Ophthalmic medicament for pets with neurotrophic eye diseases as well as preparation method and application of ophthalmic medicament

Abstract

The invention relates to an ophthalmic medicament for neurotrophic eye diseases of pets and a preparation method and application thereof.The ophthalmic medicament comprises the active ingredients of cat nerve growth factors and tobramycin, and in the ophthalmic medicament, the concentration of the cat nerve growth factors is 60-150 micrograms / mL; the weight percentage of the tobramycin is 0.2-0.5%, the nucleotide sequence for coding the cat nerve growth factor is shown as SEQ ID NO: 1 or SEQ ID NO: 7, the cat nerve growth factor has better stability and biological activity, and compared with a traditional extraction type nerve growth factor, the production cost is lower, large-scale production is more facilitated, and the method is suitable for industrial production. The invention has important application significance and application prospect in the field of preparation and application of therapeutic agents for pet neurotrophic keratitis and neurotrophic corneal ulcer.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an ophthalmic agent for pet neurotrophic eye diseases, its preparation method, and its application. Background Technology

[0002] Nerve growth factor (NGF) Nerve Growth Factor NGF is a key neurotrophic factor, belonging to the neurotrophic factor (NGF) class. neurotrophin The NGF family is a homodimeric protein composed of two identical monomers linked by non-covalent bonds. Each monomer consists of approximately 120 amino acids and contains a highly conserved β-sheet structure, as well as variable regions that determine receptor binding specificity. It is initially synthesized as a larger precursor protein (proNGF), which is cleaved by proteases to release mature NGF. Mature NGF is primarily secreted by target tissues surrounding neurons (such as skin and muscle), Schwann cells, glial cells, and immune cells (such as mast cells). It is released paracrinely or autocrinely, internalized by binding to receptors at neuronal terminals, and transported retrogradely to the cell body to exert its effects.

[0003] NGF can accelerate ulcer healing by activating the proliferation and migration of corneal epithelial cells. Studies have shown that topical application of NGF can improve corneal epithelial defects, shorten healing time, and reduce the risk of secondary infection. It can also alleviate corneal stromal damage and prevent further deterioration of ulcers by regulating the expression of inflammatory factors and inhibiting apoptosis pathways. However, neurotrophic corneal ulcers (caused by trigeminal nerve injury, diabetic neuropathy, etc.) are often accompanied by a decrease in corneal nerve density due to trigeminal nerve injury. NGF has poor stability and a short half-life, requiring multiple administrations to maintain an effective concentration. Therefore, it usually needs to be used frequently, such as 6 times a day for 8 consecutive weeks, which limits its use. Moreover, there are currently no NGF-based eye drops for veterinary corneal ulcers available in China.

[0004] Tobramycin ( Tobramycin ) is an aminoglycoside antibiotic, commonly used clinically in its sulfate form, and is mainly derived from Streptomyces diatomaceous earth (Streptomyces diatomaceous earth). Streptomyces tenebrarius It was extracted from the culture of ) and has the chemical formula C 18 H 37N5O9, its antibacterial spectrum mainly covers gram-negative bacilli, such as Pseudomonas aeruginosa, Escherichia coli, Klebsiella, etc., especially the antibacterial activity of Pseudomonas aeruginosa is significantly stronger than that of gentamicin, and even against some gentamicin-resistant strains. Tobramycin irreversibly binds to bacterial ribosomes 30S and 50S subunits, hinders the formation of 70S complex, inhibits protein synthesis, and eventually leads to bacterial death. In clinical practice, tobramycin is applied in various dosage forms such as injection, eye drops and eye ointment; among them, the injection is widely used for severe infections caused by sensitive bacteria, such as septicemia, respiratory tract infection, urinary system infection, burn infection and meningitis, etc.; and the eye preparation is mainly used for bacterial infection of conjunctivitis, keratitis and other eye diseases.

[0005] In view of the current lack of cat nerve growth factor for pet neurotrophic corneal ulcer and corneal inflammation, the poor stability of existing nerve growth as a medicament, and the high drug application frequency, an effective solution has not been proposed. SUMMARY

[0006] The purpose of the present application is to provide an eye medicament for pet neurotrophic eye disease and its preparation method and application, so as to solve the problems of lack of cat nerve growth factor for pet neurotrophic corneal ulcer and corneal inflammation, poor stability of existing nerve growth as a medicament, and high drug application frequency in the related art.

[0007] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is: The first aspect of the present application is to provide an eye medicament for pet neurotrophic eye disease, the active ingredient of the eye medicament includes cat nerve growth factor and tobramycin, wherein the concentration of the cat nerve growth factor in the eye medicament is 60-150 μg / mL; the weight percentage of the tobramycin is 0.2-0.5%; preferably, the concentration of the cat nerve growth factor is 60-120 μg / mL; the weight percentage of the tobramycin is 0.3%; more preferably, the concentration of the cat nerve growth factor is 120 μg / mL.

[0008] Further, the nucleic acid sequence encoding the cat nerve growth factor is as shown in SEQ ID NO: 1 or SEQ ID NO: 7; preferably, as shown in SEQ ID NO: 7.

[0009] In the present application, the tobramycin is obtained by conventional purchase in the market.

[0010] Further, the molecular weight of the cat nerve growth factor is 43.7 kDa.

[0011] Further, the dosage form of the eye agent is a drop, an ointment or a gel; preferably, the dosage form of the eye agent is a drop.

[0012] Further, the eye agent further comprises an excipient, wherein the excipient comprises at least one of benzalkonium bromide, boric acid borax, sodium hyaluronate, disodium hydrogen phosphate and sodium dihydrogen phosphate.

[0013] Further, the neurotrophic eye disease comprises neurotrophic keratitis and neurotrophic corneal ulcer.

[0014] The second aspect of the present application provides a use method of the eye agent according to the first aspect, the use method being: applying the eye agent to the eyes of the pet, 1-2 drops each time, 1-3 times a day, closing the eyes for 8-12 min after administration, and continuously administering for 7-21 days; preferably, 1 drop each time, 3 times a day, closing the eyes for 10 min after administration, and continuously administering for 14 days.

[0015] It can be understood that the administration amount of the eye agent can be adjusted according to different pets or the severity of the neurotrophic eye disease.

[0016] The third aspect of the present application provides a preparation method of the eye agent according to the first aspect, comprising the following steps: S1, extracting total RNA in cat tissues, synthesizing cDNA as a template by reverse transcription, and then obtaining a nucleic acid sequence encoding a cat nerve growth factor by PCR amplification; S2, using the nucleic acid sequence encoding the cat nerve growth factor obtained in step S1 to perform double enzyme digestion, and then performing enzyme connection with a plasmid vector to obtain a recombinant bacteria, and then extracting a recombinant plasmid after amplification and culture of the recombinant bacteria; S3, constructing an E. coli expression bacteria using the obtained recombinant plasmid, inducing expression, and then purifying and renaturing, so as to obtain the cat nerve growth factor, mixing the cat nerve growth factor and tobramycin to prepare a mixed solution, and thus obtaining the eye agent.

