A cashmere goat circRNA, an interference vector and application thereof in regulating cashmere goat hair follicle development

Abstract

This invention belongs to the field of animal genetic engineering technology, specifically relating to a cashmere goat circRNA, an interference vector, and their application in regulating cashmere goat hair follicle development. The cashmere goat circRNA is circ-0000987; the base sequence of circ-0000987 is shown in SEQ ID NO.1, and it is used to regulate cashmere goat hair follicle development. This invention reveals for the first time the inhibitory effect of circ-0000987 on the proliferation of cashmere goat papillary cells. The results of this invention show that circ-0000987 plays a proliferative inhibitory role in cashmere goat papillary cells, inhibiting their activity by negatively regulating cell proliferation-related pathways; and participating in the transition of hair follicles from the anagen to catagen phase by inhibiting cell proliferation and promoting apoptosis.

Description

A cashmere goat circRNA, an interference vector, and its application in regulating cashmere goat hair follicle development Technical Field

[0001] This invention belongs to the field of animal genetic engineering technology, specifically relating to a cashmere goat circRNA, an interference vector, and its application in regulating cashmere goat hair follicle development. Background Technology

[0002] Circular RNA (circRNA) is a special class of non-coding RNA molecules characterized by a covalently closed circular structure, completely abandoning the 5' cap and 3' poly(A) tail of traditional linear RNA. This unique conformation originates from the backsplicing mechanism—during pre-mRNA splicing, the downstream splice donor site and the upstream splice acceptor site connect in reverse, forming a closed circular structure mediated by the spliceosome. Thanks to the physical protection of its covalent circular structure, circRNA can effectively resist degradation by exonucleases, specifically RNase R, exhibiting significantly higher stability in cells than linear RNA. Furthermore, its sequence shows high conservation across different species, suggesting it may play an important regulatory role in evolution. circRNA plays a crucial role in skin development and regeneration, and is related to a series of physiological phenomena, including epidermal and hair follicle development, pigmentation, and the cyclical growth of hair follicles. Dermal papilla cells are key regulatory cells for hair follicle growth, development, and regeneration. They occupy a central position in hair-related research and can influence the cyclical growth of hair follicles by regulating small hormonal molecules, thus playing an important regulatory role in hair follicle development and regeneration.

[0003] Therefore, it is necessary to explore the molecular mechanism by which circRNA regulates hair follicle development in dermal papilla cells. Summary of the Invention

[0004] To address the above problems, this invention provides cashmere goat circRNA, interference vector, and their application in regulating cashmere goat hair follicle development.

[0005] This invention is achieved through the following technical solution:

[0006] A cashmere goat circRNA, wherein the cashmere goat circRNA is circ-0000987; the base sequence of circ-0000987 is shown in SEQ ID NO.1, and it is used to regulate cashmere goat hair follicle development.

[0007] An interference vector, wherein the interference vector is the siRNA interference vector of circ-0000987, and the sequence of the siRNA is shown in SEQ ID NO.2.

[0008] The interference vector is used to promote the development of cashmere goat hair follicles by inhibiting the expression of cashmere goat circRNA.

[0009] Preferably, the promotion of goat hair follicle development includes any of the following:

[0010] Promotes the cell cycle process of dermal papilla cells.

[0011] Promotes the proliferation of dermal papilla cells.

[0012] Promotes the migration of dermal papilla cells.

[0013] Inhibits apoptosis of dermal papilla cells.

[0014] Expression of mRNAs that promote the proliferation or migration of dermal papilla cells, including PCNA, CCND2, and Ki67.

[0015] Preferably, the dermal papilla cells are dermal papilla cells from the hair follicles of cashmere goats.

[0016] Preferably, the interference vector is used to prepare a product that promotes the proliferation or migration of dermal papilla cells.

[0017] Preferably, the interference vector is used to prepare a product that inhibits apoptosis of dermal papilla cells.

[0018] Preferably, the application of the cashmere goat circRNA in regulating cashmere goat hair follicle development.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention provides a cashmere goat circRNA, wherein the cashmere goat circRNA is circ-0000987; the base sequence of circ-0000987 is shown in SEQ ID NO.1, and it is used to regulate cashmere goat hair follicle development.

