 and ASO3, such as... Figure 3 The results from DE demonstrate that ASO3 is more effective in ovarian cancer cells A2780 and HEY.
[0168] The inhibitory effect of antisense oligonucleotide ASO3 on ovarian cancer cell lines A2780 and HEY was determined using the MTT assay.
[0169] The main experimental steps of the MTT method include:
[0170] 1. Collect cells in the logarithmic growth phase, digest them with trypsin, centrifuge to collect the cells, prepare a single-cell suspension, count the cells under a microscope, and adjust the cell concentration;
[0171] 2. Prepare the cell suspension by counting the required number of cells and preparing 5 replicates per well at a rate of 5000 cells / 100μL / well;
[0172] 3. Add 100 μL of cell suspension to a 96-well plate, leaving the wells around the perimeter for adding PBS to reduce culture medium evaporation. Let stand for 30-40 minutes, then incubate in an incubator.
[0173] 4.24 h later, the corresponding antisense oligonucleotides were added to each well according to the final concentration gradient of 0, 12.5, 25, 50, 100, 200 and 400 nM. After 72 h of treatment, obvious cell apoptosis was observed and the next step was carried out.
[0174] 5. Take out the 96-well plate, add 10 μL of MTT (5 mg / mL) to each well, gently shake to mix, and then put it back into the incubator and incubate at 37°C for 4 hours.
[0175] After 6.4 hours, remove the 96-well plate, aspirate the culture medium, being careful not to disturb the formazan crystals at the bottom. Add 100 μL LDMSO to each well, shake or let stand at room temperature for 10 minutes to dissolve the precipitate.
[0176] 7. Measure the absorbance at 570 nm using an ELISA reader, and calculate cell viability and IC50 value using GraphPad 8.0.
[0177] The results are as follows Figure 3 F and Figure 3 As shown in G, the half-maximal inhibitory concentration (IC50) of ASO3 is 30.78 nM in A2780 and 22 nM in HEY.
[0178] Example 4: Antisense oligonucleotides inhibit ovarian cancer proliferation and induce apoptosis.
[0179] Taking advantage of the fact that ASO3 can regulate BCS1L alternative splicing to increase BCS1L-S expression, we will further study its effects on inducing tumor cell apoptosis and anti-tumor activity.
[0180] The cell proliferation rate after the addition of ASO3 was verified in different ovarian cancer cells or cell lines using the MTT assay and long-term live cell imaging.
[0181] The main experimental steps for determining cell proliferation rate using the MTT assay include:
[0182] 1. Collect cells in the logarithmic growth phase, digest them with trypsin, centrifuge to collect the cells, prepare a single-cell suspension, count the cells under a microscope, and adjust the cell concentration;
[0183] 2. Prepare the cell suspension by counting the required number of cells and preparing 5 replicates per well at a rate of 5000 cells / 100μL / well;
[0184] 3. Add 100 μL of cell suspension to a 96-well plate, leaving the wells around the perimeter for adding PBS to reduce culture medium evaporation. Let stand for 30-40 minutes, then incubate in an incubator.
[0185] 4. After 24 hours, antisense oligonucleotides were added to each well at a final concentration of 100 nM. At 0, 24, 48, 72, and 96 hours after incubation, 10 μL of MTT (5 mg / mL) was added to each well. The mixture was gently vortexed and returned to the incubator for 4 hours at 37°C. After 4 hours, the 96-well plate was removed, and the culture medium was aspirated, taking care not to disturb the formazan crystals at the bottom. 100 μL of DMSO was added to each well, and the plate was vortexed or left at room temperature for 10 minutes to dissolve the precipitate.
[0186] 5. Measure the absorbance at 570 nm using an ELISA reader and calculate cell viability using GraphPad 8.0.
[0187] The results are as follows Figure 4 A and Figure 4 As shown in B, the antisense oligonucleotide ASO3 significantly inhibited the proliferation rate of ovarian cancer cell lines A2780 and HEY.
