A recombinant carbonyl reductase mutant and its use in synthesis of chiral alcohol

Abstract

The application relates to the field of biotechnology and discloses a recombinant carbonyl reductase mutant and application thereof in synthesis of chiral alcohol. The application is characterized in that the wild-type carbonyl reductase is subjected to mutation of the 36th lysine into any one of aspartic acid, threonine and valine, and / or mutation of the 125th histidine into any one of lysine, serine and leucine, or mutation of the 170th histidine into any one of lysine, cysteine and leucine, so that the obtained carbonyl reductase mutant, especially the single-point mutant Mut-K36D, the mutant Mut-H125K and the combined mutant Mut-K36D-H125K, has different degrees of improvement in activity compared with the wild type, has excellent thermal stability and relative enzyme activity, and has high activity and stability for various chiral alcohols, and has the advantages of high catalytic activity, high enzyme expression amount and easy fermentation.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a recombinant carbonyl reductase mutant and its application in the synthesis of chiral alcohols. Background Technology

[0002] Chiral alcohols are a class of optically active alcohols whose molecular structures contain one or more chiral centers, preventing the molecule from overlapping with its mirror image. Chiral alcohols have wide applications in the asymmetric synthesis of pharmaceuticals, pesticides, fragrances, flavorings, and natural products. Carbonyl reductase-mediated biocatalytic asymmetric reduction reactions are an important pathway for the synthesis of chiral alcohols.

[0003] Carbonyl reductase (CaRbonyl ReductaSe, EC1.1.1.148), a member of the oxidoreductase family, uses the coenzyme NADPH (nicotinamide adenine dinucleotide phosphate) as a hydrogen donor to catalyze the conversion of a series of prochiral ketones or aldehydes into their corresponding secondary alcohols. Under the condition of hydrogen donation from the coenzyme, carbonyl reductase can catalyze the asymmetric reduction of a series of carbonyl compounds. Its catalytic mechanism is as follows: the carbonyl reductase first binds to the coenzyme to form a complex, then collides with the substrate, transferring hydrogen from the coenzyme to the carbonyl group of the oxidizing substrate to form the corresponding chiral alcohol. Simultaneously, the coenzyme NAD(P)H is oxidized to NAD(P)+, and finally the product is released from the enzyme-coenzyme complex, completing the catalytic process. The coenzyme NAD(P)H attacks the carbonyl carbon from different directions, resulting in products with different stereoconfigurations. When the [H] at the C4 position of the NAD(P)H nicotinamide ring attacks the substrate carbonyl carbon from the Re-face, it follows the PRelog rule, producing an S-type product; while when the [H] attacks the substrate carbonyl carbon from the Si-face, it follows the anti-PRelog rule, producing an R-type product. Most carbonyl reductase-catalyzed reactions follow the PRelog rule.

[0004] VibegRon (6S)-N-[4-({(2S,5R)-5-[(R)-HydRoxy(phenyl)methyl]pyRRolidin-2-yl}methyl)phenyl]-4-oxo-4,6,7,8-tetRahydRopyRRolo[1,2-a]pyRimidine-6-caRboxamide) is the first β3-adrenergic receptor agonist (β3-AR agonist) drug used to treat overactive bladder (OAB). (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoate (methyl(2S,3R)-2-((teRt-butoxycaRbonyl)amino)-3-hydRoxy-3-phenylpRopanoate, (2S,3R)-aminohydroxy ester) is a key chiral intermediate in the synthesis of veberon. In existing technologies, studies have constructed a coupling system between NADPH-dependent carbonyl reductase KRED and glucose dehydrogenase GDH. Methyl(S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropanoate ((S)-amino ketone ester) is asymmetricly reduced to the product (2S,3R)-aminohydroxy ester. The substrate concentration is 85 g / L, the co-substrate glucose concentration is 70 g / L, and after 4 h of reaction, the product yield is >95.0%, and ee >99.9%. However, this enzymatic method for catalyzing asymmetric reduction reactions to synthesize chiral alcohols has a low yield.

[0005] Florfenicol is a widely used veterinary chloramphenicol antibiotic. (2S,3R)-p-methylsulfonylbenzylserine ethyl ester (D-ethyl ester) and its analogues, as key precursors for the synthesis of florfenicol, contain adjacent bichiral centers, making their synthesis challenging. Currently, industrial production of D-ethyl ester both domestically and internationally mainly employs aldol condensation and L-(+)-tartaric acid resolution. This method generates copper ammonia wastewater and copper sulfide solid waste, and the chiral resolution yield is only 41%, resulting in poor atom economy and high production costs. An asymmetric synthesis of D-ethyl ester and its analogues using carbonyl reductase dynamic reduction kinetics resolution of p-methylsulfonylphenyl-α-amino-β-keto ester substrates can overcome the shortcomings of traditional routes.