[0021] This invention reveals for the first time the inhibitory effect of circ-0000987 on the proliferation of hair papilla cells. The results of this study indicate that circ-0000987 plays a proliferative inhibitory role in hair papilla cells, suppressing cell activity by negatively regulating cell proliferation-related pathways. Circ-0000987 may participate in the transition of hair follicles from the anagen to catagen phase by inhibiting cell proliferation and promoting apoptosis. Furthermore, melatonin and circ-0000987 knockdown have an antagonistic relationship in proliferation regulation, weakening its promoting effect on hair papilla cells. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 shows the effect of melatonin-mediated circ-0000987 on proliferation marker genes according to the present invention.

[0024] Figure 2 shows the cell proliferation detection using the CCK8 method of this invention; where A is a diagram of melatonin-mediated downregulation of circ-0000987 promoting dermal papilla cell proliferation; B is a fluorescence field image of the NC group after transfection; C is a fluorescence field image of the circ-0000987-si-3 group after transfection; D is a detailed fluorescence field image of the MT+circ-0000987-si-3 group after transfection; E is a bright field image of the NC group after transfection; F is a detailed bright field image of the circ-0000987-si-3 group after transfection; and G is a bright field image of the MT+circ-0000987-si-3 group after transfection.

[0025] Figure 3 illustrates the effect of melatonin-mediated circ-0000987 on the cell cycle of hairy papilla cells in this invention; where A is the flow cytometry analysis results of the NC group; B is the flow cytometry analysis results of the circ-0000987-si-3 group; C is the flow cytometry analysis results of the MT+circ-0000987-si-3 group; D is a statistical analysis of each stage of the dermal papilla cell cycle; and E is an integrated statistical analysis of the dermal papilla cell cycle.

[0026] Figure 4 shows the effect of melatonin-mediated circ-0000987 on cell apoptosis according to the present invention; where A is a four-quadrant diagram of cell apoptosis in the NC group, circ-0000987-si-3 group and MT+circ-0000987-si-3 group; B is a graph of cell apoptosis rate detected by qRT-PCR in the NC group, circ-0000987-si-3 group and MT+circ-0000987-si-3 group, specifically representing the percentage of cell viability and mortality; C is a graph of the expression levels of target genes Bcl-2 and Bax in the NC group, circ-0000987-si-3 group and MT+circ-0000987-si-3 group. Detailed Implementation

[0027] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0028] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0029] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0030] The circ-0000987 of this invention is formed by reverse splicing of exon 2 and exon 3 of the ADAMTS5 gene, and is 301 nt in length. The base sequence of circ-0000987 is shown in SEQ ID NO.1, and is as follows:

[0031] GATTTATGTGGGCATCATTCATGCGACACCCTGGGAATGGCAGACGTTGGGACCATATGCTCTCCTGAGCGCAGCTGTGCGGTGATTGAAGACGATGGCCTCCATGCAGCCTTCACCGTGGCTCACGAAATTGGACATCTGCTTGGCCTCT CCCATGACGATTCCAAATTCTGTGAAGAAAATTTCGGCTCCACGGAAGATAAGCGCTTAATGTCTTCCATCCTAACCAGCATTGACGCATCCAAACCCTGGTCCAAATGCACCTCAGCCACCATCACAGAATTTCTGGATGATGGCCACG.

[0032] Example 1

[0033] 1.1 Test Materials

[0034] 1.1.1 Test Materials

[0035] Skin tissue samples of hair follicle dermal papilla cells from Inner Mongolia cashmere goats were collected from Inner Mongolia Jinlai Animal Husbandry Co., Ltd. Six 1-year-old Inner Mongolia Albas cashmere goats were randomly selected. After disinfection with 75% alcohol, a 1cm × 1cm skin sample was taken from the scapula side of the goat using a brand-new scalpel. The wound was immediately treated with Yunnan Baiyao. The tissue block was placed in 15mL of pre-cooled PBS solution for preservation and quickly brought back to the laboratory for further processing.

[0036] In this laboratory, papillary cells of Inner Mongolian cashmere goat hair were isolated by: taking scapular skin tissue, disinfecting with 75% alcohol (v / v), washing with PBS, and cutting into 1mm pieces. 2 Small pieces were digested with 0.25% neutral protease at 37°C for 2 hours. The dermis and subcutaneous tissue were removed by microscopic dissection. Hair papilla cells at the base of the hair follicles were isolated and adhered to DMEM medium containing 10% FBS and 1% penicillin antibiotics. The medium was changed every 3 days at 37°C with 5% CO2.

