Application of DDIT4 in treatment of vascular restenosis

Abstract

The invention provides an application of DDIT4 in treatment of vascular restenosis. The DDIT4 gene is found to be capable of serving as a treatment target of vascular restenosis for the first time through a large number of researches. The specific knockout or inhibition of the expression of the DDIT4 gene can effectively inhibit the proliferation of vascular smooth muscle cells, inhibit the dedifferentiation of the vascular smooth muscle cells, promote the differentiation of the vascular smooth muscle cells, and reduce the ratio of the neointima area to the intima area of a mouse femoral artery guide wire injury model. Therefore, the reagent for specifically knocking out the DDIT4 gene and the reagent for inhibiting the expression of the DDIT4 gene can be used for preparing the medicine for treating the vascular restenosis. The invention provides a new target spot and thought for the treatment of vascular restenosis.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of DDIT4 in the treatment of vascular restenosis. Background Technology

[0002] Restenosis refers to the recurrence of narrowing or blockage in a blood vessel after interventional treatment (such as balloon angioplasty or stent implantation) at the original treatment site. The main pathological process of restenosis is not atherosclerosis, but rather the proliferation, migration, and extracellular matrix secretion of vascular smooth muscle cells triggered by mechanical injury, leading to thickening of the vessel wall and narrowing of the lumen. This process is known as neointimal hyperplasia.

[0003] Restenosis is not a recurrence of disease, but rather an over-healing response of the blood vessel to treatment damage. Its main mechanisms include: (1) Intimal hyperplasia, the core reason being that during balloon dilation or stent implantation, the smooth muscle cells of the vascular wall are damaged and stretched. In order to repair this damage, the smooth muscle cells of the vascular media are activated and proliferate and migrate to the vascular intima in large quantities. At the same time, the extracellular matrix also increases. These over-proliferated tissues (like scars) accumulate in the lumen, causing the lumen to narrow again and blood flow to be obstructed. This is the main pathological basis of restenosis. (2) Vascular remodeling: refers to the structural changes of the entire vascular wall after injury, which causes the entire vascular vessel to narrow inward, further aggravating the narrowing of the lumen. (3) Thrombosis: the stent itself, as a foreign body, may activate platelets and the coagulation system to form thrombi. Although acute thrombosis is now uncommon, persistent, chronic inflammation and microthrombus formation can stimulate intimal hyperplasia.

[0004] Currently, there are several methods to reduce the incidence of restenosis, such as: (1) After balloon angioplasty (PTCA), simply implanting a metal stent can effectively support the blood vessel and prevent its elastic recoil. However, in this case, the stent itself can stimulate intimal hyperplasia, and the problem still exists. (2) Drug-eluting stents: A layer of polymer and anti-proliferative drugs (such as sirolimus and zotamoxetine) are coated on a metal stent. After stent implantation, the drug is slowly released over several weeks to months, inhibiting excessive proliferation of local smooth muscle cells. Then, the long-term inflammation caused by the polymer carrier can lead to thrombus formation in the stent in a very late stage.

[0005] Therefore, there is a need in this field for more new targets that can effectively inhibit neointimal hyperplasia and treat restenosis. Summary of the Invention

[0006] Based on this, the purpose of this invention is to provide the application of DDIT4 in the treatment of restenosis, and the DDIT4 gene can serve as a new target for the treatment of restenosis.

[0007] To achieve the above objectives, the present invention adopts the following technical solution.

[0008] In a first aspect, the invention provides the use of a reagent for knocking out the DDIT4 gene in the preparation of a medicament for treating restenosis.

[0009] In some embodiments, the reagent is a CRISPR-Cas system.

[0010] In some embodiments, the reagent is a CRISPR-Cas9 system.

[0011] In a second aspect, the invention provides the use of an agent that inhibits DDIT4 gene expression in the preparation of a medicament for treating restenosis.

[0012] In some embodiments, the reagents include RNA interference reagents and small molecule inhibitors.