[0006] Additionally, the key chiral intermediate (S)-3-hydroxy-3-(2-thiophenyl)propionate ethyl ester (Ethyl(S)-3-hydRoxy-3-(thiophen-2-yl)pRopanoate, (S)-HEES), a 5-hydroxytryptamine-norepinephrine re-extraction inhibitor, and the key chiral intermediate (3R,5S) of rosuvastatin, a selective HMG-CoA reductase inhibitor, are also important chiral intermediates. The asymmetric synthesis of (3R,5S)-CDHH catalyzed by carbonyl reductase, including tert-butyl(3R,5S)-6-chloro-3,5-dihydroxyhexanoate (tert-butyl(3R,5S)-6-cyano-3,5-dihydroxyhexanoate), a key chiral intermediate of the lipid-lowering drug atorvastatin, is a significant challenge in the green biomanufacturing of pharmaceutical chemicals. Currently, the yields of these key chiral intermediates synthesized by carbonyl reductase-mediated biocatalytic asymmetric reduction reactions are low. Carbonyl reductase (WT) is a multifunctional biocatalyst with a broad substrate activity spectrum, but its low thermal stability limits its applications. Summary of the Invention

[0007] To address the technical problem of low yield in the synthesis of chiral alcohols mediated by carbonyl reductase, this invention provides a recombinant carbonyl reductase mutant and its application in the synthesis of chiral alcohols.

[0008] The specific technical solution of this invention is as follows:

[0009] In a first aspect, the present invention provides a recombinant carbonyl reductase mutant, obtained by performing single-point or multi-point combination mutations at the following sites on the amino acid sequence shown in SEQ ID NO.2:

[0010] The lysine at position 36 is mutated to any one of aspartic acid, threonine, or valine.

[0011] The histidine at position 125 is mutated to any one of lysine, serine, or leucine.

[0012] The histidine at position 170 is mutated to any one of lysine, cysteine, or leucine.

[0013] Secondly, the present invention provides the encoding gene of the above-mentioned carbonyl reductase mutant.

[0014] Thirdly, the present invention provides an expression vector containing the above-mentioned coding gene.

[0015] Preferably, the expression vector is a plasmid, bacteriophage, or viral vector.

[0016] Fourthly, the present invention provides a cloning vector for the above-mentioned encoded gene.

[0017] Fifthly, the present invention provides the above-mentioned carbonyl reductase mutant or the host cell for the above-mentioned encoding gene.

[0018] Preferably, the cells are Escherichia coli.

[0019] In a sixth aspect, the present invention provides the application of the above-mentioned carbonyl reductase mutant in the synthesis of chiral alcohols.

[0020] Using a prochiral ketone as a substrate, and with wet bacterial cells obtained by fermentation culture of genetically engineered bacteria containing the above-mentioned recombinant carbonyl reductase mutant encoding gene, or with crude or pure enzyme obtained by ultrasonic disruption of the wet bacterial cells as a catalyst, the corresponding chiral alcohol can be prepared by biocatalysis.

[0021] Preferably, the chiral alcohol is a duloxetine intermediate, florfenicol intermediate, rosuvastatin intermediate, atorvastatin intermediate, or veberon intermediate. That is, the corresponding prochiral ketone may include: methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionate, methyl 2-acetamido-3-(4-(methanesulfonyl)phenyl)-3-oxopropionate, ethyl 3-oxo-3-(2-thienyl)propionate, tert-butyl (S)-6-chloro-5-hydroxy-3-carbonylhexanoate ((S)-CHOH), or tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate.

[0022] More specifically:

[0023] The application includes: using the wet cell or crude enzyme solution after crushing the wet cell or pure enzyme extracted from the crushed wet cell obtained by fermentation culture of genetically engineered bacteria containing a novel carbonyl reductase mutant gene as a catalyst, and using methyl 2-acetamido-3-(4-(methanesulfonyl)phenyl)-3-oxopropionate as a catalyst to prepare methyl (2S,3R)-2-acetamido-3-hydroxy-3-(4-(methanesulfonyl)phenyl)propionate, which is a key chiral intermediate in the synthesis of the drug florfenicol.