[0037] After the primary cells reached confluence, they were washed three times with PBS, digested with 0.25% trypsin at 30°C for 3 minutes, and then the digestion was stopped by adding FBS medium. Epithelial and villous cells were separated, washed three times again with PBS, digested with 0.25% trypsin at 37°C for 4 minutes, and then the digestion was stopped by adding BI medium. The cell suspension was centrifuged at 1500 rpm for 5 minutes, and the pellet was resuspended in 5% complete medium and cultured at 37°C with 5% CO2.

[0038] Third-generation cells with good growth were seeded and cultured for 48 hours. Immunofluorescence labeling was used to identify the expression of dermal papillary cell markers smooth muscle actin α-SMA and vimentin VIM.

[0039] 1.1.2 Test Reagents

[0040] Annexin V-APC apoptosis detection kit was purchased from Eliteray Bio-Medical Electronics Co., Ltd.; PI staining solution was provided by MCE Biotechnology Co., Ltd.; and the CCK8 kit was purchased from Solarbio. Melatonin was purchased from Sigma-Aldrich (product number M5250); 0.25% trypsin was purchased from Gibco; high-glucose DMEM medium and dimethyl sulfoxide were purchased from Wako Pure Chemical Industries Co., Ltd.; penicillin and streptomycin antibiotic mixture was purchased from Gibco; fetal bovine serum was purchased from Yiji Cell Biotechnology Co., Ltd.; DPBS was purchased from Hyclone Biotechnology Co., Ltd.; DAPI was provided by Solarbio; α-SMA primary antibody and VIM primary antibody were both purchased from Abcam; vector plasmids were purchased from Hanheng Biotechnology Co., Ltd.; and DH5α competent cells were purchased from Tiangen Biotech Co., Ltd. (product number CB 101-02). Phanta Max high-fidelity DNA polymerase was purchased from Novizan (product number P505-D1), HB-infusion recombinant reagent from Hanheng Biotechnology, plasmid DNA purification kit from MACHEY-NAGEL (product number 740412), gel DNA recovery kit from General Biotechnology (product number GK2041), DNA molecular weight standards from General Biotechnology, and restriction endonucleases from Thermo Fisher Scientific.

[0041] 1.1.3 Test Instruments

[0042] The fluorescence microscope was manufactured by Nikon, the NanDrop2000 UV spectrophotometer was purchased from Thermo Fisher Scientific, the flow cytometer was a Beckman CytoFLEX model, the multi-functional microplate reader was provided by Berten, the 37℃ constant temperature incubator was from Jinghong, the image analysis software was Adobe Photoshop, and the exposure unit was manufactured by Protein Simple.

[0043] 1.2 Test Methods

[0044] 1.2.1 Culture of dermal papilla cells

[0045] In this laboratory, papillary cells of Inner Mongolian cashmere goat hair were isolated by taking skin tissue from the scapula, disinfecting it with 75% alcohol, washing it with PBS, and then cutting it into 1mm pieces. 2 Small pieces were digested with 0.25% neutral protease at 37°C for 2 hours. The dermis and subcutaneous tissue were removed by microscopic dissection. The dermal papilla cells at the base of the hair follicle were isolated and adhered to DMEM medium containing 10% FBS and 1% penicillin antibiotics. The medium was changed every 3 days at 37°C with 5% CO2.

[0046] After the primary cells reached confluence, they were washed three times with PBS, digested with 0.25% trypsin at 30°C for 3 minutes, and then the digestion was stopped by adding FBS medium. Epithelial and villous cells were separated, washed three times again with PBS, digested with 0.25% trypsin at 37°C for 4 minutes, and then the digestion was stopped by adding BI medium. The cell suspension was centrifuged at 1500 rpm for 5 minutes, and the pellet was resuspended in 5% complete medium and cultured at 37°C with 5% CO2.

[0047] Third-generation cells with good growth were seeded and cultured for 48 hours. Immunofluorescence labeling was used to identify the expression of dermal papillary cell markers smooth muscle actin α-SMA and vimentin VIM.