[0013] In some embodiments, the RNA interference reagent includes siRNA, shRNA or their recombinant expression vector, or miRNA.

[0014] In some embodiments, the RNA interference reagent is shRNA or its recombinant expression vector, and the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1.

[0015] In some embodiments, the recombinant expression vector includes a recombinant adenovirus vector and a recombinant adeno-associated virus vector.

[0016] In some embodiments, the recombinant adeno-associated virus vector is a recombinant adeno-associated virus type 9 vector.

[0017] In some implementations, the application includes any one or more of the following (1) to (4): (1) Inhibits the proliferation of vascular smooth muscle cells; (2) Inhibits the dedifferentiation of vascular smooth muscle cells; (3) Promotes the differentiation of vascular smooth muscle cells; (4) Reduce the ratio of neointimal area to media area after vascular injury.

[0018] A third aspect of the present invention provides a medicament for treating restenosis, the medicament comprising an active ingredient and pharmaceutically acceptable excipients; The active ingredients include reagents that knock out the DDIT4 gene and / or reagents that inhibit DDIT4 gene expression.

[0019] In some embodiments, the reagent for knocking out the DDIT4 gene is a CRISPR-Cas system, preferably a CRISPR-Cas9 system.

[0020] In some embodiments, the inhibition of DDIT4 gene expression includes RNA interference reagents and small molecule inhibitors.

[0021] In some embodiments, the RNA interference reagent includes siRNA, shRNA or their recombinant expression vector, or miRNA.

[0022] In some embodiments, the active ingredient is shRNA or its recombinant expression vector, and the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1.

[0023] In some embodiments, the recombinant expression vector is a recombinant adenovirus vector or a recombinant adeno-associated virus vector.

[0024] In some embodiments, the recombinant adeno-associated virus vector is a recombinant adeno-associated virus type 9 vector.

[0025] Compared with the prior art, the present invention has the following beneficial effects.

[0026] This invention, through extensive research, is the first to discover that the DDIT4 gene can serve as a therapeutic target for vascular restenosis. Specific knockout or inhibition of DDIT4 gene expression effectively suppresses vascular smooth muscle cell proliferation, inhibits vascular smooth muscle cell dedifferentiation, promotes vascular smooth muscle cell differentiation, and reduces the neointimal to media area ratio in a mouse femoral artery guidewire injury model. Therefore, reagents for specifically knocking out the DDIT4 gene and reagents for inhibiting DDIT4 gene expression can be used to prepare drugs for treating vascular restenosis.

[0027] This invention provides new targets and approaches for the treatment of vascular restenosis. Attached Figure Description

[0028] Figure 1 These are experimental results regarding the effects of the DDIT4 gene on the proliferation and phenotypic transformation of primary human vascular smooth muscle cells.

[0029] Figure 2 This study demonstrates that knocking down DDIT4 under PDGF-BB or IL-1β stimulation can inhibit the proliferation and phenotypic transformation of primary human vascular smooth muscle cells.

[0030] Figure 3 AAV-mediated smooth muscle cell-specific delivery of the Ddit4 gene exacerbates the results of mouse endometrial hyperplasia experiments.

[0031] Figure 4 The results of experiments showed that knocking out Ddit4 specifically in smooth muscle cells could alleviate neointimal hyperplasia in mice. Detailed Implementation

[0032] Experimental methods in the following embodiments of the present invention, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the embodiments are commercially available products.

[0033] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0034] The terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device that includes a series of steps is not limited to the steps or modules listed, but may optionally include steps not listed, or may optionally include other steps inherent to such process, method, product, or device.

[0035] The term "and / or" as used in this invention describes the relationship between related objects, indicating that there can be three relationships. For example, A and / or B can represent three situations: A exists alone, A and B exist simultaneously, and B exists alone.

