Receptor-like kinase MaHPCA1 and application thereof in relieving banana cold injury
By overexpressing the MaHPCA1-1 or MaHPCA1-3 receptor kinase genes in banana peel, the problem of chilling injury in bananas was solved, and the cold resistance of the fruit was improved and the storage period was extended.
Patent Information
- Application Number
- CN202610018343.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-08
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2046-01-08
AI Technical Summary
Existing technologies for alleviating banana chilling injury suffer from problems such as treating the symptoms but not the root cause, time-sensitive and unstable effects, high costs, and potential side effects. Moreover, most methods involve passive intervention rather than actively endowing the fruit with chilling resistance.
Overexpression of MaHPCA1-1 or MaHPCA1-3 receptor kinase genes in banana peels can improve the cold resistance of banana fruits, inhibit the production of hydrogen peroxide, superoxide anion and malondialdehyde, and alleviate chilling injury symptoms.
It significantly improved the cold resistance of banana fruits under low-temperature storage conditions, extended the storage period, and reduced the occurrence of chilling injury symptoms.
Smart Images

Figure CN121472267A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering, and in particular to a receptor-like kinase MaHPCA1 and its application in relieving banana chilling injury. BACKGROUND
[0002] Bananas belong to the climacteric fruit. In order to obtain a longer shelf life, bananas are usually picked at an immature stage. However, banana fruits at an immature stage are very sensitive to low temperature, and are prone to chilling injury when encountering unsuitable low temperature (< 13℃) during storage and transportation. The specific manifestations of chilling injury are the appearance of spots and browning on the peel, lignification of the pulp, loss of part of the fruit aroma, and even inability to ripen, etc., thereby causing huge economic losses. At present, the techniques for improving the cold tolerance of bananas after harvesting mainly include three categories: physical methods, chemical methods, and genetic improvement. Firstly, physical methods mainly control the physical parameters of the storage environment or apply external physical fields to achieve the purpose of preservation. For example, temperature regulation, intermittent warming treatment, and controlled atmosphere storage, etc. Secondly, chemical methods are to induce or directly enhance the cold resistance of fruits by applying exogenous chemicals. For example, calcium treatment, plant growth regulator treatment, coating treatment, etc. Finally, genetic improvement is to directly change the genetic background of bananas by transgenic or gene editing technology, so as to express cold-resistant genes.
[0003] The shortcomings of the prior art are summarized as follows: (1) treating the symptoms but not the root cause: most physical and chemical methods act from the external environment or through external stimulation, and fail to fundamentally change the inherent low temperature sensitivity of banana fruits. (2) timeliness and instability: the effects of chemical induction and physical regulation are usually temporary, reversible, and easily affected by the environment and management level, and the effects are unstable. (3) high cost and complexity: precise temperature control, controlled atmosphere, intermittent warming, etc. require high equipment investment and meticulous management, and the operation is complex, which is difficult to popularize. (4) potential side effects: chemical residues, flavor changes, and the risk of pesticide damage always exist. (5) passive response: most of the existing technologies are passive interventions, rather than actively endowing fruits with strong cold resistance. Therefore, it is necessary to excavate a new receptor-like kinase MaHPCA1 gene and apply it to relieve the symptoms of banana chilling injury. SUMMARY
[0004] In view of the above defects of the prior art, the present application provides a receptor-like kinase MaHPCA1 and its application in relieving banana chilling injury, to solve the problems in the background art.
[0005] To achieve the above purpose, the present application provides the following technical solutions: The application of a receptor-like kinase MaHPCA1 in relieving banana chilling injury, wherein the receptor-like kinase MaHPCA1 is any one of MaHPCA1-1 or MaHPCA1-3, the nucleotide sequence of the MaHPCA1-1 is shown as SEQ ID NO. 1, and the nucleotide sequence of the MaHPCA1-3 is shown as SEQ ID NO. 2.
[0006] Preferably, the banana chilling injury symptoms are relieved by overexpressing MaHPCA1-1 or MaHPCA1-3 in banana peel, and the cold tolerance of banana fruit is improved.
[0007] Preferably, a primer pair for cloning MaHPCA1-1, wherein the sequence of the forward primer is shown as SEQ ID NO. 3, and the sequence of the reverse primer is shown as SEQ ID NO. 4.
[0008] Preferably, a primer pair for cloning MaHPCA1-3, wherein the sequence of the forward primer is shown as SEQ ID NO. 5, and the sequence of the reverse primer is shown as SEQ ID NO. 6.
[0009] Preferably, a method for cultivating cold-resistant bananas comprises the following steps: (1) connecting the MaHPCA1-1 or MaHPCA1-3 to a vector to obtain an overexpression vector; (2) transforming the overexpression vector into Agrobacterium, oscillating and centrifuging, resuspending with an infection solution to obtain a recombinant bacteria-containing infection solution; (3) infecting banana peel with the recombinant bacteria-containing infection solution obtained in step (2) to obtain cold-resistant bananas.
[0010] Preferably, the vector in step (1) is a pGreenII 62-SK vector, and the pH of the infection solution in step (2) is 5.2-5.8.
[0011] Preferably, the pH of the infection solution is 5.6.
[0012] Preferably, the infection solution in step (2) is prepared by mixing the following components: 98 mL of water, 1 mL of 1.0 M aqueous morpholinoethanesulfonic acid solution, 1 mL of 1.0 M aqueous magnesium chloride hexahydrate solution, and 200 μL of 100 mM aqueous acetyl-syringone solution.
