An engineered bacterium for producing cytidine diphosphate-choline and a construction method and application thereof

By blocking the choline transformation pathway in Bacillus subtilis, overexpressing opuD and knocking out the opcR and gbsR genes, an engineered strain was constructed, solving the problem of low cytidine diphosphate choline production in existing technologies and achieving high-efficiency production.

CN120574757BActive Publication Date: 2025-11-18SHANDONG UNIV OF TECH +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511084778.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-04
Publication Date
2025-11-18
Estimated Expiration
2045-08-04

AI Technical Summary

Technical Problem

In existing technologies, the production of citicoline using Pichia pastoris and Escherichia coli has problems such as long fermentation cycle, need for the addition of expensive exogenous substances, and the secretion of products into the extracellular space and endotoxins, which make it difficult to meet the needs of industrialization. Bacillus subtilis does not have a complete citicoline synthesis pathway naturally, and the yield of shake flask fermentation is low.

Method used

By blocking the conversion of choline to glycine betaine in Bacillus subtilis, overexpressing opuD and knocking out opcR and gbsR genes, an engineered strain was constructed to optimize the choline absorption and conversion pathway and increase the production of cytidine diphosphate choline.

Benefits of technology

It significantly increased the fermentation yield of cytidine diphosphate choline, reaching more than 6 times that of the original patent, solving the problem of low yield in existing technologies and achieving high-efficiency production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120574757B_ABST
    Figure CN120574757B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of bioengineering, and particularly relates to an engineered bacterium for producing cytidine diphosphate choline as well as a construction method and application thereof. The present application takes Bacillus subtilis BSC1-4 as a starting bacterium, blocks the conversion of choline to glycine betaine to reduce unnecessary loss of substrates in the fermentation process, improves the absorption of choline, and enables the substrates to continuously generate cytidine diphosphate choline in the direction of generating cytidine diphosphate choline. The construction method of the engineered bacterium is specifically as follows: the key genes of the choline degradation pathway in the genome of Bacillus subtilis are knocked out gbsA and gbsB , the transporter protein OpuD is overexpressed, and finally the transcriptional repressor genes opcR and gbsR are knocked out. Experimental results show that the engineered bacterium constructed in the present application has a cytidine diphosphate choline yield of 1181.6±11.5 mg / L after 24 h of fermentation in a shake flask.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to an engineered bacterium that produces cytidine diphosphate choline, its construction method, and its application. Background Technology

[0002] Citicoline, a precursor to the synthetic neurotransmitter acetylcholine, has shown significant efficacy in improving cognitive function, protecting neurons from damage, and reducing neuroinflammation. It is widely used in the treatment of various neurological diseases, including stroke, traumatic brain injury, and Alzheimer's disease.

[0003] Currently, the production of citicoline using microbial fermentation shows great potential due to its environmental friendliness, simplified process, and low cost.

[0004] In the field of microbial fermentation, studies have already utilized Pichia pastoris ( Pichia pastoris ) and Escherichia coli ( Escherichia coli While Pichia pastoris is used to produce cytidine monophosphate (CMP) choline, its fermentation cycle is long, requiring the exogenous addition of expensive CMP and phosphocholine. Furthermore, the product is primarily secreted extracellularly, increasing the difficulty of downstream extraction (Ren, YN, et al., 2020, Biotechnol Bioeng, 117: 1426-1435; Ren, YN, et al., 2021, J Biotechnol, 341: 129-136). Escherichia coli, as a host, presents endotoxin issues, limiting its direct application in the pharmaceutical field, and CMP choline is also primarily secreted extracellularly (CN109207415B, CN116144559A). Therefore, developing a safer and more efficient microbial chassis is particularly urgent.