[0017] Further, in step S1, the PCR amplification system is: 25 μL of PCR reaction premix, 2 μL of upstream primer, 2 μL of downstream primer, 2 μL of DNA template, and deionized water is added to 50 μL.

[0018] Further, in step S1, the PCR reaction conditions are: pre-denaturation at 94℃ for 5 min, denaturation at 98℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, and cycling for 30 times.

[0019] Further, in step S1, the sequence of the primer in the PCR amplification is shown in SEQ ID NO: 4-SEQ ID NO: 5.

[0020] Further, in step S3, the induction temperature is 16~37℃; preferably, 37℃.

[0021] Furthermore, in step S3, the induction time is 2 to 6 hours; preferably, 6 hours.

[0022] Further, in step S3, the concentration of the inducing agent isopropyl-β-D-thiogalactoside (IPTG) is 0.2~1 mmol / L; preferably, 1 mmol / L.

[0023] Furthermore, in step S3, the purity of the obtained cat nerve growth factor is greater than 90%.

[0024] Further, in step S3, the concentration of feline nerve growth factor in the mixed solution is 60~150 μg / mL; and the weight percentage of tobramycin is 0.2~0.5%.

[0025] Furthermore, the mixed solution is prepared by mixing feline nerve growth factor, tobramycin, and physiological saline. In some embodiments, it also includes excipients, wherein the excipients include at least one of benzalkonium bromide, borax borate, sodium hyaluronate, disodium hydrogen phosphate, and sodium dihydrogen phosphate.

[0026] Furthermore, the feline nerve growth factor did not degrade during the purification process and under the condition of storage at -20°C for 3 months.

[0027] Furthermore, the cat nerve growth factor exhibited significant cell differentiation induction ability and certain axonal growth promotion activity in PC12 cell experiments.

[0028] A fourth aspect of the present invention is to provide an application of an ophthalmic agent prepared by the method of use as described in the first aspect, or by the method of preparation as described in the second aspect, or by the method of preparation as described in the third aspect, wherein the application is in the preparation of an ophthalmic agent for pet neurotrophic eye diseases, wherein the neurotrophic eye diseases include neurotrophic keratitis and neurotrophic corneal ulcers.

[0029] Furthermore, the pets include dogs and cats.

[0030] The present invention adopts the above technical solution and has the following technical effects compared with the prior art: This invention uses a prokaryotic system to express recombinant feline nerve growth factor (FNGF-1). The biological activity of the expressed FNGF-1 was preliminarily verified using a PC12 cell induction experiment. A rat model of neurotrophic corneal ulcer was constructed, and an ophthalmic agent was prepared by mixing FNGF-1 and tobramycin. A rat neurotrophic corneal ulcer treatment experiment was conducted to verify the adjuvant therapeutic effect of recombinant feline nerve growth factor on neurotrophic keratitis and neurotrophic corneal ulcers. Furthermore, FNGF-1, as a modified feline nerve growth factor, exhibits superior stability and biological activity, requiring less frequent administration. In addition, it shows good homology when applied to pet cats. Compared to traditional extraction methods for producing nerve growth factor, its production cost is lower, making it more suitable for large-scale production. Therefore, it has significant application value and promising prospects in the preparation of therapeutic agents for neurotrophic keratitis and neurotrophic corneal ulcers in pets. Attached Figure Description

[0031] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are for illustrative purposes only, and do not constitute an undue limitation of the invention. In the drawings: Figure 1 This is a diagram showing the PCR amplification results of the FNGF gene in one embodiment of the present invention; wherein, M: DNA Marker DL5000; 1: FNGF gene fragment amplified from cat liver tissue; 2: FNGF gene fragment amplified from cat muscle tissue; Figure 2 This is a graph showing the prediction results of recombinant feline nerve growth factor signal peptide in one embodiment of the present invention; Figure 3 This is a diagram of the CAI results before FNGF codon optimization in one embodiment of the present invention; Figure 4 This is a diagram of the CAI result after optimizing the FNGF codon in one embodiment of the present invention; Figure 5 This is a diagram showing the result of PCR amplification of the FNGF-1 gene sequence obtained in one embodiment of the present invention; Figure 6 This is a PCR identification result of pET-32a-FNGF-1 recombinant bacteria in an embodiment of the present invention; where M: DNA Marker DL2000; 1-11: positive clones; Figure 7 This is a diagram showing the double enzyme digestion identification results of the pET-32a-FNGF-1 recombinant plasmid in one embodiment of the present invention; wherein, M: DNA Marker DL5000; 1-2: pET-32a-FNGF-1 enzyme digestion products; Figure 8This is a colony result diagram of the pET-32a-FNGF-1 recombinant bacteria in one embodiment of the present invention; Figure 9 This is a graph showing the optimization results of the optimal temperature and expression time for FNGF-1 in one embodiment of the present invention; where M: Protein 180 kDa; 1: pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 37℃ for 2 h; 2: pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 16℃ for 4 h; 3: pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 37℃ for 6 h; 4: pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 16℃ for 2 h; 5: pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 16℃ for 4 h; 6: pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 16℃ for 6 h. 7: pET-32a-FNGF-1 expression bacteria; 8: pET-32a empty vector induced; 9: pET-32a empty vector induced; Figure 10 This is a graph showing the optimization of the optimal IPTG concentration for FNGF-1 and the results of solubility detection in one embodiment of the present invention; where M: Protein 180 kDa; 1: pET-32a empty vector; 2: pET-32a-FNGF-1 expression bacteria without induction; 3: pET-32a empty vector without induction; 4: whole pET-32a-FNGF-1 expression bacteria induced by 0.2 mmol / L IPTG at 37℃ for 6 h; 5: whole pET-32a-FNGF-1 expression bacteria induced by 0.5 mmol / L IPTG at 37℃ for 6 h; 6: whole pET-32a-FNGF-1 expression bacteria induced by 1 mmol / L IPTG at 37℃ for 6 h; 7: pET-32a-FNGF-1 expression bacteria precipitate induced by 0.2 mmol / L IPTG at 37℃ for 6 h; 8: precipitate of pET-32a-FNGF-1 expression bacteria induced by 0.5 mmol / L IPTG at 37℃ for 6 h. 9: Precipitate of pET-32a-FNGF-1 expressing bacteria induced by 1 mmol / L IPTG at 37℃ for 6 h; 10: Supernatant of pET-32a-FNGF-1 expressing bacteria induced by 0.2 mmol / L IPTG at 37℃ for 6 h; 11: Supernatant of pET-32a-FNGF-1 expressing bacteria induced by 0.5 mmol / L IPTG at 37℃ for 6 h; 12: Supernatant of pET-32a-FNGF-1 expressing bacteria induced by 1 mmol / L IPTG at 37℃ for 6 h. Figure 11This is a diagram showing the purification results of FNGF-1 in one embodiment of the present invention; wherein, M: protein molecular weight standard; 1: flow-through solution after protein loading; 2: whole bacteria of pET-32a-FNGF-1 expressing bacteria; 3: precipitate of pET-32a-FNGF-1 expressing bacteria; 4-9: products in the first to sixth collection tubes during purification elution, respectively; Figure 12 This is a diagram showing the immunoblotting results of FNGF-1 protein and anti-His tag antibody in one embodiment of the present invention; wherein, M: protein molecular weight standard; 1: immunoblotting of FNGF-1 protein and anti-His tag antibody; Figure 13 This is a graph showing the immunoblotting results of FNGF-1 protein and commercial NGF antibody in one embodiment of the present invention; wherein, M: protein molecular weight standard; 1: immunoblotting of FNGF-1 protein and commercial NGF antibody; Figure 14 This is a graph showing the stability test results of FNGF-1 in one embodiment of the present invention; wherein, M: protein molecular weight standard; 1: purified FNGF-1; 2: purified FNGF-1 stored for 3 months; 3: whole bacteria of pET-32a-FNGF-1 expression bacteria; Figure 15 This is a diagram showing the results of a PC12 cell differentiation induction experiment in one embodiment of the present invention; where A: blank group after 24 h; B: induction with pET-32a 100 ng / mL for 24 h; C: induction with FNGF-1 100 ng / mL for 24 h; D: blank group after 48 h; E: induction with pET-32a 100 ng / mL for 48 h; F: induction with FNGF-1 100 ng / mL for 48 h. Figure 16 This is a graph showing the percentage of positive cells in one embodiment of the present invention; Figure 17 This is a diagram showing the axon length of positive cells in one embodiment of the present invention; Figure 18 This is a diagram showing the tear film test results after capsaicin injection in one embodiment of the present invention; Figure 19 This is a graph showing the FNGF-1 concentration screening results in one embodiment of the present invention; Figure 20 This is a diagram showing the experimental results of a hot plate in one embodiment of the present invention; Figure 21 This is a diagram showing the comparison of tear film test results before and after treatment in one embodiment of the present invention; Figure 22 This is a graph showing the corneal ulcer scoring results of each group in one embodiment of the present invention; Figure 23 This is a diagram showing the results of sodium fluorescein staining in each group in one embodiment of the present invention; Figure 24 This is a graph showing the scoring results of sodium fluorescein in each group in one embodiment of the present invention; Figure 25 This is a result of HE staining of corneal tissue in one embodiment of the present invention; wherein, A: normal untreated cornea; B: cornea after capsaicin burn modeling; C: group treated with physiological saline for 14 days after modeling; D: group treated with pET32a empty vector protein for 14 days after modeling; E: group treated with TB for 14 days after modeling; F: group treated with FNGF-1 for 14 days after modeling; G: group treated with FNGF-1+TB for 14 days after modeling. Detailed Implementation