[0024] The application includes: using wet bacterial cells obtained by fermentation culture of genetically engineered bacteria containing a novel carbonyl reductase mutant encoding gene, or crude enzyme solution obtained from the crushing of wet bacterial cells, or pure enzyme extracted from the crushing of wet bacterial cells as a catalyst, and using ethyl 3-oxo-2-(3-thienyl)propionate (KEES) as a substrate, to biocatalyze the preparation of ethyl (S)-3-hydroxy-3-(2-thienyl)propionate ((S)-HEES). (S)-HEES is a key chiral intermediate in the synthesis of the drug (S)-duloxetine.

[0025] The application includes: using wet bacterial cells obtained by fermentation culture of genetically engineered bacteria containing a novel carbonyl reductase mutant encoding gene, or crude enzyme solution obtained from the crushing of wet bacterial cells, or pure enzyme extracted from the crushing of wet bacterial cells as a catalyst, and using (S)-6-chloro-5-hydroxy-3-hydroxyhexanoate tert-butyl ester ((S)-CHOH) as a substrate, to biocatalyze the preparation of (3R,5S)-6-chloro-3,5-dihydroxyhexanoate tert-butyl ester ((3R,5S)-CDHH). (3R,5S)-CDHH is a key chiral intermediate in the synthesis of the drug rosuvastatin.

[0026] The application includes: using wet bacterial cells (or crude enzyme solution after wet cell disruption) or pure enzyme extracted from the disruption of wet bacterial cells obtained through fermentation culture of genetically engineered bacteria containing a novel carbonyl reductase mutant gene as a catalyst, and using tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate as a substrate, to biocatalyze the preparation of (3R,5R)-6-cyano-3,5-dihydroxyhexanoate tert-butyl ester. This is a key chiral intermediate in the synthesis of the drug atorvastatin.

[0027] The application includes: using the wet cell or crude enzyme solution obtained by fermentation culture of genetically engineered bacteria containing a novel carbonyl reductase mutant encoding gene, or the pure enzyme extracted after the wet cell is crushed, as a catalyst, and using methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionate ((S)-aminoketone ester) as a substrate, to biocatalyze the preparation of methyl (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionate ((2S,3R)-aminohydroxy ester), where (2S,3R)-aminohydroxy ester is a key chiral intermediate in the synthesis of viberon.

[0028] Compared with the prior art, the present invention has the following technical effects:

[0029] This invention generates carbonyl reductase mutants with varying degrees of activity enhancement compared to the wild type by mutating the amino acid sequence shown in SEQ ID NO.2 by altering the 36th lysine to any one of aspartic acid, threonine, or valine, or / and the 125th histidine to any one of lysine, serine, or leucine, or the 170th histidine to any one of lysine, cysteine, or leucine. In particular, the single-point mutants Mut-K36D and Mut-H125K, as well as the combined mutant Mut-K36D-H125K, exhibit excellent thermal stability and relative enzyme activity. They also show high activity and stability against a variety of chiral alcohols, and possess advantages such as high catalytic activity, high enzyme expression, and ease of fermentation. Attached Figure Description

[0030] Figure 1The image shows an SDS-PAGE image of carbonyl reductase and its mutants. Lane M represents the molecular weight of the protein, lane 1 represents the pure carbonyl reductase from the original strain WT, lane 2 represents the pure Mut-K36D enzyme, lane 3 represents the pure Mut-H125K enzyme, lane 4 represents the pure Mut-H170K enzyme, and lane 5 represents the pure Mut-K36D-H125K enzyme. Detailed Implementation

[0031] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0032] In this embodiment of the invention, the amino acid sequence of the wild-type carbonyl reductase is shown in SEQ ID NO.2, and its encoding gene is shown in SEQ ID NO.1.

[0033] Example 1 Construction of carbonyl reductase mutant

[0034] (1) The wild-type carbonyl reductase encoding gene shown in SEQ ID NO.1 was linked to the expression vector pET28b to construct a heterologous expression recombinant plasmid pET28b(+)-WT containing the carbonyl reductase encoding gene. The expression recombinant plasmid was transformed into the host bacterium E.coli BL21(DE3) competent cells to obtain the recombinant genetically engineered bacterium E.coli BL21(DE3) / pET28b(+)-WT containing the carbonyl reductase expression recombinant plasmid, i.e., carbonyl reductase engineered bacterium.

[0035] The engineered carbonyl reductase strain *E. coli* BL21(DE3) / pET28b(+)-WT was thawed on ice, and the bacterial culture was streaked onto kanamycin-resistant LB agar plates and incubated at 37°C for 12 h. A single colony was picked and inoculated into a 10 mL LB tube with a final kanamycin concentration of 50 mg / L, and cultured at 37°C with shaking at 180 rpm for 7 h. 2 mL of the bacterial culture from the tube was then inoculated into a 100 mL LB shake flask with a final kanamycin concentration of 50 mg / L, and cultured at 37°C with shaking at 180 rpm for 2 h. 100 μL of 0.1 M IPTG was added, and the culture was incubated at 28°C with shaking at 180 rpm for 12 h. The cells were collected by centrifugation at 4°C and 8000 rpm for 15 min and stored at -20°C for later use.

