Recombinant proteins, expression cassettes, immunogenic compositions and uses thereof

Abstract

The present invention relates to a recombinant protein comprising one or more fragments of the surface protein A (PspA) of the pneumococcal, and an adenylate cyclase (CyaA) from the genus Bordetella, in particular Bordetella pertussis, in which the fragments of the PspA are selected from the group consisting of clades 1 to 4, or a combination of two or more thereof. Furthermore, the present invention relates to an expression cassette comprising a DNA sequence encoding said recombinant protein, in particular a DNA sequence selected from the nucleotide sequences represented by SEQ ID NO: 12 to 18 and a degenerate sequence thereof, which respectively encode the recombinant protein represented by SEQ ID NO: 5 to 11. In addition, immunogenic compositions comprising the recombinant protein or the expression cassette and further pharmaceutically acceptable carriers and / or adjuvants are disclosed. Finally, the present invention relates to the use of said recombinant protein, said expression cassette or said immunogenic composition for the preparation of a vaccine for the prevention of infection by Streptococcus pneumoniae wherein said vaccine provides broad spectrum protection against different pneumococcal isolates regardless of serotypes.

Description

TECHNICAL FIELD

[0001] The present invention belongs to the field of molecular biology and biochemistry, more specifically to the field of peptides, as it relates to a recombinant protein comprising a CyaA and at least one PspA fragment. It also relates to an expression cassette encoding said recombinant protein, to an immunogenic composition comprising said protein or expression cassette, and to their use in obtaining a broad-spectrum vaccine against Streptococcus pneumoniae Streptococcus pneumoniae . BACKGROUND

[0002] Streptococcus pneumoniae is an important human pathogen causing diseases such as pneumonia, meningitis and sepsis. In 2016, 200 million cases of pneumococcal pneumonia occurred in all age groups, with 1 million deaths, including 340,000 children under 5 years of age. Conjugate vaccines (PCV10 (GSK) and PCV13 (Wyeth / Pfizer)) are the main tools against pneumococcal diseases.

[0003] However, among the 100 known serotypes of pneumococcus, these vaccines only provide protection against 10 or 13 serotypes included in the formulation. In addition, an increase in invasive diseases caused by serotypes not included in the formulation is observed in vaccinated populations, reducing the effectiveness of the vaccine. Recently, two new vaccines have been licensed, containing 15 (Merck Sharp & Dohme Corp) and 20 (Wyeth / Pfizer) protein-conjugated capsular polysaccharides, respectively, in an attempt to expand the serotype coverage. However, it is necessary to monitor for a long time the eventual increase in diseases caused by serotypes not included in these formulations.

[0004] To solve the problems of the prior art, the present invention proposes a recombinant protein (CyaA-PspA) comprising a CyaA of Bordetella Bordetella species (especially Bordetella pertussis Bordetella pertussis ) for presenting at least one PspA antigen fragment of Streptococcus pneumoniae.

[0005] CyaA is able to bind to receptors present on the surface of cells of the immune system, enhancing the immune response to the associated antigen. The recombinant CyaA-PspA protein containing a specific PspA fragment induces high levels of anti-PspA antibodies that bind to the surface of a variety of pneumococcal isolates, thus exhibiting reactivity independent of the capsular serotype.

[0006] Thus, the present invention makes it possible to obtain a recombinant protein for the development of a broad-spectrum vaccine against Streptococcus pneumoniae.

[0007] Some existing technical literature describes vaccine development against Streptococcus pneumoniae, including certain fragments of PspA.

[0008] Brazilian patent application No. PI 1003753-5 (filed on September 28, 2010, published on January 22, 2013, applicant: FUNDAÇÃO BUTANTAN) entitled "A synergistic immunogenic composition based on a combination of protein antigens, pertussis cell antigens, and inactivated toxins" SYNERGISTIC IMMUNOGENIC COMPOSITIONS BASED ON COMBINED ANTIGENS PROTEICOS WITH CELLULAR PERTUSSIS ANTIGEN AND INACTIVATED TOXINS The document describes an immunogenic composition for the prevention of pertussis and Streptococcus pneumoniae infection, but does not explicitly mention the use of CyaA toxin. In contrast, this invention proposes a recombinant protein composed of CyaA from the genus Bordetella (especially Bordetella pertussis) to obtain a vaccine formulation that provides broad-spectrum protection against various pneumococcal isolates.

[0009] International Patent Application No. PCT / IE2004 / 000140 (filed on October 24, 2004, published on April 21, 2005 as WO2005 / 035557 (A2), applicant: THE PROVOST, FELLOWS AND SCHOLARS OF THE COLLEGE OF THE HOLY AND UNDIVIDED TRINITY OF QUEEN ELIZABETH, NEAR DUBLIN) entitled "Use of adenylate cyclase in the treatment and / or prevention of immune-mediated diseases" ADENYLATE CYCLASE IN THE TREATMENT AND / OR PROPHYLAXIS OF IMMUNE-MEDICATED DISEASE The document refers to CyaA or its derivatives, mutants, fragments, variants, or peptides, which can be used to treat and / or prevent inflammatory and / or immune-mediated diseases and / or autoimmune diseases to obtain vaccine formulations against inflammatory diseases, infections, and autoimmune diseases. Furthermore, the document uses CyaA as an adjuvant, and there is no physical fusion between the antigen and the CyaA molecule, whereas in this invention, PspA is inserted into recombinant CyaA. In contrast, this invention proposes a vaccine formulation against Streptococcus pneumoniae infection comprising a CyaA-PspA protein capable of providing protection against pneumococcal infection expressing PspA1, PspA2, PspA3, PspA4, or PspA5.