[0005] Bacillus subtilis ( Bacillus subtilis Bacillus subtilis is a recognized safe industrial-grade microorganism with significant advantages, including a clear genetic background, mature fermentation technology, and the absence of endotoxins. Its pyrimidine metabolic network has been thoroughly elucidated, providing a metabolic basis for the efficient synthesis of cytidine triphosphate (CTP), a key precursor of citicoline. Furthermore, its choline transport mechanism is well-understood, offering theoretical guidance for enhancing substrate absorption. Therefore, Bacillus subtilis is an ideal host for constructing a highly efficient cellular factory for citicoline synthesis.

[0006] However, wild-type Bacillus subtilis naturally lacks a complete cytidine diphosphate choline synthesis pathway. Patent CN116790466B discloses a modification method that heterologously expresses Saccharomyces cerevisiae (Saccharomyces cerevisiae) in Bacillus subtilis. Saccharomyces cerevisiaeThe enzyme synthesized choline kinase CKI and phosphocholine cytidine transferase CCT, and achieved the synthesis of cytidine diphosphate choline by expressing the endogenous transport protein OpuD. However, its shake-flask fermentation yield was only 114.3±0.5 mg / L, which is low and difficult to meet the needs of industrial production. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides an engineered bacterium for producing cytidine diphosphate choline, its construction method, and its application.

[0008] This invention reduces unnecessary choline loss during fermentation by blocking the conversion of choline to glycine betaine, while simultaneously improving choline absorption, enabling choline to continuously generate phosphate choline and cytidine choline.

[0009] The engineered bacteria described in this invention are genetically modified Bacillus subtilis, and the engineered bacteria are constructed using the following method:

[0010] (1) Inactivate or knock out the gene encoding choline dehydrogenase in the Bacillus subtilis genome. gbsB and / or genes encoding glycine betaine aldehyde dehydrogenase gbsA, get gbsAB Inactivated or knocked-out strains;

[0011] (2) Overexpression opuD : The strong starter P lapS Integrate into (1) gbsAB Inactivated or knocked-out strains of the genome ywjI Sites, to obtain overexpression opuD Recombinant strains;

[0012] (3) Inactivation or knockout of overexpression in (2) opuD The recombinant strain's genome encodes a gene that is a choline transporter and a transcriptional repressor protein. opcR and / or genes gbsR Thus, the engineered bacteria that produce cytidine diphosphate choline are obtained.

[0013] As a preferred embodiment, the Bacillus subtilis mentioned in (1) is Bacillus subtilis BSC1-4 (i.e., the strain disclosed in patent CN116790466B).

[0014] In this invention, on the one hand, a marker-free gene modification method is first used to knock out the gene on the Bacillus subtilis BSC1-4 genome. gbsA - gbsB Genes, Acquisition gbsAB Knockout strain BSC2; on the other hand, using the strong promoter P lapS overexpression opuD It was integrated into the genome of strain BSC2. ywjISites, to obtain overexpression opuD The recombinant strain BSC4-3; furthermore, due to opcR, gbsR The encoded transcriptional repressor proteins OpcR and GbsR inhibit the expression of choline transporters OpuB and OpuC. Therefore, to promote the uptake of the substrate choline chloride, the genes of the recombinant strain BSC4-3 were knocked out. opcR, gbsR Genes, obtained separately opcR Knockout strain BSC5-1, gbsR Gene knockout strain BSC5-2, and opcR and gbsR The double knockout strain BSC5-3.

[0015] In addition, due to genes gbsR Together with two other genes, they form an operon. gbsB - gbsA - gbsR ,and gbsR The gene is small, only 543 bp; therefore, this invention focuses on the gene... gbsR When performing the knockout, first knock out the BSC1-4 genome. gbsBAR Genes, then P lapS - opuD Integrated into its genome ywjI Site.

[0016] The application of the aforementioned engineered bacteria in the production of cytidine diphosphate choline is also a key technical content protected by this invention. Specifically, the application involves: first, the engineered bacteria are cultured in LB liquid medium with shaking to prepare a seed culture; then, the seed culture is transferred to a fermentation medium at an inoculation rate of 0.5%-1.5% for fermentation culture; after fermentation for 3-6 hours, choline chloride with a final concentration of 1 g / L is added; finally, cytidine diphosphate choline is recovered from the fermentation culture.