[0013] Compared with the prior art, the application has the beneficial effects that the application discloses a receptor-like kinase MaHPCA1 and applies it in relieving banana cold injury symptoms, solves the problem that banana fruits are prone to cold injury when stored at low temperature, the application finds two homologous genes MaHPCA1-1 and MaHPCA1-3 in the leucine-rich repeat receptor-like kinase gene family from banana, silencing MaHPCA1-1 and MaHPCA1-3 can cause the production of hydrogen peroxide, superoxide anion and malondialdehyde, so that the cold injury symptoms of banana fruits are significantly aggravated. Through overexpression of MaHPCA1-1 and MaHPCA1-3, the production of hydrogen peroxide, superoxide anion and malondialdehyde is inhibited, the cold injury symptoms of banana fruits are relieved, the cold resistance of banana fruits under postharvest low-temperature storage conditions is improved, and the storage period of banana fruits is prolonged. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 Figure 1 is a bioinformatics analysis diagram of the purpose receptor-like kinase, wherein A is a phylogenetic tree, B is motif analysis, and C is a multiple sequence alignment of the characteristic cysteine pairs in the hydrogen peroxide domain (HP domain) (in the figure, LRR: leucine-rich repeat receptor domain; HP: hydrogen peroxide domain; TM: transmembrane domain; Kinase: kinase domain); Figure 2 Figure 2 is a sequence alignment of the complete LRR domain and protein kinase domain of the AtHPCA1 and MaHPCA1-1-9 genes; Figure 3 Figure 3 is the relative expression amount of MaHPCA1-1 and MaHPCA1-3 at different storage times under low temperature; Figure 4 Figure 4 is an electrophoretic banding diagram of MaHPCA1-1 and MaHPCA1-3; Figure 5 Figure 5 is a transient overexpression of MaHPCA1-1 and MaHPCA1-3 genes on banana fruit peels, and storage for 5 days under the condition of 6±1℃; wherein A is the appearance of the banana fruit peels of a blank control (left side) and the banana fruit peels overexpressing MaHPCA1-1 or MaHPCA1-3 (right side); B is the relative expression amount of the genes after transient overexpression of MaHPCA1-1 and MaHPCA1-3 in the fruit peels; C is the content of H2O2 in the transient overexpression vector of MaHPCA1-1 and MaHPCA1-3; D is the content of O2 -The production rate of H2O2; E is the content of MDA in the MaHPCA1-1 and MaHPCA1-3 transient overexpression vectors; each data represents the average value ± standard error of three repeated samples, and the asterisk (**) indicates significant difference (P < 0.01); Figure 6 A is the appearance of the blank control banana fruit peel (left) and the banana fruit peel silenced MaHPCA1-1 or MaHPCA1-3 (right); B is the relative expression amount of the genes after silencing MaHPCA1-1 and MaHPCA1-3 in the fruit; C is the content of H2O2 in the MaHPCA1-1 and MaHPCA1-3 transient silencing vectors; D is the production rate of O2 - in the MaHPCA1-1 and MaHPCA1-3 transient silencing vectors; E is the content of MDA in the MaHPCA1-1 and MaHPCA1-3 transient silencing vectors; each data represents the average value ± standard error of three repeated samples, and the asterisk (**) indicates significant difference (P < 0.01). DETAILED DESCRIPTION
[0015] In order for those skilled in the art to better understand the technical content of the present application, the technical solutions of the present application will be further described in detail in combination with specific embodiments.
[0016] The names, catalog numbers, and purchase channels of the commercial reagents, vectors, and strains involved in this application are as follows: (1) Hydrogen peroxide content (H2O2) reagent kit (purchased from Suzhou Greens Biotechnology Co., Ltd., catalog number G0112W); (2) FastKing RT reagent kit (purchased from Tiangen Biotech Co., Ltd., catalog number: KR118); (3) SuperReal Premix Plus kit (purchased from Tiangen Biotech Co., Ltd., catalog number: FP205); (4) CTAB (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: H811117); (5) β-mercaptoethanol (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: M6230); (6) chloroform (trichloromethane) (purchased from Guangdong Guangshi Technology Co., Ltd., catalog number: GD10); (7) isoamyl alcohol (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: M813908); (8) LiCl (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: 767397); (9) SSTE buffer (purchased from Shanghai Zeye Biotechnology Co., Ltd., catalog number: ZY6ZT1008); (10) anhydrous ethanol (purchased from Xilong Scientific Co., Ltd., catalog number: 1280340101602); (11) reverse transcription kit Takara PrimeScript™ II 1st Strand cDNASynthesis Kit (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 6210A); (12) DNA polymerase Takara PrimeSTAR Max DNA Polymerase Ver.2 (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: R047S); (13) Agarose (catalog number: 1110GR100, BioFROXX); (14) 50×TAE buffer (purchased from Beijing Solarbio Technology Co., Ltd., catalog number: T1060); (15) Green fluorescent nucleic acid dye (purchased from Beijing Solarbio Technology Co., Ltd., catalog number: G8140); (16) 5000 DNA marker (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 3428Q); (17) 6×DNA loading buffer (purchased from Biosharp, catalog number: BL532A); (18) pGreenII 62-SK vector (purchased from Shanghai Kelei Biotechnology Co., Ltd., catalog number: KL-ZL-0668); (19) Agrobacterium GV3101 (pSoup-p19) competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1003); (20) Morpholine ethanesulfonic acid (purchased from Shanghai Maclean Biotechnology, catalog number: M813436); (21) Magnesium chloride hexahydrate (purchased from Shanghai Maclean Biotechnology, catalog number: M766361);(22) Acetyleugenone (purchased from Shanghai Maclean Biotechnology, item number: A800901) (23) Acetone (purchased from Guangdong Guangshi Technology Co., Ltd., item number: HB02); (24) KNO2 (purchased from Shanghai Maclean Biotechnology, item number: P815362); (25) Disodium hydrogen phosphate (purchased from Shanghai Maclean Biotechnology, item number: S818103); (26) Sodium dihydrogen phosphate (purchased from Shanghai Maclean Biotechnology, item number: S817780); (27) α-Naphthylamine (1-naphthylamine) (purchased from Shanghai Maclean Biotechnology, item number: N814568); (28) EDTA solution (purchased from Shanghai Maclean Biotechnology, item number: E762090); (29) Triton X-100 (purchased from Shanghai Maclean Biotechnology, item number: T824275); (30) PVP (purchased from Shanghai Maclean Biotechnology, item number: 767425); (31) Hydroxylamine hydrochloride (purchased from Shanghai Maclean Biotechnology, item number: H811239); (32) p-Aminobenzenesulfonic acid (purchased from Shanghai Maclean Biotechnology, item number: S817819); (33) Trichloroacetic acid (TCA) (purchased from Shanghai Maclean Biotechnology, item number: T824275); (34) Thiobarbituric acid (TBA) (purchased from Shanghai Maclean Biotechnology, catalog number: T768874); (35) pTRV1 (purchased from Youbao Biotechnology, catalog number: VT1437); (36) pTRV2 (purchased from Youbao Biotechnology, catalog number: VT1438); (37) Novizan gel recovery kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: DC301-01); (38) Dpn I. Reagent kit (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 1235S); (38) In-Fusion reagent kit (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 102518); (39) Kanamycin (purchased from Guangzhou Saiguosheng Co., Ltd., catalog number: 1162GR001); (40) Rifampin (purchased from Beijing Solarbio Technology Co., Ltd., catalog number: R8011).