[0010] Brazilian patent application No. PI 1013485 A2 (filed March 23, 2010, published May 4, 2021, applicants: INSTITUTE OF MICROBIOLOGY OF THE ASCR, VVI, INSTITUTE OF PHYSIOLOGY OF THE ASCR, VVI and INSTITUT PASTEUR), entitled "Polypeptides, polypeptide derivatives, pharmaceutical compositions, uses of polypeptide derivatives and methods for preparing protein carriers" POLIPTÍDEO, DERIVADO DE POLIPTÍDEO, COMPOSIÇ ÃO FARMACÊUTICA, USO DE UM DERIVADO DE POLIPTÍDEO, E, MÉTODO PARA A PREPARAÇÃ O DE UM VETOR PROTEINÁCEO The term "(")" describes peptides derived from CyaA used in the form of toxins or detoxification proteins to construct protein expression vectors for delivering molecules (particularly peptides, especially antigens) into cells (particularly cells expressing CD11b). In contrast, this invention describes a vaccine formulation against Streptococcus pneumoniae infection comprising a recombinant CyaA-PspA protein capable of providing protection against Streptococcus pneumoniae infection expressing PspA1, PspA2, PspA3, PspA4, or PspA5.

[0011] U.S. Patent Application No. US 2010 / 285068 (filed June 27, 2008, published November 11, 2010, applicant: UNIVERSIDAD DEL PAIS VASCO) entitled "A method for non-invasive bacterial internalization into eukaryotic cells" METHOD FOR THE INTERNALIZATION OF NON-INVASIVE BACTERIA IN EUKARYOTE CELLS The document relates to noninvasive bacterial internalization into eukaryotic cells for therapeutic and / or preventative purposes; specifically, it uses CyaA or its functionally equivalent variants as agents to induce noninvasive bacterial internalization into eukaryotic cells. Furthermore, in this literature, CyaA is added to bacteria to aid in their internalization into cells. However, they do not show any experimental evidence that CyaA assists in inducing an immune response against antigens expressed by the bacteria. However, the present invention differs from the aforementioned US literature in that it describes a specific vaccine formulation for Streptococcus pneumoniae infection comprising a recombinant CyaA-PspA protein capable of providing protection against pneumococcal infection expressing PspA1, PspA2, PspA3, PspA4, or PspA5.

[0012] U.S. Patent Application No. US 2015 / 320851 (filed March 22, 2013, published November 12, 2015, applicant: OSAKA UNIVERSITY) entitled "Pneumococcal Vaccine Containing Pneumococcal Surface Protein A" PNEUMOCOCCAL VACCINE CONTAINING PNEUMOCOCCAL SURFACE PROTEIN AThe aforementioned US literature discloses a pneumococcal vaccine containing pneumococcal surface protein A (PspA). However, unlike the aforementioned US literature, which does not mention the use of CyaA from Bordetella spp. (especially Bordetella pertussis), this invention proposes a vaccine formulation against Streptococcus pneumoniae infection containing recombinant CyaA-PspA protein.

[0013] Brazilian Patent Application No. BR 11 2015 001350 3 (filed July 23, 2013, published August 1, 2017, applicant: GENTICEL) entitled "Polynucleotides, chimeric polynucleotides, uses of polynucleotides, carriers, cell cultures, CyaA-derived proteins, chimeric proteins, compositions and methods for preparing chimeric proteins" POLINUCLEOTÍDEO, POLINUCLEOTÍDEO QUIMÉRICO, USO DO POLINUCLEOTÍDEO, VETOR, CULTURA DE CÉLULA, PROTEÍNA DERIVADA DE CYAA, PROTEÍNA QUIMÉRICA, COMPOSIÇÃO, E, MÉTODO PARA PRODUZIR UMA PROTEÍNA QUIMÉRICA The invention discloses a chimeric protein comprising (a) the N-terminal portion of a Bordetella CyaA protein, (b) a heterologous polypeptide, and (c) the C-terminal portion of a Bordetella CyaA protein for the production of an anti-HPV vaccine. However, an effective response to HPV infection using the HPV E7 antigen inserted into CyaA is primarily a cellular response, rather than the antibody response expected for a PspA-based anti-pneumococcal vaccine as proposed in this invention.

[0014] The title is "Development of protein vaccines against Streptococcus pneumoniae: Characterization of adjuvant components for pertussis cell vaccines and analysis of novel vaccine combinations" DESENVOLVIMENTO DE VACINAS PROTEICAS CONTRA STREPTOCOCCUS PNEUMONIAE: CARACTERIZAÇÃO DOS COMPONENTES ADJUVANTES DA VACINA CELULAR PERTUSSIS E ANÁLISE DE NOVAS COMBINAÇÕES VACINAIS The biotechnology doctoral dissertation "(Published in São Paulo in 2015 by Carolina Salcedo Rivillas)" describes a vaccine formulation composed of pneumococcal surface protein A (PspA), using whole-cell pertussis vaccine or Bordetella pertussis protein as adjuvant. However, unlike this invention, in that dissertation, PspA was simply combined (mixed) with CyaA, producing a small amount of anti-PspA antibodies and failing to provide protection against pneumococcal attack. In this invention, a PspA fragment is genetically inserted into a specific site within CyaA to prepare a recombinant CyaA-PspA fusion protein. Therefore, the results of that dissertation indicate that a simple combination of PspA with adenylate cyclase toxin induces moderate levels of anti-PspA antibodies but does not confer significant protection against Streptococcus pneumoniae infection. In contrast, this invention proposes a vaccine formulation against Streptococcus pneumoniae infection comprising the recombinant CyaA-PspA protein.

[0015] The article by Moreno AT et al., entitled "Immunization of mice with a single PspA fragment induces antibodies that mediate complement deposition on different pneumococcal strains and provide cross-protection" (published online in Clin Vaccine Immunol, January 2010), reveals that PspA4 and PspA5 can induce highly cross-reactive antibodies in vitro, which is reflected in cross-protection in mice. In contrast, this invention proposes a vaccine formulation against Streptococcus pneumoniae infection comprising the CyaA-PspA recombinant protein.

[0016] Therefore, although vaccines against pneumococcal infection already exist, there is no incentive in the prior art to obtain recombinant CyaA-PspA protein for use as a broad-spectrum vaccine against pneumococcal infection, as proposed in this invention.