[0188] The proportion of apoptotic cells was quantitatively determined using the Annexin V-PE / 7-AAD apoptosis staining kit (Nanjing Novizan Biotechnology Co., Ltd.). Specific experimental procedures are as follows:
[0189] 1. Cell collection: Collect 5 × 10⁶ cells. 5 For each adherent cell, digest the cells with trypsin without EDTA. After digestion is stopped, collect the cells, centrifuge at 1000 rpm and 4℃ for 5 min, and discard the supernatant.
[0190] 2. Washing cells: Wash cells twice with pre-cooled PBS, centrifuging at 1000 rpm and 4°C for 5 min each time, and discard the supernatant.
[0191] 3. Resuspend cells: Add 100 μL of 1×Binding Buffer and gently mix until a single-cell suspension is formed.
[0192] 4. Cell staining: Add 5 μL Annexin V-PE and 5 μL 7-AAD Staining Solution and mix well; incubate at room temperature (20-25℃) for 10 min; add 400 μL 1× Binding Buffer and mix well.
[0193] 5. Samples were analyzed by flow cytometry within 1 hour after staining: normal cells were double negative (Annexin V-PE). ﹣
[0194] / 7-AAD ﹣ Early apoptotic cells were Annexin V-PE single positive (Annexin V-PE) ﹢ / 7-AAD ﹣ Late-stage apoptotic cells were double-positive for Annexin V-PE and 7-AAD (Annexin V-PE). ﹢ / 7-AAD ﹢ ).
[0195] Experimental results are as follows Figure 4 As shown in Figure C, the antisense oligonucleotide ASO3 was found to induce an increase in the proportion of early and late apoptosis in ovarian cancer cell lines A2780 and HEY.
[0196] Example 5: Antisense oligonucleotides inhibit mitochondrial function in ovarian cancer
[0197] Based on ASO3 targeting key assembly chaperones of mitochondrial complex III, we will further investigate its impact on mitochondrial function.
[0198] The ATP content of ovarian cancer cell lines A2780 and HEY treated with antisense oligonucleotide ASO3 was determined using an enhanced ATP assay kit (Beyotime). The results are as follows: Figure 5 As shown in AB, ASO3 treatment significantly reduced the mitochondrial ATP content in ovarian cancer cells.
[0199] The specific steps for detecting ATP are as follows:
[0200] 1. Take out the reagents used in the experiment in advance and thaw them on ice. When the cell culture is terminated, collect the cells, wash them 3 times with pre-cooled PBS, discard the supernatant, add 100-200 μL of ATP lysis buffer, and lyse on ice for 10-15 min. Centrifuge at 12000g for 5 min at 4℃, transfer the supernatant to a new 1.5 mL microcentrifuge tube, and keep it on ice.
[0201] 2. Preparation of the standard curve: Dilute the ATP standard with ATP lysis buffer, setting concentration gradients of 0.01 μM, 0.03 μM, 0.1 μM, 0.3 μM, 1 μM, 3 μM, and 10 μM. After preparation, store on ice for later use.
[0202] 3. Prepare the ATP detection working solution. Prepare an appropriate amount of ATP detection working solution according to the ratio of ATP detection reagent to ATP detection reagent diluent = 1:4, and add 100 μL of ATP detection working solution to each group;
[0203] 4. ATP Concentration Determination. ATP concentration was determined using a 96-well plate specifically designed for luciferase. 100 μL of ATP working solution was added to each well, and the plate was incubated at room temperature for 5 minutes to consume all background ATP. 50 μL of standard or test sample was then added to each well, and the mixture was thoroughly mixed with a pipette (avoiding air bubbles). The RLU value was then measured using a chemiluminescence analyzer. The procedure was: wait 2 seconds; detect for 10 seconds.
[0204] 5. Plot the standard curve and calculate the ATP concentration (μM) of the sample;
[0205] 6. The protein concentration of the sample was determined using the BCA method to eliminate errors caused by differences in protein concentration during sample preparation. Finally, the ATP concentration was converted to nmol / mg.
[0206] The reactive oxygen species (ROS) levels of ovarian cancer cells after ASO3 treatment were determined using a reactive oxygen species (ROS) detection kit (Beyotime). The specific steps are as follows:
[0207] 1. Cell transfection is as described above; a positive control group must be included in the experiment. Collect cells at a specific time point.