[0017] The following embodiments in this application all use Brazilian bananas ( Musa (AAA Group) 'Brazil' was used as the experimental material, and the bananas were picked in a banana plantation in Chengmai.
[0018] Example 1: Screening for target receptor kinases Using AtHPCA1 (AT5G49760) from Arabidopsis thaliana as a template, nine candidate genes (MaHPCA1-1~9) for banana hydrogen peroxide receptors were identified based on sequence conservation. These nine candidate genes were then used in conjunction with Arabidopsis AtHPCA1 to construct a phylogenetic tree for evolutionary relationship analysis. The specific steps were as follows: the AtHPCA1 and MaHPCA1-1~9 sequences were imported into the MEGA program; the Statistical Method was set to Neighbor-joining; the Bootstrap method was set to 1000; the generated phylogenetic tree was then simply formatted and saved. The results showed (…). Figure 1 In the A group, there are two main branches. One branch consists of AtHPCA1, MaHPCA1-4, MaHPCA1-8, and MaHPCA1-9, while other MaHPCA1 candidate genes cluster into the other branch. Motif analysis is then performed. The specific steps are as follows: using the online website MEME, first upload the sequences of MaHPCA1-1~9, set the number of motifs to 6, run the analysis, and save the results file in XML format; then open TBtools, select Graphics, upload the above results file and the corresponding gene ID names, click Start, and obtain the visualization results. The obtained visualization results are then beautified in terms of shape and color to obtain the final result. The results show (…). Figure 1 In the B group, MaHPCA1-1~9 and AtHPCA1 all contain the same conserved motif at the C-terminus. Amino acid sequence alignment analysis shows that ( Figure 1 In the C group, MaHPCA1-1~9, similar to AtHPCA1, contains two conserved cysteine residue pairs in the hydrogen peroxide domain. Furthermore, conserved domain analysis ( Figure 2 The results also showed that they all contain LRR domains and protein kinase domains, thus suggesting that MaHPCA1-1~9, like AtHPCA1, are leucine-rich repeat receptor kinases belonging to the HPCA gene subfamily.
[0019] To determine whether the MaHPCA1s genes are involved in the response to low temperature, we performed transcriptome sequencing on banana samples (the middle section of the banana peel after the ends were removed) stored at 6±1℃ for days 0, 1, and 5. We analyzed the expression of candidate hydrogen peroxide receptor genes MaHPCA1-1~9 using FPKM and performed a one-way ANOVA analysis to assess the significance of relative expression levels of the sequenced genes. We found that among the MaHPCA1-1~9 genes, only MaHPCA1-1 and MaHPCA1-3 showed significantly upregulated relative expression levels on days 1 and 5 compared to day 0. Specifically, the average relative expression level of MaHPCA1-1 on days 1 and 5 was 2.83 times that on day 0, and the average relative expression level of MaHPCA1-3 on days 1 and 5 was 3.27 times that on day 0. The results of the relative expression level data for the sequenced genes are shown in Table 1. Table 1. Relative gene expression levels from transcriptome sequencing
[0020] To verify the authenticity of the transcriptome data, we selected the upregulated genes MaHPCA1-1 and MaHPCA1-3 for RT-qPCR validation. The specific steps for testing the relative gene expression levels included: RNA extraction, cDNA acquisition, RT-qPCR primer design, and RT-qPCR testing. 1.1 RNA extraction: Take banana samples stored at 6±1℃ for 0, 1, 3, 5 and 7 days (the middle section of the banana peel after the ends are cut off); the specific operation is as follows: (1) Sample addition: Take 0.3-0.4g of banana sample in a 10 mL EP tube, add 4mL of CTAB preheated at 65℃ and 80μL β-Mercaptoethanol, quickly vortex to mix; (2) Cleavage: 65℃, 2min (water bath); (3) Impurity removal: add 4mL chloroform / isoamyl alcohol mixed solution (24:1, v / v), vortex for 30s, centrifuge, 15℃, 10min, 10000×g, take the supernatant (supernatant is the extract); (4) Further impurity removal: repeat step (3); (5) Adsorption: add 1mL (1 / 4 volume) LiCl and gently invert to mix, 4℃, overnight; (6) Centrifugation: first centrifuge at 4℃ and 10000×g for 30min to remove the supernatant, put SSTE in a 65℃ water bath during centrifugation, then centrifuge at 15℃ and 10000×g for 1min to remove the residual liquid, and then aspirate the supernatant to obtain a white precipitate; (7) Dissolution: add 400μL of SSTE preheated at 65℃ to the white precipitate, use a pipette to blow and aspirate to dissolve the precipitate, and then transfer it to a 1.5mL enzyme-free tube. (8) Impurity removal: Add 400 μL of chloroform / isoamyl alcohol mixed solution (24:1, v / v), vortex for 30 s, centrifuge at 15℃ for 10 min, and collect the supernatant at 10000×g; (9) Further impurity removal: Repeat step (8) and determine whether the amount of supernatant obtained by adding 2 times the amount of anhydrous ethanol is less than 1.5 mL. If not, it needs to be aliquoted; (10) Alcohol precipitation: Add 2 times the volume of anhydrous ethanol in an ice bath, place in a -80℃ freezer, and precipitate for 30 min (then operate in an ice bath); (11) Centrifugation: Centrifuge at 4℃ for 20 min and aspirate the supernatant at 10000×g; (12) Dissolution: Add 20-30 μL of N-ase-Free ddH2O. The precipitate can be dissolved by pipetting to obtain RNA. Three biological replicates were made for each group of samples.