[0017] Preferably, the LB culture medium consists of: 6-15 g / L tryptone, 3-8 g / L yeast extract, and 5-20 g / L NaCl.

[0018] Preferably, the fermentation medium comprises: glucose 30-50 g / L, corn steep liquor powder 6-25 g / L, tryptone 8-12 g / L, yeast extract 3-6 g / L, NaCl 6-12 g / L, (NH4)2SO4 8-15 g / L, KH2PO4 1-5 g / L, K2HPO4 5-10 g / L, MgSO4·7H2O 0.5-2 g / L, and pH 7.0-7.5.

[0019] The beneficial effects of this invention are as follows:

[0020] This invention utilizes choline chloride as a substrate for fermentation to produce citicoline. By modifying Bacillus subtilis, the conversion of choline chloride to glycine betaine is blocked, reducing unnecessary loss of choline chloride during fermentation. Simultaneously, the absorption of choline chloride is promoted through overexpression and de-transcriptional repression, enabling choline to continuously generate phosphate choline and citicoline, significantly increasing the fermentation yield of citicoline. Attached Figure Description

[0021] Figure 1 This is a schematic diagram illustrating the metabolic pathway and systematic modification strategy of the engineered bacteria provided in this invention.

[0022] Wherein, ATP: adenosine triphosphate; ADP: adenosine diphosphate; gbsA Glycine betaine aldehyde dehydrogenase; gbsB : Encodes choline dehydrogenase; OpcR: Transcriptional repressor of choline transporters OpuB and OpuC; GbsR: Transcriptional repressor of OpuB; OpuB, OpuC, OpuD: Choline transporters; CKI : Encodes choline kinase; CCT : Encodes phosphocholine cytidine transferase;

[0023] Figure 2 The HPLC chromatogram of cytidine diphosphate choline is shown.

[0024] In this figure, A is the HPLC chromatogram of the cytidine diphosphate choline standard, B is the HPLC chromatogram of the blank fermentation medium with the cytidine diphosphate choline standard added, and C is the HPLC chromatogram of the cytidine diphosphate choline yield after 24 h of fermentation of the starting strain BSC1-4. Detailed Implementation

[0025] To enable those skilled in the art to better understand the present invention, the present invention will now be further described in conjunction with specific embodiments.

[0026] I. Preparation and source of the strains, plasmids and culture media involved in this invention.

[0027] Information on all strains and plasmids involved in this invention is detailed in Table 1. Primers were synthesized by Qingke Biotechnology Co., Ltd.

[0028] LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, for general culture of Bacillus subtilis. For solid medium, add 15 g / L agar powder. If necessary, add neomycin 16 μg / mL or chloramphenicol 8 μg / mL.

[0029] Shake-flask fermentation medium: glucose 40 g / L, corn steep liquor powder 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, (NH4)2SO4 10 g / L, KH2PO4 3 g / L, K2HPO4 8 g / L, MgSO4·7H2O 1 g / L, pH 7.2. After fermentation for 4 h, choline chloride with a final concentration of 1 g / L was added.

[0030] Initial culture medium for fed-batch fermentation: Same as shake flask fermentation medium, the fed-batch medium consists of 600 g / L glucose, 20 g / L MgSO4·7H2O and 30 g / L choline chloride.

[0031] Table 1. Strains and plasmids involved in the experiment

[0032]

[0033] II. Primers and sequences involved in this invention.

[0034] Primers used for PCR are shown in Table 2.