[0036] The following description is based on specific implementation methods. Example 1

[0037] In this embodiment, the DDIT4 gene was overexpressed or suppressed in human aortic smooth muscle cells (HASMCs) to study the effects of the DDIT4 gene on the proliferation, dedifferentiation, and differentiation of human aortic smooth muscle cells.

[0038] I. Experimental Methods The DDIT4 gene was overexpressed using the adenovirus vector Ad-DDIT4, and the DDIT4 gene expression was inhibited using the adenovirus vector shRNA-DDIT4.

[0039] adenovirus vector shRNA-DDIT4 Vector skeleton name: GV119; Component sequence: hU6-MCS-CMV-EGFP; Reference number: CON098; shRNA-DDIT4 insertion sequence: CCGGTTCCGAGTCATCAAGAAGAAGCTCGAGCTTCTTCTTGATGACTCGGAATTTTTG (SEQ ID NO: 1).

[0040] Adenovirus vector Ad-DDIT4 Gene name: DDIT4(NM_019058); Species: Human; Carrier skeleton name: GV315; Component sequence: CMV-MCS-SV40-EGFP; Cloning site: AgeI / NheI; Reference number: CON267.

[0041] The adenovirus vector Ad-DDIT4, the adenovirus vector shRNA-DDIT4, and the corresponding control vectors were all packaged and provided by Shanghai Jikai Gene Technology Co., Ltd.

[0042] Infection procedure: Adenovirus solution was added directly to HASMCs cultured in complete culture medium at a dose with an infection coefficient (MOI) of 100. The culture medium was replaced with fresh medium after 48 hours.

[0043] HASMCs were cultured in a vascular cell culture medium supplemented with cell growth factors. The final composition of the culture medium was: 5 ng / mL recombinant human fibroblast growth factor (FGF), 5 ng / mL recombinant human epidermal growth factor (EGF), 5 μg / mL recombinant human insulin, 10 mM L-glutamine, 50 μg / mL ascorbic acid, and 5% fetal bovine serum.

[0044] 1. Transcriptome sequencing Primary HASMCs were overexpressed using an adenovirus vector (Ad-DDIT4) or with DDIT4 interference (shRNA-DDIT4), with an empty adenovirus vector serving as a negative control (NC). Total RNA was extracted from the cells using the TRIzol reagent method and sent to BGI Genomics Co., Ltd. in Shenzhen for transcriptome sequencing library construction. Quality-tested samples were sequenced using the Illumina NovaSeq 6000 platform. To systematically reveal the gene expression patterns regulated by DDIT4, we performed cluster analysis on differentially expressed genes (DEGs), and the clustering results are visualized as a heatmap.

[0045] 2. Cell proliferation assay (CCK-8 assay) To investigate the effect of the DDIT4 gene on cell proliferation, the CCK-8 assay was used. HASMCs in logarithmic growth phase were digested, resuspended, and seeded at a density of 5 × 10³ cells per well in 96-well plates, with 100 μL of culture medium per well. After complete cell adhesion, the gene was overexpressed using an adenovirus vector (Ad-DDIT4) or by interference with DDIT4 (shRNA-DDIT4). Forty-eight hours after viral infection, 10 μL of CCK-8 solution was added to each well. The plates were incubated at 37°C in the dark for 2 hours. Subsequently, the absorbance of each well was measured at 450 nm using a microplate reader.

[0046] 3. EdU staining To directly observe the effect of the DDIT4 gene on DNA replication and proliferation of vascular smooth muscle cells, EdU staining was used for detection. HASMCs in logarithmic growth phase were seeded in 24-well plates. After complete cell adhesion, the gene was overexpressed using an adenovirus vector (Ad-DDIT4) or interfered with (shRNA-DDIT4). Forty-eight hours after viral infection, a final concentration of 10 μL of EdU solution was added to each well of the culture medium, and the cells were incubated at 37°C for another 2 hours to allow the cells undergoing DNA synthesis to incorporate EdU. After incubation, the culture medium was discarded, and cells were fixed with 4% paraformaldehyde for 15 minutes, followed by permeation with 0.5% Triton X-100 for 10 minutes. Following the Click-iT EdU assay kit instructions, working solution containing AlexFluor 555-labeled azide was added, and the cells were incubated at room temperature in the dark for 30 minutes. Cell nuclei were stained with Hoechst 33342 for 30 minutes. Images were randomly selected from the field of view using a fluorescence microscope. EdU-positive cells (red fluorescence) represent cells in the proliferative phase. The cell proliferation rate was calculated by counting the total number of cells per field (blue fluorescence) and the number of EdU-positive cells using ImageJ software.