[0021] 1.2 Acquisition of cDNA for RT-qPCR: RT-qPCR was performed using the FastKing RT kit, where the RNA obtained from each group of samples was reverse transcribed into cDNA. The reaction system was as follows: 4 μL 5×FastKing-RT SuperMix, 1 μg total RNA, and RNase-free ddH2O to a final volume of 20 μL. The reaction conditions were: 42℃ for 15 min; 95℃ for 3 min. Ultimately, three biological replicates of cDNA were obtained from each group of samples.
[0022] 1.3 RT-qPCR Primer Design: Primers were designed using Primer Premier 6.0 software. The internal reference gene was MaActin1 (Gene ID: AF246288.1). All real-time quantitative PCR primers are shown in Table 2. Table 2 Primers for RT-qPCR
[0023] 1.4 RT-qPCR Assay: The SuperReal Premix Plus kit was used to prepare the qPCR reaction system. The 20 μL qPCR reaction system was as follows: 10 μL 2×SuperReal PreMix Plus, 0.6 μL 10 µM forward primer, 0.6 μL 10 µM reverse primer, 1 μL cDNA, and 7.8 μL RNase-free ddH2O. qPCR was performed on a Bio-Rad CFX96 Real-Time PCR system (Hercules, CA, USA) under the following conditions: pre-denaturation: 95 °C, 15 min; PCR reaction: 95 °C, 10 s; 55 °C, 20 s; 72 °C, 30 s; 40 cycles. Three cDNA samples (biological replicates) were used for each sample group, and three technical replicates were performed for each cDNA sample. The obtained CT value was used as 2^( The relative expression level of the corresponding gene at the corresponding site is finally obtained by calculating using the ΔΔCT method.
[0024] Figure 3 The results indicate that the trends of RT-qPCR and transcriptome data are basically consistent, suggesting that the transcriptome data are highly reliable. These data demonstrate that MaHPCA1-1 and MaHPCA1-3 respond to low temperature and are upregulated during low-temperature storage, thus playing a positive regulatory role in chilling injury to bananas.
[0025] The nucleotide sequence of MaHPCA1-1 is shown in SEQ ID NO.1, the nucleotide sequence of MaHPCA1-2 is shown in SEQ ID NO.7, the nucleotide sequence of MaHPCA1-3 is shown in SEQ ID NO.2, and the nucleotide sequences of MaHPCA1-4, MaHPCA1-5, MaHPCA1-6, MaHPCA1-7, MaHPCA1-8 and MaHPCA1-9 are shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13, respectively.
[0026] Example 2: Obtaining MaHPCA1-1 and MaHPCA1-3 1.1 Acquisition of cDNA Fresh banana peels were ground into powder using liquid nitrogen, and RNA was extracted. Using the Takara PrimeScript™ II 1st Strand cDNA Synthesis Kit (6210A), 8 μL of RNA was added, along with 1 μL of Oligo dt primer and 1 μL of dNTP mixture. The reaction conditions were 65°C for 5 min. The following reagents were then added to the system: 4 μL of 5×PS II buffer, 0.5 μL of RNase inhibitor, 1 μL of PS II RTase, and RNase-Free ddH2O, bringing the total volume to 20 μL. PCR reaction conditions were 42°C for 45 min; then 95°C for 5 min. The obtained cDNA was stored at -20°C.
[0027] 1.2 Acquisition of the full-length target fragments MaHPCA1-1 and MaHPCA1-3 The DNA polymerase used was Takara PrimeSTAR Max DNA Polymerase Ver.2 (R047S). The MaHPCA1-1 forward primer sequence was: ATGATTGGAGTCTTTCTTATCTTTTATGGGGC (SEQ ID NO.3); the MaHPCA1-1 reverse primer sequence was: TCATCGGGCCGCAACAGC (SEQ ID NO.4); the MaHPCA1-3 forward primer sequence was: ATGGGAACCCTCATCTTCACCC (SEQ ID NO.5); the MaHPCA1-3 reverse primer sequence was: TTATTTGGGCTCGGGTTTTGCTG (SEQ ID NO.6); the total PCR reaction volume of 20 μL was prepared as follows: PrimeSTAR Max DNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; cDNA template: 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10s; 55℃, 5s; 68℃, 30s; for a total of 30 cycles. Agarose gel electrophoresis was used to verify the band positions: the gel running time was 25 minutes; the results were obtained. Figure 4 The bands were excised and purified using the Novizan Gel Recovery Kit to obtain fragments of MaHPCA1-1 (2805bp) and MaHPCA1-3 (2877bp).