[0035] Table 2 PCR primer sequences

[0036] Primer Sequence Name Sequence (5'→3') gbsAB-U1 SEQ ID No.1 TTCAGCCAGTCATAGTAAGC gbsAB-U2 SEQ ID No.2 TGAAACAGGAATCGGAGATG gbsAB-D1q SEQ ID No.3 TCATCTCCGATTCCTGTTTCAAAGCATTCCGAGTAGAAGC gbsAB-D2 SEQ ID No.4 GGATGCCGCCATAATCAA gbsAB-CR1q SEQ ID No.5 TTTGATTATGGCGGCATCCCTCTTCTACTAAAGCACCCA CR2 SEQ ID No.6 TTATTCATTCAGTTTTCGTG gbsAB-G1q SEQ ID No.7 CGCACGAAAACTGAATGAATAACGCTTGGTTGTTGAGGAT gbsAB-G2 SEQ ID No.8 CAATCACCAGACGGACAG ywjI-U1 SEQ ID No.9 CTGCGTGACCTGTTAAAG ywjI-G2 SEQ ID No.10 CGGAAGAAGTTTACCAAAGA ywjI-D2 SEQ ID No.11 GTTCGCTGTAATGCTGTTG ywjI-P2 SEQ ID No.12 TTTTCCTCTCTCCCCTCTAAT opuD-1q SEQ ID No.13 GATTAGAGGGGAGAGAGGAAAAATGTTGAAACATATATCTAGTGTATTT opuD-2 SEQ ID No.14 GCGGTATTTGATGAAGAGCAT ywjI-oD1q SEQ ID No.15 ATGCTCTTCATCAAATACCGCTACTGTTCGTTTCGCTGAC opcR-U1 SEQ ID No.16 GCTGAATCGCCTGAGAAA opcR-U2 SEQ ID No.17 AGCAAGTTCAAAGATGTCG opcR-D1q SEQ ID No.18 CGACATCTTTGAACTTGCTTAATGACCAATGCCGCTAT opcR-D2 SEQ ID No.19 TTGCTCCGCTTGATTGAT opcR-CR1q SEQ ID No.20 TAATCAATCAAGCGGAGCAATCTTCAACTAAAGCACCCAT opcR-G1q SEQ ID No.21 CGCACGAAAACTGAATGAATAATGGAAAGCCTACAACTGT opcR-G2 SEQ ID No.22 CCGAGATGAATGTGATTACC gbsBAR-U1 SEQ ID No.23 CTCCACAATACAGACAATCC gbsBAR-U2 SEQ ID No.24 GATGCGGTTCCCTTAATG gbsBAR-D1q SEQ ID No.25 CCATTAAGGGAACCGCATCACTATGACAGGCTGAAACG gbsBAR-D2 SEQ ID No.26 GCCGATAATAGACCTCCTC gbsBAR-CR1q SEQ ID No.27 AGAGGAGGTCTATTATCGGCGTCTTCTACTAAAGCACCCA gbsBAR-G1q SEQ ID No.28 CGCACGAAAACTGAATGAATAATCCAGCCAAGCCATAGAT gbsBAR-G2 SEQ ID No.29 AGAATGGTCATCGCTATCC

[0037] Third, the DNA manipulation, preparation and transformation of competent cells involved in this invention can be achieved using conventional techniques in the field. For details of the marker-free gene modification principle used, please refer to patent CN108715825B.

[0038] Example 1: Construction of engineered bacteria for producing cytidine diphosphate choline

[0039] according to Figure 1 The system modification method shown modifies Bacillus subtilis BS168N. The specific operation is as follows:

[0040] gbsA - gbsB Gene knockout: Using the genome of Bacillus subtilis BS168N as a template, fragment U (SEQ ID No. 30), fragment D (SEQ ID No. 31), and fragment G (SEQ ID No. 32) were amplified using primer pairs gbsAB-U1 / gbsAB-U2, gbsAB-D1q / gbsAB-D2, and gbsAB-G1q / gbsAB-G2, respectively; BS168N / Δ yrpCm Using the genome as a template, the chloramphenicol resistance gene was amplified using primer pair gbsAB-CR1q / CR2. cat and arabinose repressor gene araRThe select cassette fragment CR (the sequence of which is identical to that disclosed in the inventor's authorized patent CN116790466B, and will not be described in detail here) was assembled with fragments U, D, CR, and G to form fragment UDCRG (SEQ ID No. 33), which was then transformed into competent cells of recipient bacterium BSC1-4 to obtain gbsAB Knockout strain BSC2.