[0048] 1.2.2 Construction of Lentiviral Interference Vector

[0049] Construction and packaging of circ-0000987 siRNA lentiviral vector

[0050] Since the screening and design of the interference target site for circ-0000987 required "crossing" the splicing sites of the full-length sequence while ensuring that the expression of the linear source gene was not affected, a specific interference sequence siRNA was designed, and the sequence information is shown in Table 1. Based on the full-length sequence information of circ-0000987, the interference sequence was finally synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd.

[0051] Table 1. siRNA sequence information for circ-0000987

[0052]

[0053] 1.2.3 Lentiviral transfection of dermal papilla cells

[0054] The constructed siRNA interference sequences were transfected into dermal papilla cells, and total RNA was extracted from the cells. The inhibition efficiency of the circ-0000987-siRNA interference sequence on circ-0000987 and linear 0000987 was verified by RT-qPCR experiments.

[0055] 1.2.4 CCK8 assay for Detection of Hair Papillary Cell Proliferation

[0056] Three groups were set up: a negative control group (NC), a circ-0000987-si-3 group, and an MT+circ-0000987-si-3 group, where MT was melatonin. The circ-0000987-si-3 group consisted of dermal papilla cells whose circ-0000987 expression was interfered with; the MT+circ-0000987-si-3 group consisted of dermal papilla cells co-treated with melatonin and circ-0000987-si-3; and the negative control group (NC) consisted of dermal papilla cells whose circ-0000987 expression was not interfered with and who were not given melatonin.

[0057] After transfection, medium change, and further culture at 24h, 48h, 72h, and 96h in 96-well plates, the original culture medium in each well was removed, and the cells were rinsed with pre-warmed PBS. 10 μL of CCK-8 solution was added to each well, using cell culture medium without fetal bovine serum. The 96-well plates were then incubated at 37℃ with 5% CO2 for another 4h. The OD value at 450nm was then measured using a microplate reader to analyze the changes in the proliferative activity of Inner Mongolian goat hair papilla cells after knockdown of circ-0000987 expression. Each experiment was performed in triplicate.

[0058] 1.2.5 Cell cycle experiment

[0059] After transfecting and changing the medium of dermal papilla cells cultured in 6-well plates, and continuing culture for 48 hours, the cell culture medium from each well was carefully collected into separate centrifuge tubes for later use. Cells were digested with 0.25% (w / v) EDTA-free trypsin until they could be gently detached from the bottom of the culture plate by pipetting. The collected cell culture medium was added, and the cells were aspirated and centrifuged at 1500 rpm for 5 minutes. After centrifugation, the supernatant was removed, and the cells were washed with pre-chilled PBS to suspend them. The cells were centrifuged again, excess PBS was removed, and approximately 50 μL was reserved. The bottom of the centrifuge tube was gently tapped to disperse the cells appropriately. Subsequently, pre-chilled 70% (w / v) ethanol was added to the centrifuge tube, and the cells were gently aspirated and fixed at 4°C for 12 hours. After 12 hours, the cells were centrifuged at 1500 rpm for 5 minutes, and the supernatant was carefully aspirated, reserving approximately 50 μL of 70% ethanol. Add 500 μL of propidium iodide staining solution (PI) to each tube, prepare fresh before use, and incubate at 37°C in the dark for 30 min. Finally, analyze the data using flow cytometry and visualize the experimental dataset using GraphPad Prism 9.0 software.

[0060] 1.2.6 Apoptosis Experiment

[0061] After culturing dermal papilla cells in 6-well plates for 48 hours, the cells were trypsin-digested, centrifuged, and then washed with pre-chilled PBS. The supernatant was removed after centrifugation. Cells were resuspended in centrifuge tubes with 1× binding buffer. Subsequently, 5 μL of annexin V-APC and PI staining solution were added to the centrifuge tubes, and the cells were incubated at room temperature in the dark for 10 min. Flow cytometry analysis was performed, and the experimental dataset was visualized using GraphPad Prism 9.0 software.

[0062] 1.2.7 RT-qPCR Experiment

[0063] To verify the reliability of differentially expressed circRNAs screened by transcriptome sequencing, the expression levels of six randomly selected target circRNAs were validated using qRT-PCR technology.