[0017] Therefore, based on the cited prior art, currently available multivalent conjugate vaccines consist of purified capsular polysaccharides from different pneumococcal serotypes conjugated with carrier proteins, which can induce protection against invasive diseases and nasopharyngeal colonization in children. However, their effectiveness is limited to the serotypes contained in the formulation (a maximum of 20 out of 100 serotypes described to date), and there are concerns that serotypes not present in the vaccine formulation may replace common infecting strains.

[0018] Therefore, it is crucial to develop new candidate vaccines that can induce protection against a wider range of pneumococcal strains. Summary of the Invention

[0019] Advantageously, the present invention proposes recombinant CyaA-PspA proteins capable of inducing high levels of anti-PspA antibodies, which react with pneumococcal strains expressing PspA1, PspA2, PspA3, PspA4 and / or PspA5.

[0020] Recombinant CyaA-PspA protein can protect mice from invasive attacks by pneumococci expressing PspA2, PspA4, or PspA5, and the antibodies induced by CyaA-PspA protein have broad-spectrum reactivity against different pneumococcal isolates, indicating their good potential in conferring serotype-independent protection in vaccine composition.

[0021] As previously stated, this invention will provide significant advantages in broad-spectrum protection against different pneumococcal isolates.

[0022] In a first aspect, the present invention relates to a recombinant protein comprising one or more fragments of pneumococcal surface protein A (PspA) and adenylate cyclase (CyaA) of the genus Bordetella (especially Bordetella pertussis), wherein said fragments are derived from PspA of families 1 and 2, preferably fragments from clades 1 to 4, or a combination of two or more thereof.

[0023] In a second aspect, the present invention relates to an expression cassette comprising a DNA sequence selected from the nucleotide sequences shown in SEQ ID NO:12 to 18 and a degenerate sequence thereof, the sequences encoding recombinant proteins shown in SEQ ID NO:5 to 11.

[0024] In a third aspect, the present invention relates to an immunogenic composition comprising the recombinant protein or expression cassette and a carrier, optionally comprising a pharmaceutically acceptable adjuvant.

[0025] In a fourth aspect, the present invention relates to the use of the recombinant protein, the expression cassette, or the immunogenic composition in the preparation of a vaccine for the prevention of Streptococcus pneumoniae infection, wherein the vaccine preferably provides broad-spectrum protection against different Streptococcus pneumoniae isolates regardless of serotype.

[0026] In a fifth aspect, the present invention relates to a method for preventing Streptococcus pneumoniae infection in a subject in need, wherein the method comprises administering an immunogenic composition according to the invention to the subject. Attached Figure Description

[0027] The invention, along with its further advantages, can be better understood by referring to the accompanying drawings and the following description.

[0028] Figure 1 illustrates the recombinant CyaA-PspA protein graphically, where (A) is a schematic diagram of PspA from clades 2 and 4, along with their respective N-terminus and F5 fragments; (B) is the protein analyzed by SDS-PAGE, with CyaA-PspA2-F5 and CyaA-PspA4-F5 proteins using 8% polyacrylamide gel (left), or PspA2F5 and PspA4-F5 using 15% polyacrylamide gel (right), with PspA2Pro and PspA4Pro used as controls; (C) is the anti-PspA2 (left) or anti-PspA4 (right) assays by immunoblotting, which recognize PspA2-F5 and PspA4-F5 expressed alone or in the CyaA system, with PspA2Pro and PspA4Pro used as positive controls and CyaA-OVA21 used as a negative control. Arrows indicate the target band, and "MW" refers to the full-range rainbow molecular weight marker (Cytiva, USA).

[0029] Figure 2 graphically illustrates the induction of anti-PspA antibodies in mice immunized with CyaA-PspA protein. Mouse serum was collected after one, two, or three immunizations with the recombinant protein, and anti-PspA2 (A and C) or anti-PspA4 (B and D) IgG was measured by ELISA. Circles represent individual levels, and lines represent the median for each group. Dashed lines indicate the detection limit.

[0030] Figure 3 graphically represents the equilibrium IgG1 / IgG2a titers induced by CyaA-PspA protein, where the induction of anti-PspA2 (A) or anti-PspA4 (B) IgG1 and IgG2a titers in mouse serum immunized with three doses was assessed by ELISA. The bars represent the mean for each group, with standard deviation. The numbers above the bars represent the IgG1 / IgG2a ratio (mean for each group). The IgG1 / IgG2a ratio was not calculated for groups with serum below the detection limit (dashed line).

[0031] Figure 4 graphically illustrates the binding of antibodies induced by CyaA-PspA protein immunization to the surface of pneumococci. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains. The numbers represent the median fluorescence intensity of each curve. The name of each strain, along with its serotype and PspA clade, is indicated in each figure.

[0032] Figure 5 graphically illustrates complement deposition induced on the surface of pneumococci by mouse serum immunized with CyaA-PspA protein. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains. The numbers represent the median fluorescence intensity of each curve. The name of each strain, along with its serotype and PspA clade, is indicated in each figure.

[0033] Figure 6 graphically illustrates the protection of mice immunized with CyaA-PspA against challenges from strains expressing homologous and heterologous PspA, where mice were immunized with two doses (B) or three doses (A and C) of the recombinant protein and challenged with the pneumococcal strains shown.

[0034] Figure 7 graphically illustrates the induction of anti-PspA antibodies and protection against pneumococcal infection by immunization with the CyaA-PspA2-F5-PspA4-F5 protein, where (A) is a schematic diagram of the fusion fragment composed of PspA2-F5 and PspA4-F5 expressed in the CyaA platform; (B) is CyaA-PspA2-F5-PspA4-F5 as analyzed by SDS-PAGE using 8% polyacrylamide; (C and D) are mouse serum collected after three immunizations with the recombinant protein. The induction of anti-PspA2 (C) or anti-PspA4 (D) IgG was analyzed by ELISA. Circles represent individual levels, and lines represent the median for each group. Dashed lines indicate the limit of detection. (E) are mice challenged with the A66.1 strain of pneumococcus.