[0041] opuD Gene overexpression: Due to the inventor's previous research (patent CN116790466B), it was found that gene overexpression occurred in the Bacillus subtilis genome. ytsJ Sites utilize promoter P HpaII overexpression opuD The gene can promote the synthesis of citicoline, so it was selected for overexpression in this invention. opuD It uses the strong promoter P. lapS Integrate it into the BSC2 genome ywjI Site.

[0042] First, with BS168N / Δ ywjIm Using the genome as a template, the UDCRG fragment (SEQ ID No. 34) was amplified using primer pair ywjI-U1 / ywjI-G2 and transformed into competent BSC2 cells to obtain... ywjI BSC3 strain was knocked out as a control;

[0043] Secondly, using the BSH8 genome as a template, primer pairs ywjI-U1 / ywjI-P2 and opuD-1q / opuD-2 were used to amplify the structures containing the upstream homologous arm and P. lapS The promoter sequence fragment UP (SEQ ID No. 35) and containing opuD Gene fragment O (sequence identical to patent CN116790466B); with BS168N / Δ ywjIm Using the genome as a template, the DCRG fragment (SEQ ID No. 36) was amplified using primer pair ywjI-oD1q / ywjI-G2. Fragments UP, O, and DCRG were then spliced ​​together to form the UPODDCRG fragment (SEQ ID No. 37), which was then transformed into competent BSC2 cells to obtain P. lapS - opuD exist ywjI Site-integrated expression opuD Gene overexpression recombinant strain BSC4-3.

[0044] opcRGene knockout: Using the BS168N genome as a template, fragment U (SEQ ID No. 38), fragment D (SEQ ID No. 39), and fragment G (SEQ ID No. 40) were amplified using primer pairs opcR-U1 / opcR-U2, opcR-D1q / opcR-D2, and opcR-G1q / opcR-G2, respectively. yrpCm Using the genome as a template, fragment CR was amplified using primer pair opcR-CR1q / CR2. Then, fragments U, D, CR, and G were spliced ​​into fragment UDCRG (SEQ ID No. 41), which was then transformed into competent cells of BSC4-3 to obtain... opcR Knockout strain BSC5-1.

[0045] gbsR Gene knockout: Using the BS168N genome as a template, fragment U (SEQ ID No. 42), fragment D (SEQ ID No. 43), and fragment G (SEQ ID No. 44) were amplified using primer pairs gbsBAR-U1 / gbsBAR-U2, gbsBAR-D1q / gbsBAR-D2, and gbsBAR-G1q / gbsBAR-G2, respectively. yrpCm Using the genome as a template, fragment CR was amplified using primer pair gbsBAR-CR1q / CR2. Fragments U, D, CR, and G were then spliced ​​into fragment UDCRG (SEQ ID No. 45), which was then transformed into competent cells of BSC1-4 to obtain... gbsBAR After knocking out the strain, the UPODCRG fragment was transformed. gbsBAR Knockout of competent cells of the strain yielded gbsR Knockout strain BSC5-2.

[0046] At the same time, the same method described above is used to obtain opcR and gbsR Double knockout strain BSC5-3.

[0047] Example 2: Evaluation of the fermentation effect of cytidine diphosphate choline by various engineered bacteria

[0048] The engineered strains prepared in Example 1 (including the starting strain BSC1-4 as a control) were streaked on LB agar plates for activation. Single colonies were picked from the plates and inoculated into test tubes containing 5 mL of LB liquid medium. The culture was shaken at 37°C and 200 rpm for 12 h to prepare seed culture. The seed culture was transferred to a 250 mL Erlenmeyer flask containing 30 mL of fermentation medium at an inoculation rate of 1% (v / v). The culture was shaken at 37°C and 220 rpm. After 4 h of fermentation, choline chloride was added to a final concentration of 1 g / L. The total fermentation time was 24 h.