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0033] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0034] The main reagents used in the embodiments of this invention are sourced from the following table: Other manufacturers not specifically labeled in the examples can be obtained through commercial purchases.

[0035] The present invention will be described below by way of example.

[0036] Example 1 - Preparation and Acquisition of Feline Nerve Growth Factor (FNGF-1) 1. Obtain the target gene sequence of feline nerve growth factor (FNGF). Based on the CDS gene sequence corresponding to feline nerve growth factor published by NCBI, and using the designed specific primers FNGF-F as the upstream primer and FNGF-R as the downstream primer (primer sequences are shown in Table 1), cDNA synthesized from RNA reverse transcribed from cat tissue (the experimental cat tissue sample was obtained from the frozen storage of the Department of Veterinary Medicine, Nanjing Agricultural University) was used as a template for PCR amplification. The PCR amplification system is shown in Table 2. The reaction conditions were: pre-denaturation: 94℃, 5 min; denaturation: 98℃, 15 s; annealing: 55℃, 15 s; extension: 72℃, 1 min; 30 cycles in total; final extension: 72℃, 5 min, stored at 4℃. The PCR products were subjected to agarose gel electrophoresis at 120 V for 30 min, and the electrophoresis results were observed in a UV gel imaging system. The results are shown in Table 2. Figure 1 As shown in the figure, the gene sequence of the expected length was successfully amplified; and the target gene sequence of feline nerve growth factor (FNGF) was obtained by gel recovery and purification, as shown in SEQ ID NO: 1.

[0037] Cat nerve growth factor gene sequence (FNGF): ATGTCCATGTTGTCCTACACTCTGATCACAGCTCTTTTGATCGGCATACAGGCAGAACCACACCCAGAGAGCAATGTCCCAGCAGGACACACCATCCCCCAAGCCCACTGGACTAAGCTTCAGCATTCCCTCGACACAGCCCTCCGCAGAGCCCGCAGCACCCCGGCCGGGGCAATAGCCGCGAGGGTGGCAGGGCAGACCCGCAACATCACTGTGGACCCCAAACTTTTTAAAAAGCGGCGACTGCGTTCACCCCGCGTGCTGTTCAGCACGCACCCCCCACCTGTGGCTGCAGATACTCAGGGTCTGGACTTGGAGGCGGGTGGTGCTGCCTCCTTCAACAGGACTCACAGGAGCAAGCGGTCGTCGTCGCACCCTGTCTTCCACCGGGGGGAGTTCTCGGTGTGCGACAGCGTCAGCGTGTGGGTGGGGGACAAGACCACCGCCACGGACATCAAGGGCAAGGAGGTGATGGTGCTGGGAGAGGTGAACATTAACAACAGTGTGTTCAAACAGTACTTTTTTGAGACCAAGTGCCGGGACCCCACTCCCGTGGACAGCGGGTGCAGGGGCATCGACTCGAAGCACTGGAACTCATACTGTACCACGACGCACACCTTCGTCAAGGCGCTGACCATGGACGGCAAGCAGGCCGCCTGGCGGTTCATCCGGATCGACACGGCCTGTGTGTGTGTGCTCAGCAGGAAGGCTGGGAGAAGAGCC Table 1 Primer sequences Table 2 Amplification of full-length FNGF PCR reaction system 2. Acquisition of cat nerve growth factor protein (FNGF-1) gene sequence and addition of restriction enzyme sites Gene and protein analysis tools such as Novofocus, Expasy, and SignalP-5.0 were used to analyze the FNGF gene sequence for signal peptides and hydrophobicity. Specifically, the full-length mRNA sequence of FNGF was downloaded from NCBI, and the locations of the signal peptides of two feline interferon genes were predicted using the SignalP-5.0 signal peptide prediction website. The results are as follows: Figure 2 As shown, the signal peptide of FNGF is located at amino acids 1-19 (MSMLSYTLITALLIGIQAE). After removing the signal peptide sequence and optimizing the codons, the result is shown in SEQ ID NO: 7. The codon fitness index (CAI) before optimization was 0.57, and after optimization, it was 0.77. The statistical data are shown below. Figure 3 As shown in Figure 4.