[0035] Figure 8 graphically illustrates the binding of antibodies induced by CyaA-PspA-F5 immunization to the surfaces of different pneumococcal strains. Serum obtained after the third immunization was pooled for each group and incubated with strains of different serotypes. The numbers represent the average fluorescence intensity of each curve. The name of each strain, along with its serotype and PspA clade, is indicated in each figure.

[0036] Figure 9 graphically illustrates the binding of antibodies induced by CyaA-PspA2-F5-PspA4-F5 immunization to the surface of different pneumococcal strains. Serum obtained after the third immunization was pooled for each group and incubated with strains of different serotypes. The numbers represent the median fluorescence intensity of each curve. The name of each strain, along with its serotype and PspA clade, is indicated in each figure.

[0037] Figure 10 graphically illustrates the complement deposition induced on the surface of pneumococci by mouse serum immunized with CyaA-PspA2-F5-PspA4-F5. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains. The numbers represent the median fluorescence intensity of each curve. The name of each strain, along with the serotype and PspA clade, is indicated in each figure.

[0038] Figure 11 graphically illustrates how CyaA-A2-A4 protein induces high levels of anti-PspA2 and PspA4 antibodies and protects mice against pneumococcal lung colonization and invasive infection by pneumococcal strain 3JYP2670 (ST3, PspA4). Mice were immunized with three doses of either CyaA-A2-A4 or PCV13 vaccine. Serum IgG induction against PspA2 (A), PspA4 (B), or polysaccharide 3 (PS3, C) was assessed. Colonization was assessed in BALF (D) or lung (E) at 12 hours post-challenge. IgG against PspA4 (F) or PS3 (G) was assessed in BALF at 12 hours post-challenge. Survival was assessed at 10 days post-challenge (H). Antibody and CFU levels were assessed using one-way ANOVA, with intergroup comparisons performed using Tukey's post-hoc test. Survival was assessed using Log-Rank survival curves and the Mantel-Cox test for intergroup comparisons. ***P<0.001 and ****P<0.0001. Circles represent individual data, and lines represent the mean for each group. Dashed lines indicate the detection limit (AG) for each method.

[0039] Figure 12The surface of pneumococcal strains expressing PspA1, immunized with CyaA-A2 and CyaA-A4, is not bound graphically. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains expressing PspA of clade 1. Binding was assessed by flow cytometry in a FACS Canto II instrument after incubation with anti-IgG-FITC. Results were analyzed using FlowJo V10.1 software, recording 15,000 events. The numbers represent the mean fluorescence intensity (MFI) for each curve. The name of each strain, along with the serotype and PspA clade, is indicated in each graph. Antibodies induced by CyaA-A2 and CyaA-A4 do not bind to the surface of pneumococcal strains expressing PspA1. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains expressing PspA of clade 1. Binding was assessed by flow cytometry in a FACS Canto II instrument after incubation with anti-IgG-FITC. Results were analyzed using FlowJo V10.1 software, recording 15,000 events. The numbers represent the mean fluorescence intensity (MFI) for each curve. The name of each strain, along with its serotype and PspA clade, is indicated in each graph.

[0040] Figure 13 is a schematic diagram of the insertion of A1 and / or A3 fragments into the AC domain of CyaA. (A) Insertion of A1 at the first position of CyaA to generate CyaA-A1 or insertion of A1-A3 fusion to generate CyaA-A1-A3. (B) Insertion of A1 at the second position of CyaA-A2-A4 (of which the first position contains A2-A4 of the CyaA molecule) to generate CyaA-A2-A4 / A1 or insertion of A1-A3 to generate CyaA-A2-A4 / A1-A3. (C) Insertion of A1-A3 at the 3' end of A4 in the CyaA-A2-A4 molecule to generate CyaA-A2-A4-A1-A3, containing all fusion fragments at the same position. (D) SDS-PAGE electrophoresis of CyaA-PspA protein after purification steps. Lanes: (1) CyaA-A1; (2) CyaA-OVA / A1; (3) CyaA-A1-A3; (4) CyaA-OVA-A1-A3; (5) CyaA-A2-A4 / A1; (6) CyaA-A2-A4 / A1-A3; (7) CyaA-A2-A4-A1-A3. Molecular weight ladder standard: SeeBlue Plus2 pre-stained protein standard (Thermo). CyaA-OVA / A1 (a CyaA molecule containing an OVA peptide at the first position and an A1 peptide at the second position) and CyaA-OVA / A1-A3 (a CyaA molecule containing an OVA peptide at the first position and an A1-A3 peptide at the second position) are constructed intermediate antigens used to help obtain other proteins and are not presented as vaccine antigens.

[0041] Figure 14 graphically illustrates the induction of antibodies recognizing multiple clades of PspA in mice immunized with different CyaA-PspA-based formulations. Mice were immunized with three doses of CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3. The control group received CyaA-OVA21. Serum IgG induction against PspA1 (A), PspA2 (B), PspA3 (C), PspA4 (D), or PspA5 (E) was evaluated. Antibody and CFU levels were assessed by one-way ANOVA, and intergroup comparisons were performed using Tukey's post-hoc test. **P < 0.01; ***P < 0.001 and ****P < 0.0001. Circles represent individual data, and lines represent the mean for each group. Dashed lines indicate the detection limit of the method.

[0042] Figure 15 graphically illustrates the surface binding of PspA1 and PspA3-expressing pneumococcal strains immunized with formulations containing CyaA-A2-A4 and A1 and / or A3. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains expressing clades 1 or 3. Binding was assessed by flow cytometry in a FACS Canto II instrument after incubation with anti-IgG-FITC. Results were analyzed using FlowJo V10.1 software, recording 15,000 events. Numbers represent the mean fluorescence intensity of each curve. The name of each strain, along with the serotype and PspA clade, is indicated in each figure.

[0043] Figure 16 graphically illustrates the surface binding of pneumococcal strains expressing PspA2, PspA4, and PspA5 to antibodies induced by immunization with formulations containing CyaA-A2-A4 and A1 and / or A3. Serum obtained after the third immunization was pooled for each group and incubated with different pneumococcal strains expressing clades 1 or 3. Binding was assessed by flow cytometry in a FACS Canto II instrument after incubation with anti-IgG-FITC. Results were analyzed using FlowJo V10.1 software, recording 15,000 events. Numbers represent the mean fluorescence intensity of each curve. The name of each strain, along with the serotype and PspA clade, is indicated in each figure.