[0208] 2. After collecting the cells, wash them once with PBS and discard the PBS. Resuspend the cells in 1 mL of preheated (37°C) staining buffer in each tube;
[0209] 3. In the positive control group, 1 μL of CCCP (final concentration 50 μM) and 1 μL of JC-1 (final concentration 2 μM) were added simultaneously. In the experimental group, 1 μL of JC-1 was added. The cells were incubated in an incubator for 20-30 min. After centrifugation at 11000 rpm for 5 min, the supernatant was discarded, and the cells were washed once with 1 mL of PBS preheated to 37℃. After centrifugation at 11000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in 500 μL of PBS.
[0210] 4. Flow cytometry analysis (FITC and PE channels), with CCCP treatment group adjusted and compensated.
[0211] The results are as follows Figure 5 As shown in CD, the ROS level of ovarian cancer cells increased significantly after ASO3 treatment.
[0212] Specific experimental steps for determining cellular oxygen consumption rate on a Seahorse XFe96 cell using a mitochondrial stress assay kit:
[0213] 1. Turn on and preheat the detection system the day before the experiment. Turn on the instrument host and controller, open the Wave software, wait for the controller to connect successfully to the instrument host, and heat up to 37℃ (the Seahorse XFe96 detection system should be turned on at least 5 hours in advance);
[0214] 2. Seedling cells. Collect cells and count them at a ratio of (5-10) × 10⁻⁶. 3 Seed cells at a density of 80 μL / well into XFe96-well plates. Leave one well at each of the four corners of the plate, adding 80 μL of cell growth medium as a background correction well. Place the plate in a clean bench and let it stand for 1 hour to allow the cells to settle naturally, thereby reducing edge effects and ensuring even cell distribution. After standing, place the plate in a 37°C, 5% CO2 incubator. The next day, the cell density should be approximately 80-90% before incubation.
[0215] 3. Hydration of the probe plate. Remove the cap and probe plate from the hydration plate and place it upside down on a clean bench (to protect the receptors on the probe plate from damage). Add 200 μL of sterile 3DW to each well of the hydration plate. Replace the cap and probe plate back onto the hydration plate, ensuring all receptors are submerged in sterile water. Incubate the entire probe plate overnight at 37°C in a CO2-free incubator.
[0216] 4. On the second day, discard the sterile water and add 200 μL of XF hydration solution to each well of the hydration plate. Place the probe plate device in a 37°C, CO2-free incubator and hydrate for 1-2 hours, while waiting for the medication to be prepared.
[0217] 5. Cell washing. Remove cells from the incubator and observe their state and density under a microscope, ensuring good adhesion, adequate confluence, and no contamination. Use a pipette to aspirate 60 μL of growth medium from all wells of the culture plate, leaving 20 μL. Then add 200 μL of test solution to all wells, aspirate another 200 μL, and repeat this process once more, leaving 20 μL of test solution in each well. Add 160 μL of test solution to all wells, bringing the final volume to 180 μL. Place the culture plate in a 37°C, CO2-free incubator and incubate for 1 hour before analysis.
[0218] 6. Prepare the drug and add it to the dosing well of the probe plate. Resuspend the drug and dilute it to prepare a working solution. Dilute and dissolve the drug according to the instructions, mix well and set aside. Dilute the prepared drug to the working concentration (10×) according to the instructions and add the diluted drug to the dosing well of the probe plate.
[0219] 7. On-machine operation and testing. First, place the probe plate and hydration plate into the instrument for calibration. After calibration, remove the hydration plate, place the cell culture plate in it, and start the energy metabolism detection phase. After the entire program is completed, remove the cell plate and probe plate, save the data, and close the program and the instrument.
[0220] Experimental results are as follows Figure 5 As shown in EF, treatment with the antisense oligonucleotide ASO3 reduced basal oxygen consumption, proton leakage levels, and reserve respiratory capacity in ovarian cancer cells.