[0038] PCR amplification was performed using primer pairs with the signal peptide removed. EcoRI and XhoI restriction sites were introduced at the 5' and 3' ends of the primer gene fragments, respectively (underlined restriction site sequences). The upstream primer FNGF-1-F, downstream primer FNGF-1-R, and the codon-optimized template were synthesized by Shanghai Sangon Biotech Co., Ltd., and the specific primer sequences are shown in Table 1. The PCR amplification system is shown in Table 3. The reaction conditions were: 94℃ pre-denaturation for 5 min; 98℃ for 15 s; 55℃ for 15 s; 72℃ for 1 min; 30 cycles in total; final extension at 72℃ for 5 min; and storage at 4℃. The PCR product (the gene sequence encoding FNGF-1) was subjected to agarose gel electrophoresis at 120 V for 30 min. The electrophoresis results were observed using a UV gel imaging system. The results are shown below. Figure 5 As shown, from Figure 5 It can be seen that a single band was obtained between 750bp and 500bp, which is consistent with the expected size (683bp).

[0039] The FNGF sequence after removing the signal peptide and codon optimization is shown in SEQ ID NO: 7, and is referred to below as the coding sequence of FNGF-1: GAGCCGCACCCTGAATCCAACGTCCCGGCGGGCCATACCATCCCGCAGGCTCACTGGACGAAACTGCAACACTCCCTGGATACGGCCGCTGCGCCGCGCCCGCAGCACCCCGGCTGGCGCAATTGCCGCGCGCGTTGCGGGCCAGACCCGTAACATTACTGTCGACCC GAAACTGTTTAAAAAACGTCGCCTGCGTTCCCCGCGTGTACTGTTTTCCACTCACCCGCCTCCGGTGGCAGCAGACACCCAGGGTCTGGACCTGGAAGCAGGTGGTGCTGCGTCCTTCAACCGTACTCACCGCTCCAAGCGCTCCTCTTCCATCCGGTCTTTCACC GTGGCGAATTCAGCGTGTGTGACTCTGTTTCTGTATGGGTAGGTGACAAAACCACCGCGACGGACATCAAAGGCAAGGAAGTGATGGTGCTGGGCGAAGTCAACATCAACAACTCTGTGTTCAAACAGTACTTCTTCGAAACGAAATGCCGTGATCCTACCCCGGTC GATTCTGGTTGCCGTGGCATCGATTCCAAACACTGGAATTCCTACTGCACCACCACCCATACCTTTGTTAAAGCGCTGACTATGGACCGGTAAACAGGCAGCATGGGCTTTTCATCCGTATTGATACCGCCTGCGTTTGCGTTCTGTCTCGCAAAGCTGGCCGCCGTGCG Table 3. PCR reaction system for FNGF sequence with optimized amplified codons. 3. Construction of pET-32a-FNGF-1 prokaryotic expression vector The pET-32a prokaryotic expression vector was double-digested with EcoRI and XhoI, specifically using the digestion system shown in Table 4, at 37°C for 2 h. The pET-32a vector digestion product and the identified PCR product (coding sequence of FNGF-1) were subjected to 1% agarose gel electrophoresis and purified according to the instructions of the GenePrep Gel Extraction Kit.

[0040] Table 4 pET32a enzyme digestion system 4. Ligation of the pET-32a-FNGF-1 recombinant plasmid The gel-recovered fragment of the FNGF-1 coding sequence was digested according to the enzyme digestion system in Table 4 above. The digested prokaryotic expression vector pET-32a was then ligated using T4 ligase at 16℃ for 20 h. The ligation system is shown in Table 5.

[0041] Table 5 Recombinant plasmid ligation system 5. PCR identification of pET-32a-FNGF-1 bacterial culture After ligation, the entire plasmid was aspirated and mixed with DH5α competent cells. The mixture was incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, and then incubated on ice again for 2 min. 500 μL of antibiotic-free LB broth was added, and the mixture was shaken for 1 h (37℃, 200 rpm). After a brief centrifugation at 12000 rpm, the supernatant (300 μL) was discarded. The remaining plasmid was mixed with a pipette and spread onto agar plates containing ampicillin. The plates were incubated at 37℃ for 12 h. Single white, round colonies were picked and inoculated into 5 mL of ampicillin-resistant LB broth. The cells were incubated overnight at 37℃ with shaking at 200 rpm. The overnight culture was then subjected to PCR identification. The upstream primer used was T7-F. The reaction system is shown in Table 6. The results are as follows. Figure 6 As shown, from Figure 6 As can be seen, the nucleic acid gel band result is consistent with the expected size (1264 bp), and the sequencing results show a 100% match with the target sequence, indicating that the double enzyme digestion result is correct.

[0042] Table 6. Bacterial PCR Reaction System 6. Extraction of pET-32a-FNGF-1 plasmid Plasmids were extracted according to the Beyotime Plasmid Mini Preparation Kit instructions, as follows: (1) Take 1.5 ml of overnight bacteria, centrifuge at 5000g for 1 minute to collect bacterial precipitate, and discard the supernatant; repeat once more, and collect a total of 3 ml of overnight bacterial precipitate per tube.

[0043] (2) Add 250 μL of Solution I to each tube to resuspend the bacterial precipitate, ensuring that the precipitate is completely dispersed and there are no visible bacterial clumps.

[0044] (3) Add 250 μL of solution II to each tube and gently invert the centrifuge tube 4 to 6 times to completely lyse the bacteria and make the solution clear.

[0045] (4) Add 350 μL of solution III to each tube, then invert the centrifuge tube 4 to 6 times to mix. White flocculent material will be visible.

[0046] (5) Centrifuge at the highest speed (12,000 rpm to 14,000 rpm) at room temperature for 10 minutes.

[0047] (6) Pour or aspirate the supernatant from the previous centrifugation into the plasmid purification column; centrifuge at the highest speed for 30-60 seconds, and discard the liquid in the collection tube.

[0048] (7) Add 750 μL of solution IV to the plasmid purification column, centrifuge at the highest speed for 30-60 seconds to wash away impurities, and discard the liquid in the collection tube.

[0049] (8) Centrifuge at the highest speed for 1 minute to remove residual liquid and allow trace amounts of ethanol to evaporate completely.