[0044] Figure 17 graphically illustrates the lung colonization of mice immunized against EF3030 isolate (ST19F, PspA1) using CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3 proteins. Mice were immunized with three different formulations and challenged with EF3030 pneumococcal strain intranasally. Lung colonization was assessed 24 hours post-challenge (A). IgG against PspA1 was assessed in BALF before challenge (B) and 24 hours post-challenge (C). Antibody and CFU levels were compared using one-way ANOVA, and intergroup comparisons were performed using Tukey's post-hoc test. ***P < 0.001 and ****P < 0.0001. Circles represent individual data, and lines represent the mean for each group. Dashed lines indicate the detection limits for each method. Detailed Implementation

[0045] Although the invention may be implemented in different ways, preferred embodiments are shown in the following detailed discussion. It should be understood that these embodiments are to be regarded as examples of the principles of the invention and are not intended to limit the invention to the contents described in this specification.

[0046] This invention relates to a recombinant protein (CyaA-PspA) comprising one or more fragments of pneumococcal surface protein A (PspA) and adenylate cyclase (CyaA) of Bordetella spp. (especially Bordetella pertussis).

[0047] The PspA fragments are selected from the PspA clades belonging to families 1 and 2, preferably fragments from clades 1 to 4, or combinations of two or more thereof.

[0048] PspA is a virulence factor exposed on the surface of all pneumococcal isolates described to date. PspA helps bacteria evade the immune system by inhibiting complement deposition on the surface of pneumococci and impairing the bactericidal activity of lactoferrin, a component of the mucosal surface innate immune response.

[0049] PspA plays an important role in virulence because it interacts with the host's immune system and helps bacteria evade phagocytosis. PspA is divided into three families, comprising six clades: family 1 PspA (clades 1 and 2), family 2 PspA (clades 3, 4, and 5), and family 3 PspA (clade 6).

[0050] In one embodiment of the invention, the recombinant protein comprises fragments (PspA2-F5 and PspA4-F5) at the N-terminal end of PspA encoding clades 2 and 4, belonging to families 1 and 2, respectively.

[0051] In one embodiment of the invention, the recombinant protein comprises fragments (PspA1-F5-PspA3-F5) at the N-terminal end of PspA encoding clades 1 and 3, belonging to families 1 and 2, respectively.

[0052] In one embodiment of the invention, the recombinant protein comprises a fragment (PspA2-F5-PspA4-F5-PspA1-F5) at the end of the N-terminal region of PspA encoding clades 2, 4 and 1.

[0053] In one embodiment of the invention, the recombinant protein comprises a fragment at the end of the N-terminal region of PspA encoding clades 2, 4, 1 and 3 (PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5).

[0054] It is worth noting that the N-terminal region is a variable part of the molecule, and the initial or final amino acid varies depending on the sequence. Therefore, the N-terminal region is different for each molecule, even within the same evolutionary branch.

[0055] In one embodiment of the invention, more specifically, the PspA fragment comprises at least one amino acid sequence selected from the group consisting of: -PspA2-F5 consists of the amino acid sequence shown in SEQ ID NO:1; -PspA4-F5 consists of the amino acid sequence shown in SEQ ID NO:2; -PspA1-F5 consists of the amino acid sequence shown in SEQ ID NO:3; and -PspA3-F5 consists of the amino acid sequence shown in SEQ ID NO:4.

[0056] In another embodiment of the invention, the PspA fragment comprises at least one amino acid sequence selected from the group consisting of amino acid sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher identity with SEQ ID NO:1-4.

[0057] In one embodiment of the invention, the PspA fragment is encoded by a nucleotide sequence selected from the group consisting of: -The DNA sequence shown in SEQ ID NO:29 and its degenerate sequence encode PspA2-F5 shown in SEQ ID NO:1; -The DNA sequence shown in SEQ ID NO:30 and its degenerate sequence encode PspA4-F5 shown in SEQ ID NO:2; -The DNA sequence shown in SEQ ID NO:31 and its degenerate sequence, encoding PspA1-F5 shown in SEQ ID NO:3; and -The DNA sequence shown in SEQ ID NO:32 and its degenerate sequence encode PspA3-F5 shown in SEQ ID NO:4.

[0058] In another embodiment of the invention, the PspA fragment is encoded by a nucleotide sequence selected from the group consisting of nucleotide sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher identity with SEQ ID NO:29-32.

[0059] The PspA fragment was cloned into the allowable site of CyaA to obtain the recombinant CyaA-PspA protein. For this purpose, CyaA was engineered to express the N-terminal region of PspA as described herein. Adenylate cyclase (CyaA) is derived from the genus *Bordezoella* (e.g., *Bordezoella pertussis*, *Bordezoella parapertussis*). Bordetella parapertussis ), Bordetella bronchiseptica ( Bordetella bronchiseptica ), Bordetella sinensis ( Bordetella hinzii(), especially Bordetella pertussis. The amino acid sequence and nucleotide sequence of Bordetella pertussis are designated as SEQ ID NO:33 and 34, respectively.

[0060] Bordetella pertussis CyaA is a 1706-residue protein composed of an N-terminal catalytic domain (AC) and a C-terminal RTX-like region. It participates in the binding of the toxin to the CD11b / CD18 receptor expressed on antigen-presenting cells. Upon binding, the adenylate cyclase (AC) domain enters the host cell and catalyzes the production of cyclic adenosine monophosphate (cAMP), thereby disrupting cell activity.

[0061] CyaA has an affinity for the CD11b receptor present in immune system cells, such as dendritic cells (DCs). Target antigens can be fused with CyaA genetically or chemically to produce recombinant proteins delivered in vivo to DCs, inducing the production of specific antibodies and activating T-CD4 and T-CD8 lymphocytes. As a result, CyaA enhances the specific immune response to the relevant antigen.