[0036] (2) Using the prepared heterologous expression recombinant plasmid pET28b(+)-WT as a template, mutations were introduced by PCR using the site-directed mutagenesis primers shown in Table 1 below. In Table 1, the underlined locations in the primer sequences indicate the mutation sites. Primers K36-R and K36D-F were used in the PCR to mutate lysine at position 36 of the wild-type enzyme to aspartic acid; primers K36-R and K36T-F were used in the PCR to mutate lysine at position 36 of the wild-type enzyme to threonine; primers K36-R and K36V-F were used in the PCR to mutate lysine at position 36 of the wild-type enzyme to valine; primers H125-R and H125K-F were used in the PCR to mutate histidine at position 125 of the wild-type enzyme to lysine; and primers H125-R and H125K-F were used in the PCR to mutate histidine at position 125 of the wild-type enzyme to lysine. S-F were used in PCR to mutate histidine at position 125 of the wild-type enzyme to serine; H125-R and H125L-F were used in PCR to mutate histidine at position 125 of the wild-type enzyme to leucine; H170-R and H170K-F were used in PCR to mutate histidine at position 170 of the wild-type enzyme to lysine; H170-R and H170C-F were used in PCR to mutate histidine at position 170 of the wild-type enzyme to cysteine; and H170-R and H170L-F were used in PCR to mutate histidine at position 170 of the wild-type enzyme to leucine.

[0037] Table 1

[0038] Primers Sequence 5′-3′ K36D-F <![CDATA[CCGGCGCACC GAC GAACTGGAAAGCCTGC]]> K36T-F <![CDATA[CCGGCGCACC ACA GAACTGGAAAGCCTGC]]> K36V-F <![CDATA[CCGGCGCACC GTA GAACTGGAAAGCCTGC]]> K36-R GGTGCGCCGGGCCACCAGAACCAG H125K-F <![CDATA[GCGATTAC AAA GATGTTGAAGGTGC]]> H125S-F <![CDATA[GCGATTAC AGC GATGTTGAAGGTGC]]> H125L-F <![CDATA[GCGATTAC CTA GATGTTGAAGGTGC]]> H125-R TAATCGCGCACATACAGTGAGCTC H170K-F <![CDATA[AGCTGATT AAA AATGATGCGAAACTGAGAG]]> H170C-F <![CDATA[AGCTGATT TGC AATGATGCGAAACTGAGAG]]> H170L-F <![CDATA[AGCTGATT CTA AATGATGCGAAACTGAGAG]]> H170-R AATCAGCTCCTGCGCTAAGCCCT

[0039] The PCR reaction procedure for introducing mutations via PCR is as follows: 98℃ for 10 min, 98℃ for 30 s, 56℃ for 30 s, 72℃ for 3 min 40 s, repeated for 31 cycles; extension at 72℃ for 5 min.

[0040] The PCR products were treated with DpnI at 37℃ for 3 h to inactivate them, and then transformed into E. coli BL21(DE3) recipient bacteria. The products were plated on LB solid plates containing a final concentration of 50 mg / L kanamycin and cultured at 37℃ for 12 h. Single colonies were randomly selected for sequencing analysis to confirm the results, and each carbonyl reductase mutant and its wet cells were obtained.

[0041] Among them, the mutant enzyme with lysine at position 36 of the wild-type enzyme mutated to aspartic acid is designated Mut-K36D; the mutant enzyme with lysine at position 36 of the wild-type enzyme mutated to threonine is designated Mut-K36T; the mutant enzyme with lysine at position 36 of the wild-type enzyme mutated to valine is designated Mut-K36V; the mutant enzyme with histidine at position 125 of the wild-type enzyme mutated to lysine is designated Mut-H125K; and the mutant enzyme with histidine at position 125 of the wild-type enzyme mutated to serine is designated Mut-H125K. The mutant enzyme is denoted as Mut-H125S, the mutant enzyme with histidine at position 125 of the wild-type enzyme mutated to leucine is denoted as Mut-H125L, the mutant enzyme with histidine at position 170 of the wild-type enzyme mutated to lysine is denoted as Mut-H170K, the mutant enzyme with histidine at position 170 of the wild-type enzyme mutated to cysteine ​​is denoted as Mut-H170C, and the mutant enzyme with histidine at position 170 of the wild-type enzyme mutated to leucine is denoted as Mut-H170L.