[0050] (9) Place the plasmid purification column on a clean 1.5 mL centrifuge tube, add 50 μL of solution V to the column surface, and let stand for 1 minute.

[0051] (10) Centrifuge at the highest speed for 1 minute, and the resulting liquid is the high-purity plasmid pET-32a-FNGF-1.

[0052] 7. Identification by double enzyme digestion of pET-32a-FNGF-1 plasmid The extracted pET-32a-FNGF-1 plasmid was double-digested with EcoRI and XhoI in a 37°C water bath for 2 h. The double-digestion system is shown in Table 7. The successfully digested recombinant plasmids were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing identification. The correctly sequenced bacterial culture and plasmids were promptly preserved. The double-digestion identification results of the recombinant plasmids are shown in Table 7. Figure 7 As shown, the enzyme-digested plasmid appears as two segments: the target gene FNGF-1ru (approximately 683 bp) and the enzyme-digested pET-32a plasmid (approximately 5567 bp).

[0053] Table 7 pET-32a-FNGF-1 double enzyme digestion system 8. Resuscitation of pET-32a-FNGF-1 recombinant strain The pET-32a-FNGF-1 plasmid was mixed with competent E. coli BL21(DE3) cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, and then incubated on ice again for 2 min. 500 μL of antibiotic-free LB broth was added, and the mixture was shaken for 1 h (37℃, 200 rpm). After a brief centrifugation at 12000 rpm, the supernatant (300 μL) was discarded, and the remainder was mixed with a pipette and spread onto ampicillin-resistant plates. The plates were incubated upside down at 37℃ for 12 h. Single colonies were picked and inoculated into LB broth containing ampicillin, shaken at 180 rpm overnight to revive the pET-32a-FNGF-1 recombinant bacterial strain. The pET-32a-FNGF-1 recombinant bacterial colonies are shown in the image. Figure 8 As shown, from Figure 8 As can be seen from the data, the white colonies are recombinant bacterial colonies that have been introduced with the pET-32a-FNGF-1 plasmid.

[0054] 9. Expression and purification of recombinant protein FNGF-1 (1) Inoculate the revived bacterial culture into 5 mL of LB liquid medium containing ampicillin resistance, and continue to culture. Place it on a shaker and shake it at 180 rpm at 37°C until the bacteria reach OD. 600 Once the nm value reaches 0.4–0.6, add IPTG (0.2, 0.5, or 1 mmol / L) to the bacterial culture and continue induction culture at 180 rpm. Collect the induced bacterial culture during the culture period (0 h–6 h), collecting every 2 h. Wash the bacterial cells three times with PBS solution, add 5× SDS-PAGE loading buffer, mix well and disperse, then boil in boiling water for 10 min, followed by SDS-PAGE gel electrophoresis.

[0055] (2) Optimization of optimal temperature and induction time DH5α *E. coli* strain pET32a-FNGF-1 (derived from laboratory preservation), verified by sequencing, was expanded and plasmid extracted. This plasmid was then transformed into *E. coli* BL21(DE3) competent cells, and the optimal induction temperature and time were optimized. Specific conditions are shown in Table 8, and the results are as follows: Figure 9 As shown, the molecular weight of recombinant protein FNGF-1 is about 43.7 kDa, and the expression level of pET32a-FNGF-1 is highest after induction at 37℃ for 6 h.

[0056] Table 8. Conditions for Induced Expression (3) Solubility test and optimization of optimal IPTG concentration Under the optimal induction temperature and time (37℃, 6 h induction), the IPTG concentration was optimized, and solubility was tested. Specific induction conditions and solubility parameters are shown in Table 9. The results are as follows: Figure 10 As shown in the figure, pET32a-FNGF-1 was expressed at the highest concentration of IPTG at 1 mmol / L, and the molecular weight of the target protein was about 43.7 kDa, with most of it being inclusion body precipitates.

[0057] Table 9 Induction conditions and soluble test objects (4) Purification FNGF-1-inactivated BL21 glycerol bacteria were revived overnight at 37°C with shaking at 180 rpm. The revived bacteria were then amplified in large quantities in LB medium until OD200. 600 The concentration was approximately 0.6. After inducing expression for 6 h with IPTG at a final concentration of 1 mM, the bacterial cells were collected. The bacterial suspension was repeatedly freeze-thawed three times and sonicated. The bacterial suspension was then centrifuged at 8000 rpm for 20 min at 4°C, and the supernatant was collected. Impurities were removed using a filter. The protein purification column was washed with 10 times the column volume of deionized water (50 mL), and then bound to the column with 5 times the column volume of inclusion body binding buffer (25 mL). The FNGF-1 protein sample was loaded onto the column, ensuring slow efflux to ensure sufficient binding. The protein was then eluted with 5 times the column volume of inclusion body binding buffer (25 mL), and finally eluted with 5 times the column volume of inclusion body elution buffer (25 mL, containing 250 mM imidazole). The eluted protein sample was prepared and subjected to SDS-PAGE gel electrophoresis to determine the protein purification effect. The results are as follows: Figure 11 As shown.

[0058] (5) Renaturation The purified FNGF-1 protein was placed in a dialysis bag, and the bag was sequentially placed in refolding buffers containing different concentrations of urea (6M, 4M, 2M, and 0M) to refold the FNGF-1 protein into inclusion bodies. After refolding, the protein was dialyzed in K+-free PBS to remove imidazole. Dialysis was performed three times, with the buffer changed every 8–10 hours during both refolding and dialysis.

[0059] from Figure 11It can be seen that, after large-scale cultivation under optimal conditions, followed by nickel column loading and elution, relatively pure FNGF-1 protein can be obtained at approximately 43.7 kDa, with a molecular weight of about 43.7 kDa. In the figures, M: protein molecular weight standard; 1: flow-through after protein loading; 2: whole pET-32a-FNGF-1 expressing bacteria; 3: pET-32a-FNGF-1 expressing bacteria precipitate; 4-9: products from collection tubes 1-6 during purification elution, respectively.

[0060] (6) Immunoblot test of FNGF-1 protein and anti-His tag antibody The prokaryotically expressed FNGF-1 protein was transferred to a PVDF membrane via SDS-PAGE, and Western blot analysis was performed using purified His-tagged antibody as the primary antibody and HRP-labeled goat anti-mouse IgG as the secondary antibody. The results are as follows: Figure 12 As shown, the His-tagged antibody can specifically react with the FNGF-1 protein, and a specific band appears at around 43.7 kDa.

[0061] (7) Immunoblot test of FNGF-1 protein and commercial NGF antibody The recombinant NGF protein expressed in prokaryotes was transferred to a PVDF membrane via SDS-PAGE. Western blot analysis was performed using a commercially available NGF antibody as the primary antibody and HRP-labeled goat anti-mouse IgG as the secondary antibody. The results are as follows: Figure 13 As shown, commercially available NGF antibodies can specifically react with FNGF-1 protein, producing a specific band at approximately 43.7 kDa.