[0049] During shake-flask fermentation, 1 mL of fermentation broth was collected at 4 h, 8 h, 12 h, 20 h, and 24 h, respectively. The precipitate and supernatant were separated by centrifugation. The cell precipitate was washed with deionized water, resuspended, and diluted appropriately. The OD of the bacterial suspension was then measured. 600 The supernatant was used to determine the residual choline chloride content; in addition, 2.5 mL of fermentation broth was taken at 12 h and 24 h respectively to determine the total production of cytidine diphosphate choline.

[0050] In this invention, high-performance liquid chromatography (HPLC) is used to determine the concentrations of cytidine diphosphate choline and choline chloride. The specific method is as follows:

[0051] (1) HPLC analysis conditions

[0052] Chromatographic system for determination of citicoline: LC-2030 high-performance liquid chromatograph (Shimadzu); column: PCHILIC column (250 mm × 4.6 mm, 5 μm); column temperature: 30℃; mobile phase A: 0.5% formic acid aqueous solution, mobile phase B: acetonitrile / methanol (8:2, v / v) solution, A:B eluted isocratically at a ratio of 4:6 (v / v); flow rate: 1.0 mL / min; detector: UV detector; detection wavelength: 280 nm; injection volume: 20 μL. Quantitative method: Citicoline was quantified using the same chromatographic conditions to determine the standard solution of sodium citicoline.

[0053] Chromatographic system for determining choline chloride: The same HPLC system as described above was used for detection, but equipped with a RID-20A detector. The mobile phase was ammonium formate / water / acetonitrile solution (85:45:55, w / v / v), and the flow rate was 1.0 mL / min.

[0054] (2) Sample processing

[0055] Determination of total cytidine diphosphate choline concentration: Take 2.5 mL of fermentation broth, add 2.5 mL of deionized water and mix well. Place in an ice-water bath and process with an ultrasonic cell disruptor. Centrifuge the disrupted suspension at 8000 rpm for 10 min, collect the supernatant, and perform HPLC analysis after post-processing. The post-processing is as follows: first heat-treat the supernatant at 100℃ for 5 min, then centrifuge at 12000 rpm for 10 min to completely remove proteins and cell debris. Take the final supernatant, dilute it appropriately with 20% acetonitrile water (v / v), and filter through a 0.22 μm filter membrane.

[0056] Determination of choline chloride content in fermentation broth supernatant: Take 1 mL of fermentation broth, centrifuge at 12000 rpm for 5 min, collect the supernatant, perform post-processing, and perform HPLC analysis. The post-processing method is the same as above.

[0057] (3) Method validation

[0058] The results of HPLC analysis of total cytidine diphosphate choline and standards are as follows: Figure 2 As shown, A is the HPLC chromatogram of cytidine diphosphate choline standard (200 mg / L), with a retention time of approximately 9.385 min; B is the HPLC chromatogram of the blank fermentation medium after treatment, showing no interfering peaks at the corresponding retention time; C is the HPLC chromatogram of the fermentation broth sample of the starting strain BSC1-4, clearly detecting the characteristic peak of cytidine diphosphate choline, proving the accuracy and specificity of this detection method.

[0059] In this embodiment, the starting strain BSC1-4 was used. gbsAB Knockout strain BSC2 ywjI Knockout strain BSC3 opuD Overexpression strain BSC4-3, opcR Knockout strain BSC5-1, gbsR Knockout strain BSC5-2 and opcR and gbsR Fermentation was performed using the double knockout strain BSC5-3, and the growth results of the strain are shown in Table 3.

[0060] Table 3. Growth of the strains

[0061]

[0062] Note: * The results showed a significant difference compared to the control strain (P < 0.05). ** The results showed highly significant differences compared to the control strains (P < 0.01). BSC1-4 were the control strains of BSC2; BSC3 was the control strain of BSC4-3; and BSC4-3 was the control strain of BSC5-1, 5-2, and 5-3.