[0062] The protein used is CyaA or a functional fragment thereof. The fragment may be a truncated CyaA, in which residues at one or both ends are deleted. Specifically, the C-terminal residues may be deleted to the extent that they do not affect the recognition and binding sites of the CD11b / CD18 cell receptor. Alternatively, or additionally, N-terminal residues may be deleted, as long as they do not affect the translocation ability of the CyaA fragment. It may also be a fragment obtained by deleting one or more residues within the native CyaA protein. A specific fragment is one in which amino acid residues 225 to 234 of the CyaA protein have been deleted, thus providing a CyaA fragment containing residues 1 to 224 and 235 to 1706 (when referring to the amino acid sequence of the Bordetella pertussis CyaA protein). The functional fragment retains the ability of the full-length CyaA to bind to cells (especially cells expressing CD11b / CD18) and ultimately retains the ability of its N-terminal domain to translocate into the target cell cytosol.

[0063] In one particular embodiment, the enzymatic activity of the CyaA protein, namely its ability to convert ATP to cAMP, is inactivated. This inactivation can be achieved through genetic inactivation. For example, genetic inactivation can be achieved by introducing a dipeptide at a site in the catalytic site portion of the amino acid sequence of CyaA (e.g., between 188 and 189). Preferably, the process involves inserting leucine (L) and glutamine (Q) residues between aspartic acid (D) at position 188 and isoleucine (I) at position 189. These insertions eliminate the activity of adenylate cyclase. Inactivation in this specification is not limited to the insertion of a dipeptide between 188 and 189. Inactivation of enzyme activity can also be achieved by modifying certain amino acids involved in the catalysis (e.g., Lys58 to Gln, Lys65 to Gln (Glaser et al., 1989), Asp188 to Asn, Asp190 to Asn, His298 to Leu (Glaser et al., 1991). Insertion of an antigen fragment between glycine at position 335 and glutamine at position 336 also eliminates the enzyme activity of adenylate cyclase (Ladant et al., 1992).

[0064] Therefore, a recombinant protein was developed by mutating residues in the AC domain of CyaA that are important for adenylate cyclase activity, thereby inactivating the toxin (as previously described, through the presence of the DLQI sequence in CyaA). "Allowable sites" are sites in the CyaA protein sequence where polypeptides can be inserted without substantially affecting the functional properties of the CyaA protein, particularly its targeting of cells (especially APCs), including substantially not affecting its specific binding to the CD11b-CD18 receptor, and advantageously substantially not affecting the domains in the protein involved in epitope translocation to target cells. The permissible sites for epitope translocation of the CyaA catalytic domain of Bordetella pertussis adenylate cyclase, which allow insertion into such permissible sites, include, but are not limited to, residues 137-138 (Val-Ala), residues 224-225 (Arg-Ala), residues 228-229 (Glu-Ala), residues 235-236 (Arg-Glu), and residues 317-318 (Ser-Ala) (Sebo et al., 1995), residues 107-108 (Gly-His), residues 132-133 (Met-Ala), residues 232-233 (Gly-Leu), residues 319-320 (Thr-Gly), residues 335-336 (Gly-Gln), and residues 336-337 (Gln-Gln). In one specific embodiment, at least one PspA fragment is inserted between residues 224 and 225 of *Bordeaux pertussis* adenylate cyclase. In another specific embodiment, at least one PspA fragment is inserted between residues 319 and 320 of *Bordeaux pertussis* adenylate cyclase. In yet another specific embodiment, *Bordeaux pertussis* adenylate cyclase comprises at least two PspA fragments, and at least one PspA fragment is inserted between residues 224 and 225 of *Bordeaux pertussis* adenylate cyclase, and at least one PspA fragment is inserted between residues 319 and 320 of *Bordeaux pertussis* adenylate cyclase.

[0065] In one embodiment of the present invention, the obtained recombinant protein is selected from the group consisting of or composed of the following amino acid sequences: - The recombinant protein CyaA-PspA2-F5 consists of the amino acid sequence shown in SEQ ID NO:5; - The recombinant protein CyaA-PspA4-F5 consists of the amino acid sequence shown in SEQ ID NO:6; - The recombinant protein CyaA-PspA2-F5-PspA4-F5 consists of the amino acid sequence shown in SEQ ID NO:7; - The recombinant protein CyaA-PspA1-F5 consists of the amino acid sequence shown in SEQ ID NO:8; - The recombinant protein CyaA-PspA1-F5-PspA3-F5 consists of the amino acid sequence shown in SEQ ID NO:9; - The recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5 consists of the amino acid sequence shown in SEQ ID NO: 10; and - The recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5 consists of the amino acid sequence shown in SEQ ID NO:11.

[0066] In another embodiment of the invention, the obtained recombinant protein is selected from the group consisting of or composed of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher identity with SEQ ID NO:5-11.

[0067] In one embodiment, the recombinant protein of the present invention is encoded by a nucleotide sequence selected from or comprising the group consisting of: The DNA sequence shown in SEQ ID NO:12 and its degenerate sequence encode the recombinant protein CyaA-PspA2-F5 shown in SEQ ID NO:5; -The DNA sequence shown in SEQ ID NO:13 and its degenerate sequence encode the recombinant protein CyaA-PspA4-F5 shown in SEQ ID NO:6; -The DNA sequence shown in SEQ ID NO:14 and its degenerate sequence encode the recombinant protein CyaA-PspA2-F5-PspA4-F5 shown in SEQ ID NO:7; -The DNA sequence shown in SEQ ID NO:15 and its degenerate sequence encode the recombinant protein CyaA-PspA1-F5 shown in SEQ ID NO:8; -The DNA sequence shown in SEQ ID NO:16 and its degenerate sequence encode the recombinant protein CyaA-PspA1-F5-PspA3-F5 shown in SEQ ID NO:9; -The DNA sequence shown in SEQ ID NO:17 and its degenerate sequence encode the recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5 shown in SEQ ID NO:10; and The DNA sequence shown in SEQ ID NO:18 and its degenerate sequence encode the recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5 shown in SEQ ID NO:11.