[0042] (3) Using plasmid DNA containing the Mut-K36D gene as a template, mutations were introduced by PCR. The following are the combination of mutation primers (the underlined positions are the mutation sites):

[0043]

[0044] The PCR reaction procedure for introducing the mutation via PCR is the same as in step (2), yielding the recombinant carbonyl reductase mutant Mut-K36D-H125K and its wet cells. The nucleotide sequence of the mutant Mut-K36D-H125K is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4.

[0045] (4) Using plasmid DNA containing the Mut-K36D gene as a template, mutations were introduced by PCR. The following are the combination of mutation primers (the underlined positions are the mutation sites):

[0046]

[0047] The PCR reaction procedure for introducing mutations by PCR is the same as step (2), and the recombinant carbonyl reductase combined mutant Mut-K36D-H170K and its wet cells are obtained.

[0048] (5) Using plasmid DNA containing the Mut-H125K gene as a template, mutations were introduced by PCR. The following combination of mutation primers was used (the underlined positions are the mutation sites):

[0049]

[0050] The PCR reaction procedure for introducing mutations by PCR is the same as step (2), and the recombinant carbonyl reductase combined mutant Mut-H125K-H170K and its wet cells are obtained.

[0051] like Figure 1 The image shown is an SDS-PAGE image of the above-mentioned wild-type carbonyl reductase and its mutants.

[0052] Example 2: Screening for the optimal carbonyl reductase mutant

[0053] The carbonyl reductase mutant obtained in Example 1 was analyzed by measuring the residual enzyme activity. The mutant was incubated at 35°C for 24 hours and at 50°C for 1 hour, respectively, and the residual enzyme activity was measured to determine the optimal mutant. The steps are as follows:

[0054] (1) Preparation of crude enzyme solution: The strain containing the carbonyl reductase mutant encoding gene obtained in Example 1 was inoculated into LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance and cultured at 37°C and 180 rpm for 7 h. Then, it was inoculated into fresh LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance at a volume concentration of 2% and cultured at 37°C and 180 rpm for 2 h. 100 μL of 0.1 M IPTG was added and the culture was induced at 28°C and 180 rpm for 12 h. After centrifugation at 4°C and 8000 rpm for 15 min, the supernatant was discarded and the wet bacterial cells were collected. 125 mg of the wet bacterial cells of the mutant was weighed and resuspended in 10 mL of sodium phosphate buffer. The cells were sonicated at 4°C on ice until the bacterial solution was clear (220 W, 1 s, 2 s). Each crude enzyme solution was incubated at 35°C for 24 h and at 50°C for 1 h, respectively.

[0055] (2) 500 μL reaction system: 150 μL NADP + 50 μL of glucose, 50 μL of crude enzyme solution incubated at 35℃ for 24 h, 100 μL of substrate (S)-amino ketone ester stock solution, and sodium phosphate buffer were added to bring the total volume to 500 μL. The mixture was shaken at 1100 rpm and reacted in a shaking reactor at 35℃. Samples were taken immediately after 10 min of reaction. The concentration of substrate (S)-amino ketone ester in the stock solution was 50 g / L (solvent: dimethyl sulfoxide), the concentration of co-substrate glucose in the stock solution was 180 g / L (solvent: sodium phosphate buffer), and the concentration of coenzyme NADP in the stock solution was... + The concentration was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC and the relative enzyme activity was calculated. The initial enzyme activity of each mutant was set as 100%, and the remaining enzyme activity after a certain incubation time is shown in Table 2.

[0056] (3) 500 μL reaction system: 150 μL NADP +50 μL of glucose, 50 μL of crude enzyme solution incubated at 50 °C for 1 h, 100 μL of substrate (S)-amino ketone ester stock solution, and sodium phosphate buffer were added to bring the volume to 500 μL. The mixture was shaken at 1100 rpm and reacted in a shaking reactor at 50 °C. Samples were taken immediately after 10 min of reaction. The concentration of substrate (S)-amino ketone ester in the stock solution was 50 g / L (solvent: dimethyl sulfoxide), the concentration of glucose as the co-substrate in the stock solution was 180 g / L (solvent: sodium phosphate buffer), and the concentration of coenzyme NADP in the stock solution was... + The concentration was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC and the relative enzyme activity was calculated. The initial enzyme activity of each mutant was set as 100%, and the remaining enzyme activity after a certain incubation time is shown in Table 2.