[0047] 4. Immunofluorescence staining To investigate the effects of the DDIT4 gene on the expression of vascular smooth muscle cell marker proteins and cell morphology, immunofluorescence staining was used to examine ACTA2. HASMCs were seeded in laser confocal microscopy dishes and overexpressed (Ad-DDIT4) or interfered with (shRNA-DDIT4) the gene. Forty-eight hours after adenovirus infection, the culture medium was discarded, cells were fixed with 4% paraformaldehyde for 15 minutes, then permeated with 0.1% Triton X-100 for 10 minutes, blocked with 5% bovine serum albumin (BSA) at room temperature for 1 hour, and incubated overnight at 4°C with Alexa Fluor 488-conjugated ACTA2 primary antibody working solution. The nuclei were then counterstained with Hoechst 33342 staining solution for 30 minutes. Finally, images were acquired using a laser confocal microscope to observe the cell morphology of HASMCs.

[0048] 5. Western blot HASMCs were lysed on ice for 30 minutes using RIPA lysis buffer (containing protease and phosphatase inhibitors), followed by centrifugation at 12,000 rpm for 15 minutes at 4°C. The supernatant was collected as the total protein sample. Protein concentration was determined using the BCA method. Samples were diluted to a uniform concentration using loading buff and denatured by boiling in a 100°C metal bath for 5 minutes. Equal amounts of denatured protein samples (10-40 μg) were separated by SDS-polyacrylamide gel electrophoresis. Proteins were transferred from the gel to a PVDF membrane using wet transfer. The membrane was blocked with 5% skim milk TBST at room temperature for 1 hour, incubated with primary antibody overnight at 4°C, washed with TBST solution, and then incubated with horseradish peroxidase-labeled secondary antibody at room temperature for 1 hour. Images were acquired using ECL chemiluminescence reagent under a chemiluminescence imaging system, and the grayscale values ​​of the target bands were quantitatively analyzed using ImageJ software.

[0049] 6. Knockdown of the DDIT4 gene under PDGF-BB or IL-1β stimulation Add 20 ng / mL (final concentration) PDGF-BB or 10 ng / mL (final concentration) IL-1β to the HASMC culture system, interfere with the DDIT4 gene using the above-mentioned adenovirus vector (shRNA-DDIT4), and then use Western blot to detect the protein levels of DDIT4 and smooth muscle cell contraction markers. EdU staining is used to detect proliferation, and the method is the same as above.

[0050] II. Experimental Results Figure 1The results show the effects of DDIT4 on the proliferation and phenotype transition of primary human vascular smooth muscle cells. All data are expressed as mean ± standard error of mean; *P < 0.05, **P < 0.01 for comparisons shown in the figure.

[0051] The heatmap shows differentially expressed genes obtained by RNA sequencing in HASMCs infected with NC or Ad-DDIT4. Figure 1 A).

[0052] Figure 1 B represents the use of the Cell Counting Kit-8 (CCK-8) method to detect the proliferation of HASMCs infected with NC or Ad-DDIT4 (n = 12). Figure 1 C shows a representative EdU staining image of HASMCs infected with NC or Ad-DDIT4. Figure 1 D represents the quantitative EdU detection data (n=6). The results indicate that overexpression of the DDIT4 gene can promote the proliferation of HASMCs.