[0068] In another embodiment, the recombinant protein of the present invention is encoded by a nucleotide sequence selected from the group consisting of or composed of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher identity with SEQ ID NO:5-11.

[0069] Furthermore, the inventors of this invention declare that they obtained access to Brazilian national genetic heritage and / or related traditional knowledge during the research and technological development that led to this patent application, and inform that the registration number (Sisgen) is A3B0F7E.

[0070] Furthermore, the present invention relates to an expression cassette comprising a DNA sequence according to the present invention, particularly a DNA sequence selected from the nucleotide sequences shown in SEQ ID NO:12 to 18 and its degenerate sequence, which encodes the recombinant protein shown in SEQ ID NO:5 to 11.

[0071] Furthermore, the present invention relates to immunogenic compositions comprising the recombinant protein or the expression cassette, as well as other pharmaceutically acceptable carriers and / or adjuvants.

[0072] Preferably, the immunogenic composition is in the form of a vaccine.

[0073] Pharmaceutically acceptable carriers are non-toxic, inert solid, semi-solid, or liquid excipients, diluents, any type of formulation adjuvant, or simply sterile aqueous media such as saline. Examples of materials that can be used as pharmaceutically acceptable carriers and / or adjuvants include sugars (such as lactose, glucose, and sucrose), starches (such as corn starch and potato starch), cellulose and its derivatives (such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate), cyclodextrins; oils (such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil); glycols (such as propylene glycol), polyols (such as glycerol, sorbitol, mannitol, and polyethylene); esters (such as ethyl laurate, ethyl oleate, and agar); buffers (such as aluminum hydroxide and magnesium hydroxide); alginate; pyrogen-free water; isotonic saline, Ringer's solution; ethanol and phosphate buffer solutions; and other compatible, non-toxic substances used in pharmaceutical preparations.

[0074] Therefore, a pharmaceutically acceptable carrier and / or adjuvant is any pharmaceutically acceptable carrier or adjuvant known in the prior art for obtaining a vaccine.

[0075] In one embodiment, the immunogenic composition is administered parenterally, including subcutaneously, intradermally, and intramuscularly.

[0076] In one embodiment, the immunogenic composition is administered via a mucosal route, preferably an intranasal route.

[0077] Furthermore, the present invention relates to the use of the recombinant protein, the expression cassette, or the immunogenic composition in the preparation of a medicament for the prevention of Streptococcus pneumoniae infection.

[0078] Preferably, the drug is a vaccine for preventing pneumococcal infection, which provides broad-spectrum protection against different pneumococcal isolates regardless of serotype.

[0079] In a particular embodiment, the recombinant CyaA-PspA protein of the present invention can induce high levels of anti-PspA antibodies, which react with pneumococcal strains expressing PspA2, PspA3, PspA4 and PspA5.

[0080] Furthermore, the PspA4 fragment of the present invention satisfactorily induces cross-reactivity against PspA5 without the need to include PspA5 in the immunogenic composition. Therefore, PspA4 induces cross-reactive antibodies and also provides protection against pneumococcal strains expressing clade 5 PspA.

[0081] Therefore, this invention develops a candidate vaccine capable of inducing an effective immune response against PspA in mice, utilizing the adjuvant properties of Bordetella spp. (especially Bordetella pertussis) adenylate cyclase (CyaA) and the obtained CyaA-PspA protein for mouse immunization experiments.

[0082] Although the invention has been described in conjunction with specific embodiments thereof, it will be apparent to those skilled in the art that many alternatives, modifications, and variations will be apparent from the foregoing description. Therefore, it is intended to encompass all such alternatives, modifications, and variations falling within the spirit and broad scope of the appended claims. The aspects and embodiments of the invention disclosed herein are also supported by the following non-limiting embodiments.

[0083] Example Materials and methods - Bacteria: DNA clones were performed in *E. coli* XL1-Blue or DH5α to construct either the CyaA-PspA2-F5 (SEQ ID NO:5) or CyaA-PspA4-F5 (SEQ ID NO:6) constructs. The CyaA-PspA-F5 protein was expressed in *E. coli* BLR strain, while *E. coli* BL21 Star pLyS strain was used for PspA-F5 protein expression. Bacteria were grown in LB medium (Difco) at 37°C, supplemented with 100 μg / ml ampicillin for plasmid selection.

[0084] Streptococcus pneumoniae strains ATCC6303 (serotype 3, PspA5); 3JYP2670 (serotype 3, PspA4); A66.1 (serotype 3, PspA2); D39 (serotype 2, PspA2); M10 (serotype 11A, PspA3); and TIGR4 (serotype 4, PspA3) were grown at 37°C on trypsin-soy agar (blood agar, Laborclin, Brazil) containing 5% defibrinated sheep blood. Stock solutions for animal challenge were prepared in liquid Todd-Hewitt medium (Difco) (THY) supplemented with 0.5% yeast extract. Bacterial growth reached the exponential phase (OD600). nm =0.4), centrifuged and resuspended in 1 / 10 of the initial volume of THY containing 20% ​​glycerol. The stock solution was maintained at -80°C and quantified by inoculation onto blood agar plates.

[0085] - Plasmids and recombinant proteins : The pspA-F5 fragment encodes the last part of the N-terminal region of PspA, including the clade-defined region (CDR) of either PspA2 (pneumococcal strain Rx1, GenBank accession number M74122.1) or PspA4 (pneumococcal strain 255 / 00, GenBank accession number EF649969). The fragment was amplified by PCR using either the pAE-pspARX1 plasmid (Vadesilho CF et al., 2014) or the pAE-PspA4Pro plasmid (Darrieux M et al., 2008) as templates.