[0028] Example 3: Transient overexpression of MaHPCA1-1 and MaHPCA1-3 in banana peel 1.1 Experimental Methods First, the full-length target fragments of MaHPCA1-1 and MaHPCA1-3 obtained in Example 2 were homologously recombinated with the pGreenII 62-SK vector to construct OE-MaHPCA1-1 and OE-MaHPCA1-3 overexpression vectors. The specific steps are as follows: (1) Linearization of pGreenII 62-SK vector: The pGreenII 62-SK empty vector plasmid was linearized using forward primer: CGGGCTGCAGGAATTCGATATCAAG (SEQ ID NO.24) and reverse primer: GGGGATCCACTAGTTCTAGAGCG (SEQ ID NO.25) according to the PCR amplification program. The total PCR reaction system of 20 μL was prepared as follows: PrimeSTAR Max DNAPolymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; pGreenII 62-SK (concentration of 500 ng / μL): 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 30 s; for a total of 30 cycles. The incompletely linearized circular vector was removed using a Dpn I kit. The total reaction volume of 20 μL consisted of: 5 μL linearized vector, 1 μL DpnI, 2 μL 10×T buffer, and 12 μL sterile water. The reaction conditions were: 37℃ for 4 h, followed by incubation at 70℃ for 15 min. Agarose gel electrophoresis was performed for validation: the gel ran for 25 min; the target band was recovered, and after gel extraction, the fully linearized pGreenII 62-SK vector was purified using a Novizan gel extraction kit. (2) Amplification of the homologous arm fragments of MaHPCA1-1 and MaHPCA1-3: The forward primer for the homologous arm fragment of MaHPCA1-1 is: AACTAGTGGATCCCCATGATTGGAGTCTTTCTTATCTTTTATGGGGC (SEQ ID NO.26), and the reverse primer is: AATTCCTGCCAGCCCGTCATCGGGCCGCAACAGC (SEQ ID NO.27); The forward primer for the homologous arm fragment of MaHPCA1-3 is: AACTAGTGGATCCCCATGGGAACCCTCATCTTCACCC (SEQ ID NO.28), and the reverse primer is: GAATTCCTGCAGCCCGTTATTTGGGCTCGGGTTTTGCTG (SEQ ID NO.29). PCR amplification was performed. The total PCR reaction volume of 20 μL was prepared as follows: PrimeSTAR Max DNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; cDNA template: 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 30 s; for a total of 30 cycles. Agarose gel electrophoresis was performed for verification: the gel running time was 25 min; after gel excision, the fragments MaHPCA1-1 and MaHPCA1-3 with homologous arms were purified using the Novizan gel extraction kit. (3) Ligation: Homologous recombination was performed using the In-Fusion kit. The recombination system consisted of 5 μL (1 μL of linearized pGreenII62-SK vector, 1 μL of In-Fusion enzyme premix, 1 μL of MaHPCA1-1 or MaHPCA1-3 fragment with homologous arms, and 2 μL of sterile water). After reacting at 50℃ for 15 min, the homologous recombination products MaHPCA1-1-SK or MaHPCA1-3-SK were obtained. (4) Transformation plating and colony identification: 1 μL of the homologous recombinant product of MaHPCA1-1-SK or MaHPCA1-3-SK was transformed into DH5α competent cells and plated (Kan resistant). After incubation at 37℃ for 12 h, colony identification was performed. Colonies containing the target fragment were screened and shaken. Positive colonies were picked up with a pipette tip and placed together with the pipette tip into 10 mL of liquid LB medium (Kan resistant). After incubation at 37℃ for 12 h, the plasmid was extracted to obtain the MaHPCA1-1-SK or MaHPCA1-3-SK recombinant plasmid.
[0029] The cells were then transformed into Agrobacterium GV3101 (pSoup-p19). The specific steps were as follows: Take two 100 μL tubes of Agrobacterium GV3101 (pSoup-p19) competent cells and allow them to partially thaw at room temperature. Add 1 μL of MaHPCA1-1-SK or MaHPCA1-3-SK recombinant plasmid to each cell. First, incubate on ice for 5 min, then transfer to liquid nitrogen for 5 min, then place in a 37℃ water bath for 5 min, and finally in an ice bath for 5 min. Add 700 μL of antibiotic-free LB liquid medium and incubate at 28℃ with shaking for 2-3 h. Harvest the bacteria at 6000×g for 1 min, and resuspend 100 μL of the supernatant by gentle pipetting. Spread the bacterial culture onto Rif-Kan double-antibiotic plates and incubate upside down at 28℃ for 48 h. Identify the grown colonies, and perform shaking culture on positive colonies.
[0030] Finally, the Agrobacterium tumefaciens bacterial solution containing the target gene was shaken at 28°C to OD. 600 =0.8-1.0, centrifuged, and resuspended to OD using a pH 5.6 incubation buffer (components: 98 mL water, 1 mL 1.0 M morpholine ethanesulfonic acid (MES) aqueous solution, 1 mL 1.0 M magnesium chloride hexahydrate (MgCl2·6H2O) aqueous solution, and 200 μL 100 mM acetylsyl syringone (AS) aqueous solution). 600 =0.8. Using a disposable sterile syringe, 1 mL of Agrobacterium infection solution containing the target gene was injected into the banana peel. A blank control was prepared by injecting 1 mL of Agrobacterium infection solution containing the pGreenII 62-SK empty vector plasmid into the same fruit. The OE-MaHPCA1-1 and OE-MaHPCA1-3 overexpression vectors and the blank control underwent the same low-temperature treatment time. The fruit was then stored in a cold storage at 6±1℃ and 85% relative humidity, protected from light.