[0053] Figure 1 E shows the immunofluorescence staining of ACTA2 (red) in HASMCs infected with NC or Ad-DDIT4. ACTA2 is one of the most specific and important markers of mature, differentiated "contractile" vascular smooth muscle cells. It can be seen that the expression level of ACTA2 is reduced in HASMCs infected with Ad-DDIT4 compared to those infected with NC. Figure 1 F and Figure 1 G represents the protein levels of DDIT4, dedifferentiation markers (KLF4 and SPP1), and differentiation markers (ACTA2, CNN1, TAGLN) in HASMCs infected with NC or Ad-DDIT4 adenovirus (n = 6) using Western blotting. It was observed that compared to NC-infected HASMCs, Ad-DDIT4-infected HASMCs showed significantly increased DDIT4 protein levels, along with significantly increased expression levels of dedifferentiation markers KLF4 and SPP1, while the protein levels of differentiation markers ACTA2, CNN1, and TAGLN were significantly decreased. These results indicate that overexpression of the DDIT4 gene can promote the dedifferentiation of HASMCs from a "contractile" type to a highly proliferative and highly migratory "synthetic" type.

[0054] The heatmap shows differentially expressed genes obtained by RNA sequencing in HASMCs infected with shRNA-NC or shRNA-DDIT4 adenovirus. Figure 1 H).

[0055] Figure 1I represents the detection of HASMCs infected with shRNA-NC or shRNA-DDIT4 adenovirus using the CCK-8 assay (n = 12); Figure 1 J is a representative EdU staining image of HASMCs infected with shRNA-NC or shRNA-DDIT4 adenovirus; Figure 1 K is based on Figure 1 The quantitative EdU detection data obtained by J (n = 6) indicate that inhibiting the DDIT4 gene can suppress the proliferation of HASMCs.

[0056] Figure 1 L represents the immunofluorescence staining of ACTA2 (red) in HASMCs infected with shRNA-NC or shRNA-DDIT4 adenovirus. It can be seen that the expression level of ACTA2 is increased in HASMCs infected with shRNA-DDIT4 adenovirus compared to those infected with NC. Figure 1 M and Figure 1 N represents the protein levels of DDIT4, KLF4, SPP1, ACTA2, CNN1, and TAGLN in HASMCs infected with shRNA-NC or shRNA-DDIT4 adenovirus using Western blotting (n = 6). It was observed that compared to HASMCs infected with NC, the protein level of DDIT4 was significantly decreased in HASMCs infected with shRNA-DDIT4 adenovirus. Simultaneously, the expression levels of dedifferentiation markers KLF4 and SPP1 were significantly decreased, while the protein levels of differentiation markers ACTA2, CNN1, and TAGLN were significantly increased. These results indicate that inhibiting the DDIT4 gene can suppress the dedifferentiation of HASMCs from a "contractile" type to a highly proliferative and highly migratory "synthetic" type.

[0057] Figure 2 This study investigated the effect of DDIT4 knockdown on the inhibition of proliferation and phenotypic transformation in primary human vascular smooth muscle cells under PDGF-BB or IL-1β stimulation. All data are expressed as mean ± standard error of the mean; *P < 0.05, **P < 0.01 for comparisons shown in the figures.

[0058] Figure 2 A represents the protein levels of DDIT4 and smooth muscle cell contraction markers in HASMCs with knocked-down or non-knocked-down DDIT4, analyzed by Western blotting under PDGF-BB stimulation (20 ng / mL) (n = 4). Figure 2B represents the protein levels of DDIT4 and smooth muscle cell contraction markers in HASMCs with and without DDIT4 knockdown, analyzed by Western blotting under IL-1β (10 ng / mL) stimulation (n = 4). It is evident that DDIT4 knockdown under PDGF-BB or IL-1β stimulation can increase the protein levels of differentiation markers ACTA2, CNN1, and TAGLN in HASMCs.