[0062] Example 2 - Activity Identification of FNGF-1 This embodiment is based on the feline nerve growth factor FNGF-1 prepared in Example 1, and its activity was identified. In this embodiment, the activity of FNGF-1 was preliminarily identified through an induced PC12 cell differentiation experiment. Only FNGF-1 with good biological activity can have medicinal value. In this embodiment, the degradation of FNGF-1 stored for 6 months was first analyzed, and the concentration of FNGF-1 was further determined, thus providing experimental materials for further experiments in terms of both qualitative and quantitative analysis.

[0063] 1. Determine the stability of FNGF-1 protein samples The concentration of purified FNGF-1 protein samples was determined, and the degradation of FNGF-1 protein during purification and storage at -20℃ for 3 months was analyzed. SDS-PAGE and Coomassie Brilliant Blue staining were primarily used to determine the concentration of FNGF-1 samples for activity identification; ImageJ software was used to analyze whether FNGF-1 was degraded during storage. The specific steps are as follows.

[0064] (1) Preparation of electrophoresis samples: Take 200 μL LFNGF-1 in a clean bench and add 50 μL 5× Loadingbuffer. Mix thoroughly and then boil the sample in a dry bath at 95℃ for 10 min.

[0065] (2) Samples were separated using 10% SDS-PAGE gel, stained with Coomassie Brilliant Blue G-250, and destained with acetic acid. ImageJ software was used to analyze sample concentration and detect degradation. The results are as follows: Figure 14 As shown.

[0066] As shown in the figure, the FNGF-1 protein appears as a single band on the gel, and the position of the band does not change before and after purification or freezing. According to ImageJ software analysis, the purity of the purified FNGF-1 protein is about 90%, indicating that the FNGF-1 protein did not degrade during the purification process and under the condition of storage at -20℃ for 3 months, and its molecular weight is about 43.7kDa.

[0067] 2. PC12 induction method for detecting FNGF-1 activity (1) PC12 cells (derived from Pronosei Biotechnology) were cultured in 1640 complete medium (containing 5% FBS and 10% HS) at 37 ℃ and 5% CO2. The cells were spaced at 3 × 10⁶ cells per well. 5 One cell was seeded in a 12-well plate.

[0068] (2) After 18 h, remove the culture medium, add 1 mL of fresh culture medium to each well, and add 100 ng of FNGF-1 to make a final concentration of 100 ng / mL. Incubate in a carbon dioxide incubator at 37℃ and 5% CO2. Use injectable mNGF (Sutaisheng) with the same final concentration as the positive control group. Each drug group is repeated 6 times (n = 6).

[0069] (3) Observe the morphology of PC12 cells under a microscope after 24 h and 48 h.

[0070] The results are as follows Figure 15 , Figure 16 , Figure 17As shown in the figure. A: Blank group after 24 h; B: Induction with pET-32a 100 ng / mL for 24 h; C: Induction with FNGF-1 protein 100 ng / mL for 24 h; D: Blank group after 48 h; E: Induction with pET-32a 100 ng / mL for 48 h; F: Induction with FNGF-1 protein 100 ng / mL for 48 h.

[0071] from Figure 15 It can be seen that significant cell differentiation was observed in all FNGF-1 groups, while no significant cell differentiation was observed in the blank group and pET32a group; from Figure 16 It can be seen that, regarding the positive differentiation rate of cells in the FNGF-1 group, no cell differentiation was observed in the PBS group and the pET32a group, while the differentiation rate in the FNGF-1 group reached approximately 40%. Figure 17 The results show that the average axon length of positive cells after FNGF-1 differentiation exceeds 40 μm, indicating that FNGF-1 can differentiate PC12 cells, thus proving its biological activity.

[0072] Example 3 - Effect of FNGF-1 on the repair of neurotrophic corneal ulcers in rats This embodiment investigates the effect of feline nerve growth factor FNGF-1 prepared in Example 2 on the repair of neurotrophic corneal ulcers in rats.

[0073] 1. Establishment of a rat model of neurotrophic keratitis induced by capsaicin. A neurotrophic keratitis model was induced in Wistar rats (from Qinglongshan Experimental Animal Center) by a single subcutaneous injection of 50 mg / kg capsaicin into the neck. Four weeks later, the difference in paw licking or paw-raising time between the neurotrophic keratitis rats and the control group was recorded using a hot plate test. The rats were randomly divided into two groups according to their body weight: a control group (n=6) and a model group (n=30). The model group was further subdivided into a control group (treated with saline), a pET32a group (treated with pET32a empty vector protein), a TB group (treated with tobramycin), an FNGF-1 group (treated with FNGF-1 protein), and a TB+FNGF-1 group (treated with a combination of tobramycin and FNGF-1).

[0074] In the model group, rats were subcutaneously injected in the neck with solvents and capsaicin solutions according to different subgroups. The solvents were 10% ethanol, 10% saline, and 80% PBS. The capsaicin solution was prepared with solvents at a dosage of 50 mg / kg, and the administration volume was 50 μL. The rats were fed after injection. Four weeks after modeling, the rats were examined. Rats with capsaicin-induced neurotrophic keratitis and rats in the age-matched control group were selected. A circular filter paper with a diameter of 5 mm was taken and immersed in 1 mol / L NaOH solution for 20 s. It was removed with clean surgical forceps and placed on dry, clean filter paper for 1 s to remove excess liquid. Then, it was immediately and gently applied to the corneal surface of the test eye for 30 s. The filter paper was removed, and the burned area and conjunctival sac were immediately rinsed thoroughly with 0.9% NaCl injection solution for 7 min.

[0075] 2. Evaluation of the effect of establishing the capsaicin model group in rats Because injecting capsaicin into rats induces selective sensory nerve inactivation, followed by slow and incomplete regeneration of surrounding sensory fibers in the animal body, the Schirmer tear secretion test and hot plate test were used to evaluate the modeling effect of capsaicin.

[0076] The test eye was assessed for corneal ulceration, corneal inflammation, and fluorescein sodium ophthalmological examination before treatment and at 3, 7, and 14 days after treatment. The Schirmer test was performed before treatment and at 14 days after treatment.

[0077] (1) Schirmer tear secretion test Before the experiment, without any pretreatment and after model establishment, the tear volume of rats was measured and recorded 30 seconds 14 days after treatment. Wearing disposable latex gloves, the Schirmer test tear volume strip was taken out, and a crease was made at the front horizontal line of the strip. Then, with the animal at rest, the lower eyelid was everted, and the creased end of the strip was placed into the lower eyelid conjunctival sac. The time was 30 seconds, and the strip was removed immediately, and the data was recorded. The results are as follows: Figure 18 As shown, from Figure 18 It can be seen from the tear film experiment comparison that the tear secretion volume in the blank group was significantly higher than that in the model group.