[0221] Given that BCS1L is an important component of mitochondrial complex III, this embodiment utilizes the OROBOROS O2K cellular energy metabolism analysis system to assess the function of mitochondrial complex III. The specific steps are as follows:
[0222] 1. Instrument Preparation: Turn on the OROBOROS O2K instrument and preheat to 37°C; Calibrate the oxygen sensor: Add 2 mL of air-saturated mitochondrial breathing buffer. Use DatLab software to calibrate the oxygen sensor.
[0223] 2. Sample loading: Add the cell or mitochondrial sample to the reaction chamber and adjust the sample concentration to 1×10⁻⁶. 6 Add cells / mL and mitochondrial breathing buffer to a final volume of 2mL.
[0224] 3. Baseline measurement: After adding digoxin to rupture the membrane, the baseline oxygen consumption rate (OCR) was recorded to reflect the basal respiration of the sample.
[0225] 4. Complex III Function Assay: The following reagents were added sequentially, and OCR changes were recorded: Substrate addition included glutamate and malate, substrates for Complex I and II (this stage is the proton leakage phase of Complex I); 1-2 mM ADP, substrate for ATP synthase, was added; 10 mM succinate, substrate for Complex III, was added to stimulate electron transport in Complex III, and the maximum respiratory rate was recorded. Finally, 2.5 μM antimycin A, an inhibitor of Complex III, was added to inhibit Complex III activity, and the decrease in OCR was recorded.
[0226] 5. Data Analysis: Analyze OCR data using DatLab software, calculating baseline OCR, maximum OCR, and suppressed OCR. Compare OCR changes across different groups to assess Complex III function.
[0227] The results are as follows Figure 5 As shown in G, ASO3 inhibits the function of mitochondrial complex III in ovarian cancer cells A2780.
[0228] Example 6: In vivo experiments verify that antisense oligonucleotides inhibit the growth of ovarian cancer cells.
[0229] Using 4-8 week old female NOD SCID mice, 1x10⁻¹⁰ A2780 ovarian cancer cells were injected bilaterally into the axillae. 6 For each subcutaneous tumor, when the tumor diameter is about 3-5 mm, five nude mice of similar size on both sides are selected and injected intratumorally with antisense oligonucleotide ASO3.
[0230] Each nude mouse was injected with 5 nmol of antisense oligonucleotide at each site, diluted with 25 μL Opti-MEM and mixed with 3 μL Lipo2000, twice on days 11 and 16. Tumor size was observed and recorded every three days, and the nude mice were euthanized under anesthesia after 2-3 weeks.
[0231] The results are as follows Figure 6 As shown. Figure 6 Images A and C represent subcutaneous tumor formation in nude mice. The volume and weight of tumors after intratumoral injection of antisense oligonucleotide ASO3 and its corresponding controls were statistically analyzed. The results showed that antisense oligonucleotide ASO3 inhibited tumor growth.
[0232] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. An antisense oligonucleotide, characterized in that, The antisense oligonucleotide is: C C A C C T T ACCAGA T A A A A T G G; or C T C C C T A G C TCCCC A C C T T A C; Representative phosphorothioate modifications.
2. A pharmaceutical composition, characterized by, It includes the antisense oligonucleotide as described in claim 1, and a pharmaceutically acceptable diluent or carrier.
3. The use of the antisense oligonucleotide of claim 1 or the pharmaceutical composition of claim 2 in the preparation of an anti-ovarian cancer drug.
4. The use according to claim 3, wherein the compound is ###0002### The anti-ovarian cancer drug is administered to mammals.
5. The use according to claim 4, wherein the compound is ###0002### The mammal in question is a human.
6. The use according to claim 3, wherein the compound is ###0002### The anti-ovarian cancer drug has the following effects: Inhibit the proliferation rate of cancer cells; and / or, Inducing apoptosis in cancer cells; and / or, Reduce the ATP content in the mitochondria of cancer cells; and / or, Increase the level of reactive oxygen species in cancer cells; and / or, Reduce the basal oxygen consumption of cancer cells; and / or, Reduce proton leakage levels in cancer cells; and / or, Reduce the reserve respiratory capacity of cancer cells; and / or, Inhibits the function of mitochondrial complex III in cancer cells.