[0059] Figure 2 C represents the evaluation of HASMC proliferation with or without DDIT4 knockdown under PDGF-BB or IL-1β stimulation using the EdU assay (n = 6). The results showed that DDIT4 knockdown under PDGF-BB or IL-1β stimulation inhibited HASMC proliferation.

[0060] Example 2: Smooth muscle cell-specific Ddit4 gene delivery exacerbates endometrial hyperplasia in mice. This embodiment uses a mouse femoral artery guidewire injury model (FWI) to study the effect of smooth muscle cell-specific Ddit4 gene delivery on mouse intimal hyperplasia.

[0061] The mouse femoral artery guidewire injury model is a classic in vivo experimental system for studying the mechanism of vascular restenosis and is widely recognized as one of the gold standard methods for simulating the pathological repair process after vascular injury in humans. This model, through mechanical injury to the femoral artery endothelium, can reproduce key pathological processes such as neointimal hyperplasia, smooth muscle cell activation, and vascular remodeling after vascular injury, providing a reliable in vivo research platform for exploring the molecular mechanisms of vascular restenosis and screening potential treatment strategies.

[0062] I. Experimental Methods Eight-week-old female and male C57BL / 6J mice were used for the experiment.

[0063] After anesthetizing mice with isoflurane gas, the proximal end of the great saphenous artery (a branch of the femoral artery) was exposed from the inguinal ligament on one side of the mouse under a dissecting microscope. The femoral nerve and femoral vein attached to the femoral artery were freed. The distal end of the saphenous artery was ligated with 9-0 sutures. Another 9-0 suture was used to control the blood flow in the proximal great saphenous artery. The blood flow in the proximal end of the femoral artery was stopped by clamping the vascular clamp. After microsurgically cutting open the blood vessel, a 0.25 mm diameter metal guidewire was inserted into the femoral artery from the great saphenous artery. After pulling the intima of the femoral artery three times, the guidewire was removed and the suture of the proximal saphenous artery was tightened. The contralateral femoral artery of the mouse was sham-operated (the same operation was performed but the guidewire was not inserted) as a control.

[0064] The modeling mice were randomly divided into two groups: the AAV9-pSm22α-Ddit4 group (AAV-Ddit4) and the AAV9-pSm22α-NC group (AAV-NC), with 5 mice in each group. On the second day after surgery, the AAV-Ddit4 group received a tail vein injection of AAV9-pSm22α-Ddit4 at a dose of 5 × 10⁻⁶. 11 Viral genomes per mouse, injection frequency: 1; AAV-NC group received tail vein injection of AAV9-pSm22α-NC, injection dose: 5 × 10⁻⁶. 11 Viral genomes were injected per mouse once; the control group received an equal volume of solvent via tail vein injection. Blood vessel samples were collected from mice 26 days after injection for further analysis.

[0065] AAV9-pSm22α-Ddit4 Gene name: Ddit4(NM_029083); Species: Mouse; Vector skeleton name: GV597; Component sequence: SM22ap-MCS-EGFP-3Flag-SV40 PolyA; Cloning site: EcoRI / AgeI; Reference number: CON413.

[0066] AAV9-pSm22α-Ddit4 and AAV9-pSm22α-NC adeno-associated viruses were designed, packaged, and provided by Shanghai Jikai Gene Technology Co., Ltd., with AAV9-pSm22α-NC serving as the control virus.

[0067] H&E staining method: Frozen sections were removed from -80℃ and allowed to thaw to room temperature for 30 minutes. The frozen embedding reagent was washed away with distilled water. The sections were then immersed in hematoxylin staining solution and stained at room temperature for 3 minutes. The sections were then slowly rinsed with a fine stream of running water for 1 minute until the water became clear. They were then immersed in 1% hydrochloric acid ethanol for differentiation for 3 seconds and immediately removed. The sections were then quickly immersed in saturated lithium carbonate solution for blue reversion for 30 seconds, rinsed again with running tap water for 1 minute, and then immersed in 1% eosin Y aqueous solution for counterstaining at room temperature for 1 minute. After staining, the sections were rapidly passed through a dehydration gradient: 95% ethanol I and 95% ethanol II: 10 times each; 100% ethanol I and 100% ethanol II: 10 times each. The sections were then immersed in xylene I and xylene II for clearing, 2 minutes each. After removal from xylene, a suitable amount of neutral resin was added for mounting.