[0064] The specific steps are as follows: Using the raw RNA sample provided by the sequencing project, the PrimeScript™ RT reagent Kit with gDNA Eraser from Baori Biotechnology Co., Ltd. (kit number RR047A) was used for genomic DNA removal and cDNA synthesis. The reaction system for genomic DNA removal is shown in Table 2; the reaction system for cDNA synthesis is shown in Table 3.

[0065] Using the TB Green™ Premix Ex Taq™ II kit (TliRNaseH Plus) from BioNTech, the obtained cDNA was diluted 10-fold with RNase-free ultrapure water. Subsequently, the diluted cDNA was used as a reaction template, and GAPDH as an internal control gene for real-time quantitative PCR. -ΔΔCt The relative expression level of circRNA was calculated using a method, and correlation analysis was performed with FPKM values ​​in the sequencing data. 2 To assess the reliability of the results, each experiment was performed in triplicate. The reaction system for real-time quantitative PCR is shown in Table 4, and the reaction procedure is shown in Table 5.

[0066] Table 2 Genomic DNA Removal

[0067]

[0068] Table 3 cDNA Synthesis

[0069]

[0070] Table 4 Real-time quantitative PCR reactions

[0071]

[0072] Table 5 PCR reaction procedure

[0073]

[0074] 1.3 Results and Analysis

[0075] 1.3.1 Effects of melatonin-mediated circ-0000987 on dermal papilla cell proliferation

[0076] Total RNA was collected from dermal papilla cells successfully transfected with circ-0000987-si-3 and selected for puromycin resistance. RT-qPCR was used to detect changes in the mRNA levels of dermal papilla cell proliferation marker genes, namely PCNA, CCND2, and Ki67. The results, as shown in Figure 1, revealed that knocking down circ-0000987 (circ_0000987-si-3) significantly upregulated the mRNA levels of PCNA, CCND2, and Ki67 (P < 0.01). Compared to the circ-0000987-si-3 group, the co-treatment group with melatonin and circ-0000987-si-3 showed significantly reduced expression levels of PCNA, CCND2, and Ki67 (p < 0.01). These results preliminarily indicate that inhibiting circ-0000987 expression in dermal papilla cells can promote the expression of proliferation marker genes. Co-treatment with melatonin and circ_0000987-si-3 reversed the above-mentioned effect: inhibition of proliferation gene expression. To investigate the role of melatonin in circ-0000987 in dermal papilla cells, circ-0000987-si-3 and melatonin co-treated with circ-0000987-si-3 were transfected into dermal papilla cells, as shown in Figures B-G in Figure 2. Cell proliferation rate was detected using the CCK8 assay, and data from previous laboratory measurements of melatonin's effect on dermal papilla cell proliferation were analyzed. The results showed that compared with NC, the circ-0000987-si-3 group significantly promoted dermal papilla cell proliferation at 48h and 72h (P<0.01). Compared with the circ-0000987-si-3 group, the co-treatment group with melatonin and circ-0000987-si-3 significantly promoted dermal papilla cell proliferation (P<0.01). These data indicate that melatonin antagonizes the knockdown effect of circ-0000987, as shown in Figure 2A.

[0077] 1.3.2 Effects of melatonin-mediated circ-0000987 on the cell cycle progression of dermal papilla

[0078] Cell cycle assays and flow cytometry were used to further confirm the effect of circ-0000987 in promoting dermal papilla cell proliferation. circ-0000987-si-3 was transfected into dermal papilla cells, and flow cytometry was used to detect the distribution of cell cycle progression. The results showed that compared with the NC group, circ-0000987-si-3 significantly reduced the number of dermal papilla cells in the G2 / M phase (P<0.01); while the co-treatment group with melatonin and circ-0000987-si-3 significantly increased the number of dermal papilla cells in the G2 / M phase compared with the circ-0000987-si-3 group. The experimental results further demonstrate that melatonin antagonizes the knockdown effect of circ-0000987, as shown in Figure 3.