[0031] 1.2 Test Methods The banana samples used in the following experiments were all banana peel powders ground using liquid nitrogen.
[0032] (1) H2O2 content determination: The hydrogen peroxide content (H2O2) kit was used for detection. The specific test method is as follows: The kit contains four components: reagent 1, reagent 2, reagent 3 and standard. Weigh 0.5g of banana sample, add 1.0 mL of acetone, homogenize on ice, transfer to EP tube, centrifuge at 12000 rpm and 4℃ for 10 min, take the supernatant and place on ice for testing. Preheat the microplate reader for more than 30 min and adjust the wavelength to 415 nm. Add 500 μL of supernatant, 50 μL of reagent 1 and 100 μL of reagent 2 to the sample tube, and add 500 μL of acetone, 50 μL of reagent 1 and 100 μL of reagent 2 to the blank tube. Vortex thoroughly to mix, centrifuge at 25℃ for 10 min, discard the supernatant and keep the precipitate. Add 460 μL of reagent III to both sample and blank tubes to dissolve the precipitate. Mix well and centrifuge at 12000 rpm for 2 min. Transfer 200 μL of the supernatant to a 96-well plate and read the absorbance (A) at 415 nm. The standard curve is prepared as follows: Dissolve 10 μL of the standard in 4.99 mL of acetone, mix thoroughly, and then dilute with acetone to prepare the following concentration gradients: 0 μM, 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM, 1.0 μM, and 1.2 μM. Follow the same procedure as for the blank tubes. The standard curve is then prepared using the equation: y = 2.4544x - 0.0329; where x is the molar mass of the standard (μmol); and y is ΔA.
[0033] The calculation formula is: ΔA = Adetermined - Ablank. H2O2 content (μmol g) -1 = [(ΔA+0.0329)÷2.4544]÷(W×V1÷V)=1.63×(ΔA+0.0329)÷W, where V is the volume of acetone added (1.0 mL); V1 is the volume of sample liquid added to the reaction system (0.5 mL); and W is the sample mass (0.5 g). Three technical replicates were performed for each sample group, and the average value was taken.
[0034] (2) O2 -Production rate determination: Take 1.0 g of banana sample and add 1.0 mL of extraction buffer (prepared by weighing 29.2 mg EDTA, 2 g PVP, and 0.3 mL Triton X-100, and adding them to 50 mM, pH 7.8 phosphate buffer). Grind thoroughly in an ice bath. Centrifuge the mixture at 12000 rpm for 20 min at 4 °C. The supernatant obtained is the sample extract and should be stored at 4 °C. Take 1.0 mL of the sample extract, add 1.0 mL of 50 mM, pH 7.8 phosphate buffer and 1.0 mL of 1.0 mM hydroxylamine hydrochloride solution, shake well, and incubate at 25 °C for 1 h. Then add 1.0 mL of 17.0 mM p-aminobenzenesulfonic acid solution and 1.0 mL of 7.0 mM α-naphthylamine solution, mix well, and incubate at 25 °C for 20 min for a colorimetric reaction, ensuring that the color change in the reaction system is stable and obvious. Preheat the microplate reader for at least 30 minutes, take 200 μL of supernatant (make three technical replicates for each sample group) into a 96-well plate, and measure the absorbance at 530 nm.
[0035] The standard curve was prepared by taking seven test tubes and numbering them 0-6. For tubes 0-6, add 0 mL, 0.1 mL, 0.2 mL, 0.3 mL, 0.4 mL, 0.5 mL, and 0.6 mL of 100 µM KNO2 standard solution, respectively. Add 1.0 mL, 0.9 mL, 0.8 mL, 0.7 mL, 0.6 mL, 0.5 mL, and 0.4 mL of distilled water, respectively. Add 1.0 mL of 50 mM phosphate buffer (pH 7.8) and 1.0 mL of 1.0 mM hydroxylamine hydrochloride solution to each tube. Shake well and incubate at 25°C for 1 hour. Afterward, add 1.0 mL of 17.0 mM p-aminobenzenesulfonic acid solution and 1.0 mL of 7.0 mM α-naphthylamine solution, respectively. Mix well and incubate at 25°C for 20 minutes for color development. At this point, solutions 0 through 6 contain equivalent amounts of superoxide anions of 0 μmol, 20 μmol, 40 μmol, 60 μmol, 80 μmol, 100 μmol, and 120 μmol, respectively. The microplate reader is preheated for at least 30 minutes. 200 μL of supernatant (three technical replicates per sample group) is transferred to a 96-well plate, and the absorbance is measured at 530 nm. A standard curve is constructed with absorbance on the ordinate and the amount of superoxide anion (μmol) on the abscissa.
[0036] The calculation formula is: O2 - Production rate = (n × V × 1000) ÷ (Vs × t × m), unit: nmol g -1 min -1Where n is the amount of superoxide anion calculated from the standard curve, in μmol; V is the total volume of the sample extract, i.e., 1.0 mL; Vs is the volume of the test sample, i.e., 0.2 mL; t is the reaction time of the sample with hydroxylamine, i.e., 60 min; and m is the sample mass, i.e., 1.0 g. Three technical replicates were made for each group of samples, and the average value was taken.