[0068] Method for calculating the ratio of neointimal area to media area: A cross-sectional image of the blood vessel was acquired under a microscope with a 20x objective lens. The outline of the neointimal region was manually delineated using Image-Pro Plus 6.0 analysis software, and the area of ​​the region was automatically calculated by the software and recorded as N. The outline of the media region of the blood vessel was delineated separately, and the area of ​​the region was automatically calculated by the software and recorded as M. The intimal hyperplasia index was calculated according to the formula: N / M ratio = neointimal area / media area.

[0069] II. Experimental Results The results are as follows Figure 3 As shown.

[0070] Figure 3 A is a schematic diagram of the experimental timeline of femoral artery guidewire injury model in male C57BL / 6J mice and injection of lentiviral vector. Figure 3 Image B shows a representative hematoxylin-eosin (H&E) stained cross-section of the femoral artery of male mice injected with AAV-Ddit4 or AAV-NC, with no or damaged arteries. Figure 3 C is based on Figure 3 The H&E staining results of B were used to perform a quantitative analysis of the ratio of neonatal endometrial area to medial area (n = 5). The results showed that, compared with male mice injected with AAV-NC, male model mice injected with AAV-Ddit4 had more severe endometrial hyperplasia, and the difference was statistically significant.

[0071] Figure 3 D is a schematic diagram of the experimental timeline for the femoral artery guidewire injury model in female C57BL / 6J mice and the injection of lentiviral vector. Figure 3 E shows a representative hematoxylin-eosin (H&E) stained cross-section of the femoral artery of male mice injected with AAV-Ddit4 or AAV-NC, with no or damaged arteries. Figure 3 F is based on Figure 3 The results of H&E staining of E were used to quantitatively analyze the ratio of neonatal endometrial area to medial area (n = 5). The results showed that, compared with female mice injected with AAV-NC, female model mice injected with AAV-Ddit4 had more severe endometrial hyperplasia, and the difference was statistically significant.

[0072] The results showed that adeno-associated virus (AVV)-mediated smooth muscle cell-specific Ddit4 gene delivery exacerbated intimal hyperplasia in a mouse model of femoral artery guidewire injury.

[0073] Example 3: Smooth muscle-specific Ddit4 gene knockout mice This embodiment uses smooth muscle-specific Ddit4 gene knockout mice to study the effect of smooth muscle-specific Ddit4 gene knockout on endometrial hyperplasia in mice.

[0074] The genetically modified animal strain used in this invention is C57BL / 6JGpt- Ddit4 em1Cflox / Gpt (hereinafter referred to as "Gpt") Ddit4 fl / + The mouse strain, developed by Jiangsu Jicui Yaokang Biotechnology Co., Ltd., utilizes CRISPR / Cas9 gene editing technology to edit genes located on mouse chromosome 10. Ddit4 LoxP sites were inserted flanking specific exon regions of the gene to construct conditional knockout (CKO) fluxed (flanked by loxP) alleles. Ddit4 fl / + Mice compared with tool mice expressing Cre recombinase Myh11-creER T2 (hereinafter referred to as " Myh11-Cre + After hybridization with mice, it can be achieved in smooth muscle cells. Ddit4 Spatiotemporally specific knockout of genes allows for the study of the function of Ddit4 gene deletion in specific tissues or cell types at the in vivo level.