[0078] (2) FNGF-1 concentration screening experiment To determine the optimal FNGF-1 concentration required for specific animal experiments, rats using the model were subjected to a Schirmer tear secretion pre-test according to the above-described grouping method. After 14 days of treatment, the tear volume of the rats was measured and recorded over 30 seconds. The results are as follows: Figure 19 As shown.

[0079] FNGF-1 was prepared at different concentrations: 60 μg / mL, 90 μg / mL, and 120 μg / mL.

[0080] In this embodiment, FNGF-1 is mixed with physiological saline to prepare a solution.

[0081] The rat model used in this experiment was the same as that induced by capsaicin in rats with neurotrophic keratitis (n=6). The four groups were the blank group, the 60 μg / mL group, the 90 μg / mL group, and the 120 μg / mL group.

[0082] Control group: 1 drop of physiological saline solution was added to the eyes of rats 3 times a day. After the eye was closed for 10 minutes, the eye drops were continuously applied for 14 days.

[0083] 60 μg / mL group: 1 drop of FNGF-1 (concentration 60 μg / mL) 3 times / day. After administration, the eyes of the treatment group were closed for 10 minutes. The administration was continued for 14 days.

[0084] 90 μg / mL group: 1 drop of FNGF-1 (concentration 90 μg / mL) 3 times / day. After administration, the eyes of the treatment group were closed for 10 minutes. The administration was continued for 14 days.

[0085] 120 μg / mL group: 1 drop of FNGF-1 (concentration 120 μg / mL) 3 times / day. After administration, the eyes of the treatment group were closed for 10 minutes. The administration was continued for 14 days.

[0086] from Figure 19 It can be seen that the tear recovery volume of the group using FNGF-1 was significantly better than that of the blank group, and the effect was best when the FNGF-1 concentration was 120 μg / mL.

[0087] (3) Hot plate experiment After modeling, a hot plate device was used to stimulate the rats' paws by heating the area under their toes. The rats were observed to withdraw their paws or lick their feet to elicit different paw withdrawal thresholds (PWTs), thus reflecting their thermal pain behavior. The hot plate device temperature was calibrated to 55°C, with a temperature error not exceeding 0.2°C. Mice were placed on the hot plate surface, and the time it took for the rats to withdraw or lick their paws was recorded. The results are shown in Figure 20.

[0088] from Figure 20 It can be seen that, compared with the blank control, the withdrawal time of rats in the hot plate test was significantly prolonged after capsaicin modeling; this proves that capsaicin does indeed affect the surrounding sensory fibers. In the figure, different letters represent significant differences.

[0089] 3. Effects of FNGF-1 on the repair of neurotrophic corneal ulcers in rats This experiment used rats in the model group of a rat model of neurotrophic keratitis induced by capsaicin as experimental subjects, with 6 rats randomly assigned to each group.

[0090] (1) Preparation of ophthalmic medications: ①FNGF-1 ophthalmic solution: Mix an appropriate amount of FNGF-1 with physiological saline to prepare an FNGF-1 ophthalmic solution with a concentration of 120 μg / mL; ② Tobramycin ophthalmic solution: Mix an appropriate amount of tobramycin with physiological saline to prepare a tobramycin ophthalmic solution with a mass fraction of 0.3%; ③ Compound ophthalmic medication: Take appropriate amounts of FNGF-1 and tobramycin and mix them with physiological saline to prepare a mixed solution with an FNGF-1 concentration of 120 μg / mL and a tobramycin weight ratio of 0.3%, which is used as a mixed ophthalmic medication.

[0091] In this embodiment, physiological saline is used. In practice, the solvent can be adjusted accordingly and excipients can be added, such as benzalkonium bromide, borax borate, sodium hyaluronate, disodium hydrogen phosphate, sodium dihydrogen phosphate, etc.

[0092] (2) Experimental design: Model control group: 1 drop of physiological saline solution was added to the eyes of rats 3 times a day. After the eye was closed for 10 minutes, the eye drops were continuously applied for 14 days.

[0093] pET32a empty protein negative control group: 1 drop of pET32a empty protein complex solution (120 μg / mL) was added to the eyes of rats 3 times a day. After administration, the eyes of the treatment group were closed for 10 minutes. The administration was continued for 14 days.

[0094] Tobramycin treatment group: 1 drop of 0.3% tobramycin ophthalmic solution was instilled into the eyes of rats 3 times a day. The eyes were closed for 10 minutes after administration, and the administration was continued for 14 days.

[0095] FNGF-1 treatment group: 1 drop of FNGF-1 ophthalmic solution (concentration 120 μg / mL), 3 times / day. After administration, the eyes of the treatment group were closed for 10 minutes, and the administration was continued for 14 days.

[0096] Combined treatment group: 1 drop of mixed ophthalmic solution (a mixed solution of 120 μg / mL FNGF-1 and 0.3% tobramycin) was instilled into the eyes of rats 3 times a day. After administration, the eyes of the treatment group were closed for 10 minutes. The administration was continued for 14 days.

[0097] (3) Experimental treatment: ①Schirmer tear test: After 14 days of treatment, the tear volume of rats was measured and recorded over 30 seconds. ②After the above treatment was completed, the rats were euthanized and their eyes were removed for fluorescein staining experiments and corneal histopathological observation.

[0098] The results are as follows Figure 21 As shown in the figure, the tear experiment showed no significant differences before and after treatment in the untreated group, the blank group after modeling, and the pET32a protein group after modeling. However, in the tobramycin group, there were significant differences between the FNGF-1 group and the tobramycin combined with FNGF-1 group, with the tobramycin combined with FNGF-1 group showing a more significant difference, resulting in more tear secretion after treatment compared to before treatment.

[0099] (4) Fluorescein staining Take out the sodium fluorescein ophthalmic test strip, insert it into a clean 2 mL centrifuge tube, and add 1 mL of 0.9% NaCl injection solution to the tube. Mix the liquid with a dropper, take one drop of the sodium fluorescein mixture and drop it onto the corneal surface of the test eye. Then drop a few drops of 0.9% NaCl injection solution onto the ocular surface and observe the color change of the corneal surface. If the cornea is stained with a yellow-green fluorescent color, it is a positive result for sodium fluorescein staining. After observation, rinse the ocular surface with 0.9% NaCl injection solution.

[0100] The scoring was based on the Ando et al. corneal inflammation scoring criteria, and the specific scoring criteria are shown in Table 10.

[0101] Table 10 Scoring criteria for corneal inflammation, including Ando et al. Using sodium fluorescein ophthalmic test strips (Jingming New Technology Tianjin Development Co., Ltd.), the corneal surface was stained with sodium fluorescein. The corneal ulcer scoring criteria were applied according to the Trousdale et al. scoring system; the specific scoring criteria are shown in Table 11.