[0037] (3) MDA content determination: Weigh 0.5g of banana sample and grind it thoroughly in 5.0mL of 100 g / L trichloroacetic acid (TCA) solution to obtain a homogenate. Centrifuge at 4℃ and 10000 rpm for 20min and separate the supernatant as the sample extract. Mix 1.0mL of sample extract with 1.0mL of 0.67% thiobarbituric acid solution (TBA) evenly. Place the mixture in a boiling water bath and heat to boiling for 20min. Then, quickly transfer the mixture to an ice bath for rapid cooling to terminate the reaction. After cooling, centrifuge once more under the same conditions. Preheat the microplate reader for at least 30min. Take 200μL of supernatant (three technical replicates for each group of samples) into a 96-well plate and measure the absorbance values at wavelengths of 450nm, 532nm, and 600nm, respectively. Measure three times for each group.
[0038] The calculation formula is: c = 6.45 × (OD) 532 -OD 600 -0.56×OD 450 The unit is μmol L -1 In the formula: OD 450 OD 532 OD 600 These represent the absorbance values at wavelengths of 450 nm, 530 nm, and 600 nm, respectively. MDA content = (c × V) ÷ (Vs × m), unit: nmol g -1 In the formula: c is the concentration of MDA in the reaction mixture, in μmol / L. -1 V represents the total volume of the sample extract, i.e., 1.0 mL; Vs represents the volume of the sample liquid taken during the determination, i.e., 0.2 mL; m represents the sample mass, i.e., 0.5 g. Three technical replicates were performed for each group of samples, and the average value was taken.
[0039] (4) The test method for relative gene expression level refers to the test steps 1.1 to 1.4 in Example 1 above. The test sample is a banana sample stored at 6±1℃ for 5 days (the middle section of the banana peel after the head and tail are cut off).
[0040] 1.3 Experimental Results Depend on Figure 5As shown in A, compared with the blank control, overexpression of MaHPCA1-1 and MaHPCA1-3 genes reduced the browning symptoms of banana peel, and the relative expression levels of MaHPCA1-1 and MaHPCA1-3 were found to be 15.70 times and 44.33 times higher than those in the blank control, respectively. Figure 5 (B in the text). Further measurements were taken of H2O2 content and O2 content at the transient overexpression site and the blank control site. - The production rate and MDA content were compared; the H2O2 content in the blank control was 5.08 μmol g. -1 The H2O2 content at the overexpression site of MaHPCA1-1 was 2.56 μmol g. -1 The H2O2 content of the overexpressing MaHPCA1-3 site was 2.39 μmol g. -1 The H2O2 content in the overexpressed MaHPCA1-1 and MaHPCA1-3 fractions was reduced by 49.61% and 52.95% respectively compared to the control fraction. Figure 5 C in the blank control region O2 - The production rate is 0.2545 nmol g. -1 min -1 Overexpression of O2 at the MaHPCA1-1 site - The production rate is 0.1472 nmol g. -1 min -1 Overexpression of O2 at the MaHPCA1-3 site - The production rate is 0.1643 nmol g. -1 min -1 O2 - The production rate decreased by 42.16% and 35.44% ( Figure 5 The MDA content in the blank control region (D) was 1.45 nmol g. -1 The MDA content of the overexpressing MaHPCA1-1 site was 1.02 nmol g. -1 The MDA content of the overexpressing MaHPCA1-3 site was 0.95 nmol g. -1 The MDA content decreased by 29.66% and 34.48% ( Figure 5 (E in the text).
[0041] Example 4: Banana peel silencing MaHPCA1-1 and MaHPCA1-3 1.1 Experimental Methods First, the MaHPCA1-1 and MaHPCA1-3 fragments obtained in Example 2 were homologously recombinated with the pTRV2 vector to construct MaHPCA1-1-silenced and MaHPCA1-3-silenced silencing vectors. The specific steps are as follows: (1) Linearization of pTRV2 vector: The pTRV2 empty vector plasmid was linearized using forward primer: tgtttgagggaaaagtagagaacgt (SEQ ID NO.30) and reverse primer: ttaccgatcaatcaagatcagtcga (SEQ ID NO.31) according to the PCR amplification program. The total PCR reaction system of 20 μL was prepared as follows: PrimeSTAR MaxDNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; pTRV2 vector (concentration of 500 ng / μL): 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 90 s; for a total of 30 cycles. The incompletely linearized circular vector was removed using a Dpn I kit. The total reaction volume of 20 μL consisted of: 5 μL linearized vector, 1 μL DpnI, 2 μL 10×T buffer, and 12 μL sterile water. The reaction conditions were: 37°C for 4 h, followed by incubation at 70°C for 15 min. Agarose gel electrophoresis was performed for validation: the gel ran for 25 min; the target band was recovered, and after gel extraction, the fully linearized pTRV2 vector was purified using a Novizan gel extraction kit. (2) Amplification of homologous arm fragments of MaHPCA1-1 and MaHPCA1-3: The forward primer used to amplify the specific fragment (270bp) used for silencing in MaHPCA1-1 is: gggacatgcccgggcctcgagAGCCGCATGAATGCTTACCC (SEQ ID NO.14), and the reverse primer is: tggggatccggtaccgagctcTCATCGGGCCGCAACAGC (SEQ ID NO.15). The forward primer used to amplify the specific fragment (270bp) used for silencing in MaHPCA1-3 is: gggacatgcccgggcctcgagAAGTTCACAGAGTTGGCCTTGAG (SEQ ID NO.16), and the reverse primer is: tggggatccggtaccgagctcTTATTTGGGCTCGGGTTTTG (SEQ ID NO.17). PCR amplification was performed. The total PCR reaction volume of 20 μL was prepared as follows: PrimeSTARMax DNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; cDNA template: 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 10 s; for a total of 30 cycles. Finally, agarose gel electrophoresis was performed for verification: the gel running time was 25 min; after gel excision, the fragments MaHPCA1-1 and MaHPCA1-3 with homologous arms were purified using the Novizan gel extraction kit. (3) Ligation: Homologous recombination was performed using the In-Fusion kit. The recombination system consisted of 5 μL (1 μL of linearized pTRV2 vector, 1 μL of In-Fusion enzyme premix, 1 μL of MaHPCA1-1 or MaHPCA1-3 fragment with homologous arms, and 2 μL of sterile water). After reacting at 50℃ for 15 min, the homologous recombination products MaHPCA1-1-pTRV2 or MaHPCA1-3-pTRV2 were obtained. (4) Transformation plating and colony identification: 1 μL of the homologous recombination product of MaHPCA1-1-pTRV2 or MaHPCA1-3-pTRV2 was transformed into DH5α competent cells and plated (Kan resistant). After incubation at 37℃ for 12 h, colony identification was performed. Colonies containing the target fragment were screened and shaken. Positive colonies were picked up with a pipette tip and placed together with the pipette tip into 10 mL of liquid LB medium (Kan resistant). After incubation at 37℃ for 12 h, the plasmid was extracted to obtain the recombinant plasmids MaHPCA1-1-pTRV2 or MaHPCA1-3-pTRV2.