[0079] 1.3.3 Effect of melatonin-mediated circ-0000987 on dermal papilla cell apoptosis

[0080] RT-qPCR was used to detect changes in the levels of apoptosis marker genes mRNA in dermal papilla cells, namely the anti-apoptotic gene Bcl-2 and the pro-apoptotic gene Bax. The results showed that knockdown of circ-0000987 significantly increased the expression level of Bcl-2 (P<0.01) and significantly decreased the expression level of Bax (P<0.01). Compared with the circ-0000987-si-3 group, the co-treatment group with melatonin and circ-0000987-si-3 showed significantly decreased Bcl-2 expression (P<0.01) and significantly increased Bax expression (P<0.01). These results preliminarily indicate that circ-0000987 promotes dermal papilla cell apoptosis by regulating the expression of apoptosis-related genes, as shown in Figure 4C.

[0081] Flow cytometry was used to further verify the effect of circ-0000987 on dermal papilla cell apoptosis. As shown in Figures 4A and 4B, inhibiting the expression of circ-0000987 in dermal papilla cells, specifically the circ-0000987-si-3 group, significantly reduced the total apoptosis rate and increased the number of viable cells (P < 0.01). These results further demonstrate that circ-0000987 promotes dermal papilla cell apoptosis.

[0082] This invention reveals for the first time the inhibitory effect of circ-0000987 on the proliferation of woolly goat papilla cells. Real-time quantitative PCR results showed that after specific knockdown of circ-0000987 expression via siRNA, the mRNA levels of proliferation marker genes PCNA, CCND2, and Ki67 significantly increased (P < 0.01), indicating that circ-0000987 may inhibit woolly goat papilla cell activity by negatively regulating cell proliferation-related pathways. PCNA, as a core factor in DNA replication, directly reflects an enhanced ability of cells to enter S phase with upregulation; the increased expression of CCND2 and Ki67, as markers of G1 / S phase transition and proliferation activity, further supports the enhanced cell proliferation capacity after circ-0000987 knockout.

[0083] Furthermore, CCK8 assays showed that cell proliferation significantly increased at 48 h and 72 h after circ-0000987 knockdown (P < 0.01), while melatonin co-treatment antagonized the knockdown effect of circ-0000987. Cell cycle analysis indicated that circ-0000987 knockdown significantly reduced the proportion of cells in the G2 / M phase, while melatonin co-treatment weakened the effect of circ-0000987 knockdown on promoting morphogenesis and maturation.

[0084] Regarding apoptosis regulation, circ-0000987 knockout led to increased expression of the anti-apoptotic gene Bcl-2 and decreased expression of the pro-apoptotic gene Bax. Flow cytometry also showed a decrease in the total apoptosis rate, indicating that circ-0000987 has a pro-apoptotic function (P < 0.01). The Bcl-2 / Bax ratio is a core regulator of the mitochondrial apoptosis pathway, and its changes directly determine the initiation of apoptosis. However, co-treatment with melatonin and circ-0000987-si-3 reversed the Bcl-2 / Bax ratio, suggesting that melatonin may inhibit apoptosis through a pathway independent of circ-0000987.

[0085] In summary, circ-0000987 plays a proliferative inhibitory role in hair papilla cells by negatively regulating cell proliferation-related pathways. By inhibiting cell proliferation and promoting apoptosis, circ-0000987 may be involved in the transition of hair follicles from the anagen to catagen phase. Melatonin, on the other hand, antagonizes the knockdown effect of circ-0000987, weakening its promoting effect on hair papilla cells.

[0086] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0087] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. A cashmere goat circRNA, characterized in that, The cashmere goat circRNA is circ-0000987; the base sequence of circ-0000987 is shown in SEQ ID NO.

1.

2. An interference carrier, characterized in that, The interference vector is the siRNA interference vector of circ-0000987 as described in claim 1, and the sequence of the siRNA is shown in SEQ ID NO.

2.

3. The application of the interference carrier according to claim 2 in promoting the development of goat hair follicles, characterized in that, The expression of cashmere goat circRNA was inhibited by the interference vector, thereby promoting cashmere goat hair follicle development.

4. The application according to claim 3, characterized in that, The promotion of hair follicle development includes any of the following: promoting dermal papilla cell proliferation; inhibiting dermal papilla cell apoptosis; and promoting the expression of mRNAs related to dermal papilla cell proliferation, wherein the mRNAs are PCNA, CCND2, and Ki67.

5. The application according to claim 4, characterized in that, The dermal papilla cells are dermal papilla cells of the hair follicles in the skin tissue of cashmere goats.

Images