[0057] Table 2 Comparison of Residual Enzyme Activity

[0058] enzymes Remaining enzyme activity (%) after incubation at 35℃ for 24 hours Remaining enzyme activity (%) after incubation at 50℃ for 1 hour wild type 37.60 1.19 Mut-K36D 77.29 11.86 Mut-K36T 59.56 7.88 Mut-K36V 63.21 8.59 Mut-H125K 48.68 6.89 Mut-H125S 39.65 1.59 Mut-H125L 40.58 2.65 Mut-H170K 41.53 3.56 Mut-H170C 42.68 3.86 Mut-H170L 39.16 1.25 Mut-K36D-H170K 44.44 5.23 Mut-H125K-H170K 40.01 1.89 Mut-K36D-H125K 83.68 25.06

[0059] As shown in Table 2, the results of the residual enzyme activity determination indicate that Example 1 improved the stability of carbonyl reductase through site-directed mutagenesis. The optimal mutant for a single mutant was Mut-K36D, and the optimal mutant obtained after combining mutations at different mutation sites was Mut-K36D-H125K.

[0060] As shown in Table 2, the carbonyl reductase mutants Mut-K36D and Mut-K36D-H125K not only showed improved catalytic activity, but also enhanced thermal stability.

[0061] Example 3: Determination of the relative enzyme activity of carbonyl reductase mutants

[0062] The relative enzyme activity of the carbonyl reductase mutant obtained in Example 1 was determined. The steps are as follows:

[0063] (1) Preparation of crude enzyme solution: The method is the same as in Example 2.

[0064] (2) 500 μL reaction system: 150 μL NADP + 50 μL of glucose, 50 μL of crude enzyme solution incubated at 35℃ for 24 h, 100 μL of substrate (S)-amino ketone ester stock solution, and sodium phosphate buffer were added to bring the total volume to 500 μL. The mixture was shaken at 1100 rpm and reacted in a shaking reactor at 35℃. Samples were taken immediately after 10 min of reaction. The concentration of substrate (S)-amino ketone ester in the stock solution was 50 g / L (solvent: dimethyl sulfoxide), the concentration of co-substrate glucose in the stock solution was 180 g / L (solvent: sodium phosphate buffer), and the concentration of coenzyme NADP in the stock solution was... +The concentration was 1 g / L (solvent was sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC and the relative enzyme activity was calculated. The results are shown in Table 3.

[0065] Table 3 Comparison of relative enzyme activities

[0066] enzymes Relative enzyme activity (100%) wild type 100.00 Mut-K36D 115.56 Mut-K36T 106.56 Mut-K36V 108.45 Mut-H125K 102.65 Mut-H125S 97.58 Mut-H125L 95.89 Mut-H170K 102.65 Mut-H170C 59.65 Mut-H170L 69.16 Mut-K36D-H170K 101.23 Mut-H125K-H170K 105.69 Mut-K36D-H125K 119.55

[0067] As shown in Table 3, the relative enzyme activity determination results indicate that Example 1 improved the stability of carbonyl reductase through site-directed mutagenesis. The optimal mutant for a single mutant was Mut-K36D, and the optimal mutant obtained by combining different mutation sites was Mut-K36D-H125K.

[0068] Example 4: Application of carbonyl reductase mutant in the preparation of florfenicol intermediates

[0069] The single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K, which exhibit superior thermal stability, were selected for the preparation of florfenicol intermediates. The specific steps are as follows:

[0070] The composition and catalytic conditions of the catalytic system are as follows: In a 20 mL reaction system, add 100 mM sodium phosphate buffer solution (pH 7.0), DMSO (20%) as a co-solvent, crude carbonyl reductase solution (20 g / L, prepared in the same way as in Example 2), glucose dehydrogenase (10 g / L), 200 mM glucose, and NADP. + 2 g / L, substrate methyl 2-acetamido-3-(4-(methanesulfonyl)phenyl)-3-oxopropionate 100 g / L, and bring to a final volume of 20 mL with sodium phosphate buffer.

[0071] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm for 24 hours. Samples were taken periodically during the reaction, with a sample volume of 200 μL. After separation and purification, the samples were diluted 100-fold with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0072] The results showed that after 24 h of catalysis, the yield of methyl (2S,3R)-2-acetamido-3-hydroxy-3-(4-(methanesulfonyl)phenyl)propionate produced by WT catalysis reached 77.5%, with ee>99%; Mut-K36D reached 91.4%, with ee>99%; Mut-H125K reached 90.8%, with ee>99%; and Mut-K36D-H125K reached 99.5%, with ee>99%.