[0042] The cells were then transformed into Agrobacterium competent cells GV3101 (pSoup-p19), following the experimental method described in Example 3, Section 1.1. A mixed Agrobacterium infection solution containing equal volumes of empty pTRV1 and pTRV2 vectors was injected into the same fruit as a blank control. The low-temperature treatment time for pTRV2-MaHPCA1-1, pTRV2-MaHPCA1-3, and the blank control was the same. The fruits were then placed in a cold storage at 6±1℃ and 85% relative humidity, protected from light.
[0043] 1.2 H2O2 content, O2 - The production rate and MDA content were tested using the same method as in Example 3, Section 1.2. The relative gene expression level was tested using the same method as in Example 1, Sections 1.1 to 1.4. The test sample was a banana sample stored at 6±1℃ for 5 days (the middle section of the banana peel after the ends were cut off).
[0044] 1.3 Experimental Results Depend on Figure 6 As shown in section A, compared with the blank control, silencing the MaHPCA1-1 and MaHPCA1-3 genes did not reduce the browning symptoms of banana peel, and the relative expression levels of MaHPCA1-1 and MaHPCA1-3 were found to be lower in the blank control area. Figure 6 In section B), it was found that the H2O2 content in the silent MaHPCA1-1 and MaHPCA1-3 sites was higher than that in the blank control site. Figure 6 The H2O2 content in the C portion (the blank control portion) was 5.18 μmol g. -1 The H2O2 content of the silent MaHPCA1-1 site was 7.02 μmol / g. -1 The H2O2 content of the silent MaHPCA1-3 site was 7.24 μmol g. -1 O2 - The production rate increases ( Figure 6 (D in the blank control region) O2 - The production rate is 0.2374 nmol g. -1 min -1 O2 at the silent MaHPCA1-1 site - The production rate is 0.3207 nmol g. -1 min -1 O2 in the silent MaHPCA1-3 region - The production rate is 0.2804 nmol g. -1 min -1 The content of MDA increased ( Figure 6 The MDA content in the E region (the blank control region) was 1.38 nmol g.-1 The MDA content of the silent MaHPCA1-1 site was 1.77 nmol g. -1 The MDA content of the silent MaHPCA1-3 site was 1.81 nmol g. -1 .
[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. The application of a receptor-like kinase MaHPCA1 in alleviating banana chilling injury, characterized in that, The receptor kinase MaHPCA1 is either MaHPCA1-1 or MaHPCA1-3, the nucleotide sequence of MaHPCA1-1 is shown in SEQ ID NO.1, and the nucleotide sequence of MaHPCA1-3 is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, Overexpression of MaHPCA1-1 or MaHPCA1-3 in banana peel can alleviate chilling injury symptoms in bananas and improve the cold resistance of banana fruits.
3. A primer pair for cloning MaHPCA1-1 as described in claim 1, characterized in that, The forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.
4.
4. A primer pair for cloning MaHPCA1-3 as described in claim 1, characterized in that, The forward primer sequence is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.
6.
5. A method for cultivating chilling-resistant bananas, characterized in that, Includes the following steps: (1) The MaHPCA1-1 or MaHPCA1-3 described in claim 1 is ligated into a vector to obtain an overexpression vector; (2) The overexpression vector was transformed into Agrobacterium, cultured with shaking, centrifuged, and resuspended in the infection solution to obtain an infection solution containing recombinant bacteria; (3) The banana peel was infected with the recombinant bacteria infection solution obtained in step (2) to obtain cold-resistant bananas.
6. The method according to claim 5, characterized in that, The vector used in step (1) is the pGreenII 62-SK vector.
7. The method according to claim 5, characterized in that, The pH of the infiltration solution in step (2) is 5.2~5.
8.
8. The method according to claim 7, characterized in that, The pH of the infiltration solution is 5.
6.
9. The method according to claim 5, characterized in that, The inoculation solution in step (2) is prepared by mixing the following components: 98 mL of water, 1 mL of 1.0 M morpholine ethanesulfonic acid aqueous solution, 1 mL of 1.0 M magnesium chloride hexahydrate aqueous solution and 200 μL of 100 mM acetylsuccine aqueous solution.
Citation Information
Patent Citations
Grape hydrogen peroxide receptor gene as well as encoding protein and application thereof
CN113416737A
Banana fruit cold tolerance transcription factor gene function verification method
CN114107320A
Anti-freezing regulatory gene for rape and application of anti-freezing regulatory gene
CN120290603A
Gene related to low temperature resistance and transgenic plant
KR101485831B1
Novel Gene Implicated in Plant Cold Stress Tolerance and Use Thereof
KR101803500B1