[0063] Table 3 shows that, compared with the corresponding control strains, the knockout gbsAB or overexpression opuD It had no significant negative impact on strain growth; however, knocking out the transcriptional repressor gene... opcR or gbsR Both knockout and elimination of certain substances inhibited the growth of the strain in the later stages of fermentation. Among them, the growth inhibition of the double-knockout strain BSC5-3 was the most obvious.

[0064] In addition, the results of choline chloride content in the supernatant of each engineered strain during fermentation are shown in Table 4.

[0065] Table 4. Changes in choline chloride content in the supernatant of each strain

[0066]

[0067] Note: △ The results showed a significant difference compared to the control strain (P < 0.05). △△ The results showed highly significant differences compared to the control strains (P < 0.01). BSC1-4 were the control strains of BSC2; BSC3 was the control strain of BSC4-3; and BSC4-3 was the control strain of BSC5-1, 5-2, and 5-3.

[0068] Based on the experimental data shown in Table 4, this invention evaluated the choline chloride utilization capacity of different genetically modified strains. The results showed that knocking out genes involved in the choline degradation pathway... gbsAB or overexpression of transport protein genes opuD None of these methods significantly improved the strain's absorption efficiency of choline chloride.

[0069] It is worth noting that, compared with the control strain BSC3, overexpression opuD The strains also showed no significant improvement in choline chloride uptake, indicating that the OpuD protein is not a highly efficient choline transporter. In contrast, knocking out transcriptional repressor factors to relieve the inhibition of the endogenous transport system achieved significant technical results. Specifically, knocking out transcriptional repressor genes... opcR (BSC5-2 strain) gbsR Both strain BSC5-1 and strain BSC5-3 (both knockout) significantly promoted the uptake of choline chloride. After 24 h of fermentation, the residual concentrations of choline chloride in the culture supernatants of the three engineered strains decreased to 584±52 mg / L, 630±54 mg / L and 483±10 mg / L, respectively. Compared with the control strain BSC4-3, the residual concentrations were significantly reduced by 26.1%, 20.2% and 38.9%, respectively. This result strongly demonstrates that relieving transcriptional repression is a superior technical strategy for enhancing substrate uptake.

[0070] Finally, the results of cytidine diphosphate choline production by each engineered strain at 12 h and 24 h of fermentation are shown in Table 5.

[0071] Table 5. Citicoline production (mg / L) of different strains after 12 h and 24 h of fermentation.

[0072] Strain 12 h 24 h BSC1-4 350.9 ± 12.9 689.8 ± 4.6 BSC2 <![CDATA[415.8 ## ± 4.0]]> 708.4 ± 11.5 BSC3 405.3 ± 13.7 722.4 ± 23.9 BSC4-3 <![CDATA[461.8 ## ± 9.6]]> <![CDATA[935.0 ## ± 18.5]]> BSC5-1 <![CDATA[757.6 ## ± 9.9]]> <![CDATA[1181.6 ## ± 11.5]]> BSC5-2 <![CDATA[619.7 ## ± 22.8]]> <![CDATA[1146.4 ## ± 15.4]]> BSC5-3 <![CDATA[601.6 ## ± 9.9]]> <![CDATA[1093.9 ## ± 11.5]]>

[0073] Note: ## The results showed highly significant differences compared to the control strains (P < 0.01). BSC1-4 were the control strains of BSC2; BSC3 was the control strain of BSC4-3; and BSC4-3 was the control strain of BSC5-1, 5-2, and 5-3.

[0074] The results in Table 5 show that the culture medium formula was adjusted based on the original patent CN116790466B in this invention. After culturing with this new formula, the production of cytidine diphosphate choline in the starting strain BSC1-4 was significantly increased. The production of cytidine diphosphate choline was more than 6 times that in the original patent (BSC1-4, 114.3 mg / L), which has significant technical effects.