[0073] Example 5: Application of carbonyl reductase mutant in the preparation of duloxetine intermediates

[0074] The single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K, which exhibit superior thermal stability, were selected for the preparation of duloxetine intermediates. The specific steps are as follows:

[0075] The composition and catalytic conditions of the catalytic system are as follows: 20 mL reaction system: 20 g / L crude enzyme solution (preparation method is the same as in Example 2), 150 g / L substrate KEES, 20% co-solvent DMSO, 10 g / L glucose dehydrogenase, 100 mM glucose co-substrate (solvent is sodium phosphate buffer), and coenzyme NADP. + The concentration is 3 g / L (solvent is sodium phosphate buffer). Bring the volume to 20 mL using sodium phosphate buffer.

[0076] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm for 24 hours. Samples were taken at regular intervals, with a sample volume of 200 μL. After separation and purification, the samples were diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0077] The results showed that after 24 h of catalysis, the yield of (S)-HEES produced by WT catalysis reached 83.5%, ee>99%; Mut-K36D reached 92.8%, ee>99%; Mut-H125K reached 93.7%, ee>99%; and Mut-K36D-H125K reached 99.7%, ee>99%.

[0078] Example 6: Application of Carbonyl Reductase Mutants in the Preparation of Rosuvastatin Intermediates. Single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K, exhibiting superior thermal stability, were selected for the preparation of rosuvastatin intermediates. The specific steps are as follows:

[0079] The composition and catalytic conditions of the catalytic system are as follows: 20 mL reaction system: 20 g / L crude enzyme solution (prepared in the same way as in Example 2), 150 g / L substrate (S)-CHOH, 100 mM glucose co-substrate (solvent is sodium phosphate buffer), glucose dehydrogenase (10 g / L), and coenzyme NADP. + The concentration is 3 g / L (solvent is sodium phosphate buffer). Bring the volume to 20 mL using sodium phosphate buffer.

[0080] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm for 24 hours. Samples were taken at regular intervals, with a sample volume of 200 μL. After separation and purification, the sample was diluted 40 times with 30% acetonitrile, and the conversion rate was determined by HPLC analysis.

[0081] The results showed that after 24 h of catalysis, the yield of (3R,5S)-CDHH produced by WT catalysis reached 87.1% (ee>99%), Mut-K36D reached 97.6% (ee>99%), Mut-H125K reached 93.1% (ee>99%), and Mut-K36D-H125K reached 99.8% (ee>99%).

[0082] Example 7: Application of Carbonyl Reductase Mutants in the Preparation of Atorvastatin Intermediates. Single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K, exhibiting superior thermal stability, were selected for the preparation of atorvastatin intermediates. The specific steps are as follows:

[0083] The composition and catalytic conditions of the catalytic system are as follows: 20 mL reaction system: 20 g / L crude enzyme solution (preparation method is the same as in Example 2), 150 g / L substrate tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate, 100 mM glucose co-substrate (solvent is sodium phosphate buffer), glucose dehydrogenase (10 g / L), and coenzyme NADP. + The concentration is 3 g / L (solvent is sodium phosphate buffer). Bring the volume to 20 mL using sodium phosphate buffer.

[0084] The reaction system was placed in a 35℃ water bath with a magnetic stirrer at 600 rpm for 24 hours. Samples were taken periodically in 200 μL volumes, purified, and diluted 100-fold with acetonitrile. The conversion rate was determined by HPLC. The results showed that after 24 hours of catalysis, the yield of tert-butyl 5-dihydroxyhexanoate produced by (3R,5R)-6-cyano-3,WT catalysis reached 81.2% (ee > 99%); Mut-K36D reached 90.6% (ee > 99%); Mut-H125K reached 88.8% (ee > 99%); and Mut-K36D-H125K reached 99.5% (ee > 99%).

[0085] Example 8: Application of carbonyl reductase mutant in the preparation of viberon intermediates

[0086] The single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K, which exhibit superior thermal stability, were selected for the preparation of viberon intermediates. The specific steps are as follows:

[0087] The composition and catalytic conditions of the catalytic system are as follows: For a 20 mL reaction system: Dissolve the substrate (S)-amino ketone ester in 10 mL of n-butyl acetate (final concentration 100 g / L), add 1 mL of 0.1 mM, pH 6.5 NaH₂PO₄-Na₂HPO₄ buffer solution, add crude enzyme solution (final concentration 20 g / L, prepared in the same way as in Example 2), add 2 mL of crude glucose dehydrogenase solution (final concentration 10 g / L), add 100 mg of coenzyme NADPH, and add 2.63 g of co-substrate glucose. Bring the total volume to 20 mL using sodium phosphate buffer.