[0075] I. Experimental Methods Yuji Pharmaceutical Biotechnology Co., Ltd. and Jackson Laboratory respectively introduced Ddit4 fl / + mice and Myh11-Cre + Mice, male Myh11-Cre + Mice and females Ddit4 fl / + mouse hybridization Myh11-Cre + ; Ddit4 fl / + Mice, the male offspring of which were then mated with females Ddit4 fl / + Males were obtained by backcrossing mice Myh11-Cre + ; Ddit4 fl / fl Target mice (Ddit4) SMCKO ), Myh11-Cre + Mice were used as wild-type control mice. At 6 weeks of age, these experimental mice were intraperitoneally injected with tamoxifen (70 mg / kg / day) for 5 consecutive days to induce cre recombinase activation, achieving smooth muscle-specific knockout. Ddit4 Genes were used to construct a mouse femoral artery guidewire injury model after 1 week of restorative feeding. The construction method was the same as in Example 2. The contralateral femoral artery of the mice was sham-operated (the same operation was performed but the guidewire was not inserted) as a control.

[0076] After 28 days, intimal hyperplasia occurred in the femoral artery of mice in each group. Blood vessel samples were taken from the mice for hematoxylin-eosin (H&E) staining and the ratio of the newly formed intimal area to the medial area was calculated, using the same method as in Example 2.

[0077] II. Experimental Results Experimental results are as follows Figure 4 As shown.

[0078] Figure 4 A represents the male. Myh11-Cre + mice and Myh11-Cre + ; Ddit4 fl / fl A schematic diagram of the experimental timeline for tamoxifen treatment and femoral artery guidewire injury models in mice.

[0079] Figure 4 B is from Myh11-Cre + and Myh11-Cre + ; Ddit4 fl / fl Representative hematoxylin-eosin (H&E) stained cross-sections of undamaged or damaged femoral arteries in mice. Figure 4 C is based on the diagram. Figure 4 Quantitative analysis of the ratio of neonatal endometrial area to medial area based on H&E staining results of B (n = 5). The results indicate that specific knockout... Ddit4 The gene can inhibit intimal hyperplasia in a mouse model of femoral artery guidewire injury.

[0080] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0081] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. Application of reagents that knock out the DDIT4 gene in the preparation of drugs for treating restenosis.

2. The application as described in claim 1, characterized in that, The reagent is a CRISPR-Cas system, preferably a CRISPR-Cas9 system.

3. Application of reagents that inhibit DDIT4 gene expression in the preparation of drugs for treating restenosis.

4. The application as described in claim 3, characterized in that, The reagents include RNA interference reagents and small molecule inhibitors.

5. The application as described in claim 4, characterized in that, The RNA interference reagents include siRNA, shRNA or their recombinant expression vectors, and miRNA.

6. The application as described in claim 5, characterized in that, The RNA interference reagent is shRNA or its recombinant expression vector, and the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1; and / or, The recombinant expression vectors include recombinant adenovirus vectors and recombinant adeno-associated virus vectors.

7. The application as described in any one of claims 1 to 6, characterized in that, The application includes any one or more of the following (1) to (4): (1) Inhibits the proliferation of vascular smooth muscle cells; (2) Inhibits the dedifferentiation of vascular smooth muscle cells; (3) Promotes the differentiation of vascular smooth muscle cells; (4) Reduce the ratio of neointimal area to media area after vascular injury.

8. A drug for treating restenosis, characterized in that, The drug includes an active ingredient and pharmaceutically acceptable excipients; The active ingredients include reagents that knock out the DDIT4 gene and / or reagents that inhibit DDIT4 gene expression.

9. The drug as claimed in claim 9, characterized in that, The reagent used to knock out the DDIT4 gene is a CRISPR-Cas system, preferably a CRISPR-Cas9 system; and / or, The inhibition of DDIT4 gene expression includes RNA interference reagents and small molecule inhibitors.

10. The medicament as claimed in claim 9, characterized in that, The RNA interference reagents include siRNA, shRNA or their recombinant expression vectors, and miRNA; Preferably, the RNA interference reagent is shRNA or its recombinant expression vector, and the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1; and / or, The recombinant expression vectors include recombinant adenovirus vectors and recombinant adeno-associated virus vectors.

Images