[0075] Furthermore, after fermenting each engineered strain using the culture medium system described in this invention, compared with the starting strain BSC1-4, the knockout strain... gbsAB The BSC2 strain achieved a preliminary increase in cytidine diphosphate choline (CPC-C) production of 708.4 ± 11.5 mg / L after 24 h of fermentation, based on BSC3. Overexpression of... opuD The 24-hour yield of strain BSC4-3 increased to 935.0 ± 18.5 mg / L, a significant increase of 29.4% compared to the control strain BSC3. This mismatch between absorption and yield reveals a non-obvious mechanism for increased production: the key role of OpuD overexpression may not be to increase the total flux of choline entering the cell, but rather to greatly enhance the conversion efficiency of choline entering the cell and being utilized by subsequent synthetic pathways by promoting efficient substrate guidance within the cell (e.g., forming local high concentrations or substrate channels). Furthermore, based on BSC4-3, the transcriptional repressor gene was knocked out. opcR The highest yield was achieved by strain BSC5-1, reaching 1181.6 ± 11.5 mg / L, representing a 26.4% increase compared to its control strain BSC4-3 and a 71.3% increase compared to the original strain BSC1-4; knockout gbsR The yield of strain BSC5-2 also reached 1146.4±15.4 mg / L. Although the growth of the double knockout strain BSC5-3 was affected, its yield still reached 1093.9±11.5 mg / L, which was significantly higher than that of the strain that did not knock out the repressor protein.

[0076] In summary, this invention constructs a synergistic technical solution by blocking bypass pathways, optimizing substrate utilization efficiency (e.g., through OpuD), and ultimately relieving endogenous transcriptional repression. In particular, it reveals and utilizes the unique role of OpuD in improving transformation efficiency and combines it with… opcR Combining knockout strategies is a key innovation for maximizing output.

[0077] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. An engineered bacterium that produces cytidine diphosphate choline, characterized in that, The following method is used to construct it: (1) Inactivate or knock out the gene encoding choline dehydrogenase on the Bacillus subtilis BSC1-4 genome. gbsB and the gene encoding glycine betaine aldehyde dehydrogenase gbsA, get gbsAB The inactivated or knocked-out strains are named BSC2; (2) Overexpression opuD : The strong starter P lap S、opuD Gene integration into (1) gbsAB Inactivated or knocked-out strains of BSC2 genome ywjI Site, using strong promoter P lapS Overexpression of endogenous glycine betaine and arsenate betaine transporter genes opuD , received expression opuD Recombinant strains; (3) Inactivation or knockout of overexpression in (2) opuD The recombinant strain's genome encodes a gene that is a choline transporter and a transcriptional repressor protein. opcR and / or genes gbsR Thus, the engineered bacteria that produce cytidine diphosphate choline are obtained.

2. The application of the engineered bacteria according to claim 1 in the production of cytidine diphosphate choline, characterized in that, First, the engineered bacteria were cultured in LB medium with shaking to prepare a seed culture. Then, the seed culture was transferred to the fermentation medium at an inoculation rate of 0.5%-1.5% for fermentation. After fermentation for 3-6 hours, choline chloride was added to a final concentration of 1 g / L. Finally, cytidine diphosphate choline was recovered from the fermentation culture.

3. The application as described in claim 2, characterized in that, The LB medium consists of: 6-15 g / L tryptone, 3-8 g / L yeast extract, and 5-20 g / L NaCl.

4. The application as described in claim 2, characterized in that, The fermentation medium consists of: glucose 30-50 g / L, corn steep liquor powder 6-25 g / L, tryptone 8-12 g / L, yeast extract 3-6 g / L, NaCl 6-12 g / L, (NH4)2SO4 8-15 g / L, KH2PO4 1-5 g / L, K2HPO4 5-10 g / L, MgSO4·7H2O 0.5-2 g / L, and pH 7.0-7.5.

Citation Information

Patent Citations

  • Gene overexpression and the resulting strains, applications

    CN108715825B

  • A recombinant microorganism for producing cytidine diphosphate choline and a method for producing cytidine diphosphate choline.

    CN109207415B

  • Genetically engineered bacterium for producing citicoline as well as construction method and application of genetically engineered bacterium

    CN116144559A