[0088] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm. Samples were taken at regular intervals, with a sample volume of 200 μL. After separation and purification, the sample was diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0089] The results showed that after 24 h of catalysis, the yield of (2S,3R)-aminohydroxy ester produced by WT catalysis reached 89.2%, with ee>99%; Mut-K36D reached 98.6%, with ee>99%; Mut-H125K reached 98.8%, with ee>99%; and Mut-K36D-H125K reached 99.8%, with ee>99%.

[0090] Example 9: Effect of Fed-Feed Process on the Preparation of Viberon Intermediates from Carbonyl Reductase Mutants. Single-point mutants Mut-K36D, Mut-H125K, and the combined mutant Mut-K36D-H125K, exhibiting superior thermal stability, were selected for use in the fed-feed process to prepare viberon intermediates. The specific steps are as follows:

[0091] (1) 20 mL reaction system: Dissolve the substrate (S)-amino ketone ester in 10 mL of n-butyl acetate (final concentration 80 g / L), add 1 mL of 0.1 mM, pH 6.5 NaH2PO4-Na2HPO4 buffer solution, add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 100 mg of coenzyme NADPH, and add 2.63 g of cosubstrate glucose. Make up to 20 mL with sodium phosphate buffer.

[0092] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm. After 8 hours, 1.4 g of substrate was added (the total substrate concentration after addition was 150 g / L). Samples were taken at regular intervals, with a sample volume of 200 μL. After separation and purification, the sample was diluted 150 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0093] The results showed that after 24 h of catalysis, the yield of (2S,3R)-aminohydroxy ester produced by WT catalysis reached 92.1%, ee>99%; Mut-K36D reached 97.6%, ee>99%; Mut-H125K reached 95.8%, ee>99%; and Mut-K36D-H125K reached 99.8%, ee>99%.

[0094] (2) 500 mL reaction system: Dissolve the substrate (S)-amino ketone ester in 10 mL of n-butyl acetate (final concentration of (S)-amino ketone ester is 80 g / L), add crude enzyme solution (final concentration is 20 g / L), add glucose dehydrogenase (final concentration is 10 g / L), add 3.0 g of coenzyme NADPH, and add 35.5 g of cosubstrate glucose. Make up to 500 mL with sodium phosphate buffer.

[0095] The reaction system was placed in a 35°C water bath with the stirring device set to 600 rpm. After 8 hours, 35 g of substrate was added as feed (the total substrate concentration after feeding was 150 g / L). Samples were taken at regular intervals, with a sample volume of 200 μL. After separation and purification, the sample was diluted 150 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0096] The results showed that after 24 hours of catalysis, the yield of (2S,3R)-aminohydroxy ester produced by WT catalysis reached 90.2% (ee>99%), Mut-K36D reached 97.8% (ee>99%), Mut-H125K reached 96.6% (ee>99%), and Mut-K36D-H125K reached 99.9% (ee>99%). Compared with the non-feeding process, the fed-feeding process further improved the production efficiency.

[0097] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0098] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A recombinant carbonyl reductase mutant, characterized in that: It is obtained by performing any of the following mutations on the amino acid sequence shown in SEQ ID NO.2: The lysine at position 36 is mutated to aspartic acid; Alternatively, the lysine at position 36 may be mutated to aspartic acid and the histidine at position 125 may be mutated to lysine.

2. The encoding gene of the carbonyl reductase mutant as described in claim 1.

3. An expression vector comprising the encoding gene of claim 2.

4. The expression vector as described in claim 3, characterized in that: The expression vector is a plasmid, bacteriophage, or viral vector.

5. A host cell comprising the encoding gene of claim 2.

6. The host cell as described in claim 5, characterized in that: The cells were Escherichia coli.

7. The application of the carbonyl reductase mutant as described in claim 1 in the synthesis of chiral alcohols, characterized in that: The synthesized chiral alcohol is: Methyl (2S,3R)-2-acetamido-3-hydroxy-3-(4-(methanesulfonyl)phenyl)-3-oxopropionate was synthesized using methyl 2-acetamido-3-(4-(methanesulfonyl)phenyl)-3-oxopropionate as a substrate. (S)-3-hydroxy-3-(2-thienyl)propionate ethyl ester was synthesized using 3-oxo-2-(3-thienyl)propionate ethyl ester as a substrate. (3R,5S)-CDHH was synthesized using (S)-CHOH as a substrate. Using tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate as a substrate, tert-butyl (3R,5R)-6-cyano-3,5-dihydroxyhexanoate was synthesized. Alternatively, (2S,3R)-aminohydroxy esters can be synthesized using (S)-amino ketone esters as substrates.

Images