[0102] Table 11 Trousdale et al. corneal ulcer scoring criteria Each experimental group was scored according to the above scoring criteria, and the corneal ulcer scoring results for each group are as follows: Figure 22 As shown in the figure, the ulcer scores of the TB group, FNGF-1 group and TB+FNGF-1 group were significantly lower than those of pET32a and the control group, and the TB+FNGF-1 group was better than the TB-only group and the FNGF-1 group.

[0103] Results of sodium fluorescein in each group are as follows Figure 23 As shown in the figure, the recovery effects of the TB group and the TB+FNGF-1 group were significantly better than those of the pET32a group and the control group, and the effect of the TB+FNGF-1 group was better than that of the TB group after 14 days. This indicates that FNGF-1 has a good adjuvant therapeutic effect.

[0104] The results of the fluorescein sodium score are as follows Figure 24As shown in the figure, the fluorescein sodium scores of the TB group and the TB+FNGF-1 group were significantly lower than those of the pET32a and the control group, and the TB+FNGF-1 group showed a slightly better effect than the TB-only treatment group. This indicates that FNGF-1 has a good adjuvant therapeutic effect.

[0105] (4) Histopathological observation of corneal tissue Fourteen days after treatment, rats were sacrificed, and their eyeballs were harvested. Histological sections were prepared and stained with hematoxylin and eosin (HE). The sections were then observed under a light microscope to analyze corneal damage repair and inflammatory infiltration. The results are as follows: Figure 25 As shown.

[0106] from Figure 25 It can be seen that the pathological sections were normal before modeling ( Figure 25 Part A), corneal ulceration occurred after modeling, accompanied by full-thickness epithelial defect and localized collagen fiber lysis and necrosis in the stromal layer ( Figure 25 Part B); using only the saline group (as in Part C of 25) and the pET32a protein group ( Figure 25 (Part D) After 14 days, the epithelial layer still showed no repair, with visible collagen fiber dissolution and necrosis; from Figure 25 As shown in sections E and F, epithelial repair was observed in both the tobramycin group (E) and the FNGF-1 group (F), but intratissue vacuoles were still visible. Figure 25 As shown in the middle G section, in the FNGF-1+TB group, the epithelium has been repaired and the corneal stroma has recovered well.

[0107] In summary, this invention utilizes a prokaryotic system to express recombinant feline nerve growth factor (FNGF-1). Western blot results showed that FNGF-1 reacted positively with both His-tagged antibodies and commercially available NGF antibodies, verifying its superior stability. PC12 cell induction experiments further validated the biological activity of FNGF-1. The combination of FNGF-1 and tobramycin significantly improved the treatment effect on neurotrophic corneal ulcers compared to the tobramycin-treated group, demonstrating that recombinant feline nerve growth factor possesses both biological activity and a certain adjuvant therapeutic effect. Compared to traditional extraction methods for producing nerve growth factor, the method of preparing recombinant feline nerve growth factor in this invention significantly reduces production costs, making it more suitable for large-scale production. Furthermore, it exhibits superior homology when applied to pet cats, demonstrating significant application value and broad prospects in the preparation of therapeutic agents for neurotrophic keratitis and neurotrophic corneal ulcers in pets.

[0108] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. An ophthalmic medication for neurotrophic eye disease in pets, characterized in that, The active ingredients of the ophthalmic medication include feline nerve growth factor and tobramycin, wherein the concentration of feline nerve growth factor in the ophthalmic medication is 60~150 μg / mL; and the weight percentage of tobramycin is 0.2~0.5%.

2. The ophthalmic medication according to claim 1, characterized in that, The nucleic acid sequence encoding the feline nerve growth factor is shown in SEQ ID NO: 1 or SEQ ID NO:

7.

3. The ophthalmic medication according to claim 1, characterized in that, The molecular weight of the feline nerve growth factor is 43.7 kDa.

4. The ophthalmic medication according to claim 1, characterized in that, The dosage form of the ophthalmic medication is drops, ointment, or gel.

5. The ophthalmic medication according to claim 1, characterized in that, The neurotrophic eye diseases include neurotrophic keratitis and neurotrophic corneal ulcers.

6. A method of using an ophthalmic medication as described in any one of claims 1 to 5, characterized in that, The method of use is as follows: apply the ophthalmic medication to the pet's eyes, 1-2 drops each time, 1-3 times a day. After administration, close the eyes for 8-12 minutes, and continue administration for 7-21 days.

7. A method for preparing an ophthalmic agent as described in any one of claims 1 to 6, characterized in that, Includes the following steps: S1. Total RNA was extracted from cat tissues, and cDNA was synthesized by reverse transcription. The cDNA was then used as a template and amplified by PCR to obtain the nucleic acid sequence encoding cat nerve growth factor. S2. The nucleic acid sequence encoding cat nerve growth factor obtained in step S1 is digested with double enzymes, ligated with a plasmid vector, and transformed to obtain recombinant bacteria. The recombinant bacteria are then amplified and cultured before being extracted to obtain recombinant plasmids. S3. Construct an Escherichia coli expression bacterium with the obtained recombinant plasmid, induce expression, and then purify and renature it to obtain the feline nerve growth factor. Mix the feline nerve growth factor and tobramycin to prepare a mixed solution to obtain an ophthalmic drug.

8. The preparation method according to claim 8, characterized in that, In step S1, the PCR amplification system consists of: 25 μL PCR reaction premix, 2 μL upstream primer, 2 μL downstream primer, 2 μL DNA template, and deionized water to a final volume of 50 μL; and / or In step S1, the PCR reaction conditions are as follows: pre-denaturation: 94℃, 5 min; denaturation: 98℃, 15 s; annealing: 55℃, 15 s. Extension: 72℃, 1 min; 30 cycles; and / or In step S1, the sequences of the primers used in PCR amplification are shown in SEQ ID NO: 4~SEQ ID NO:

5.

9. The preparation method according to claim 7, characterized in that, In step S3, the induction temperature is 16~37℃; and / or In step S3, the induction time is 2-6 hours; and / or In step S3, the concentration of the inducing agent IPTG is 0.2~1 mmol / L; and / or In step S3, the purity of the obtained feline nerve growth factor is greater than 90%; and / or In step S3, the concentration of feline nerve growth factor in the mixed solution is 60-150 μg / mL; and the weight percentage of tobramycin is 0.2-0.5%.

10. The application of an ophthalmic agent as described in any one of claims 1 to 5, or an ophthalmic agent prepared by the method of use as described in claim 6, or by the preparation method as described in any one of claims 7 to 9, characterized in that, The application is in the preparation of medications for neurotrophic eye diseases in pets, including neurotrophic keratitis and neurotrophic corneal ulcers.

Images