[0086] For the CyaA-PspA construct, the DNA fragments corresponding to pspA2-F5 (SEQ ID NO:12) and pspA4-F5 (SEQ ID NO:13) were amplified using the following specific primers (Nhe I and Kpn I restriction sites are in bold): - cya-pspA2-F5 Forw (SEQ ID NO:19): 5'- GGCGCGTACGCGTAGGCCTT GCTAGCTCTGAATCAGAAGATTATGCTAAA 3', and - cya-pspA2-F5 Rev (SEQ ID NO:20): 5'- CCGTGGCCTCGCTGGCGGC GGTACCTGGAGTTTCTGGAGCTGGAGCTGG 3'; or - cya-pspA4-F5 Forw (SEQ ID NO:21): 5' GGCGCGTACGCGTAGGCCT GCTAGCTCAAACGGTGAGCAAGCTGA 3'; and - cya-pspA4-F5 Rev (SEQ ID NO:22): 5' CGTGGCCTCGCTGGCGGC GGTACCTGGAGCTGGAGCTGGTTTTTCT 3'.

[0087] Then, using Gibson assembly technology (Karimova G et al., 1998), the purified DNA fragment was cloned between the Nhe I and Kpn I sites of the pCACT-E5 vector (Guermonprez P et al., 2000) to generate pCACT- pspA2- F5 and pCACT- pspA4-F5 Expression vector. Nucleotide sequencing performed via Eurofins verifies correct insertion (the vector's nucleotide sequence is available upon request). Additionally, the expression vector is constructed. pspA2-F5 (SEQ ID NO:1) and pspA4-F5 The CyaA plasmid for the (SEQ ID NO:2) fragment is shown below. Using primers A2-f51 (5'-GACCGATTACCTGGCGCGTACGCGCCGTTCTGAATCAGAAGATTATGCT-3') from SEQ ID NO:27 and A2-f52 (5'-TGAGCTAGCAGGCCTACGCGTACCTGGAGTTTCTGGAGCTGG-3') from SEQ ID NO:28, the plasmid was obtained from pCACT- pspA2 -F5 amplification of the DNA fragment encoding pspA2-F5, purification, and subcloning via Gibson cloning into BsiWI-linearized pCACT- pspA4-F5 (As shown above, correct insertion was verified through nucleotide sequencing). The resulting plasmid pCACT- pspA2-A4-F5 Expressing Carry pspA2-F5 and pspA4-F5 The recombinant CyaA fragment, separated by small peptide linkers (TRRPAS, amino acid single-letter codes), was expressed and purified as described previously (Guermonprez P et al., 2000; Karimova G et al., 1998; and Preville X et al., 2005).

[0088] In summary, the expression plasmid was transformed into *E. coli* BLR strain (Novagen, Sigma-Aldrich). Transformed cells were grown in LB medium at 37°C to the mid-log phase, and expression of the recombinant CyaA-PspA protein was induced by the addition of 0.5 mM IPTG (isopropyl β-D-1-thiogalactopyranoside). After 2.5 hours of regrowth at 37°C, bacteria were collected by centrifugation, resuspended in 20 mM Hepes-Na buffer (pH 7.5), and lysed using an sonicator (Branson Sonifier® 250, Emerson Electric Co., USA). Purification of the recombinant protein was performed from inclusion bodies dissolved in 8 M urea and 20 mM Hepes-Na (pH 7.5). Protein purification was performed by ion-exchange chromatography on DEAE-agarose followed by hydrophobic chromatography on phenyl-agarose, including a cleaning step of washing with isopropanol to remove endotoxin contamination, as previously described (Preville X et al., 2005).

[0089] Protein concentration was determined spectrophotometrically based on absorption at 278 nm, with the molecular extinction coefficient calculated from the amino acid sequence used for each molecule. http: / / www.expasy.org / tools / protparam.html ).

[0090] The CyaA-OVA protein (SEQ ID NO:25) used as a negative control in the immunization experiments was produced using the same procedure, using BLR bacteria transformed with the pCACT-E5-CyaA-OVA21 plasmid (Guermonprez P et al., 2000). pspA2-F5 pAE- pspA2Rx1 and pAE- pspA4Pro The vector was constructed as previously described (Vadesilho CF et al., 2014; and Darrieux M et al., 2008). For pAE- pspA4-F5 Plasmid construction was performed using pAE- pspA4Pro The vector was used as a template and the fragment was amplified using the following primers: - SEQ ID NO:23: Forw 5' GGATCCTCAAACGGTGAGCAAGCTGAAC 3'; and - SEQ ID NO:24: Rev: 5' AAGCTTTCATGGAGCTGGAGCTGGTTTTTCTGG 3'.

[0091] Will pspA4-F5Fragments were cloned into the Bam HI and Hind III sites of the pAE vector (Teodorowicz M et al., 2017). Expression of PspA2-F5, PspA4-F5, PspA2Pro, and PspA4Pro in BL21 Star pLyS was induced for 3 h at 37°C by adding 1.2 mM IPTG to the culture. Bacteria were lysed in a PANDA homogenizer (GEA Niro Soavi, Italy), and proteins were purified by affinity chromatography in a HisTrap 5 mL column (Cyvita, USA) as previously described (Darrieux M et al., 2008).

[0092] Additional purification steps were performed to remove excess LPS, including treatment with 2% Triton X-114 followed by detergent removal using Bio-Beads SM-2 resin (Bio-rad Laboratories, USA) (Salcedo-Rivillas C et al., 2014). The purified protein was analyzed by SDS-PAGE and quantified using the Bio-Rad Protein Assay reagent (BioRad, USA). Western blotting was performed using polyclonal anti-PspA2 or anti-PspA4 antiserum (manufactured in the laboratory) and horseradish peroxidase (HRP) conjugated anti-mouse IgG (Sigma-Aldrich, USA). Results were evaluated using the Amersham ECLPrime assay kit (Cyvita) and an Amersham ImageQuant 800 instrument (Cyvita).

[0093] - Mouse immunization and immune response analysis : Using female SPF BALB / c mice, the protein dosage was adjusted to 50 pmol per mouse based on the molecular weight differences between CyaA-PspA-F5 protein (approximately 200 kDa, 10 μg per dose) and PspA-F5 protein (PspA2-F5 at 11.3 kDa and 0.6 μg / dose, PspA4-F5 at 17.4 kDa and 0.9 μg / dose).

[0094] To analyze the fusion protein, mice were immunized with a mixture of 10 μg CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7) or 20 μg CyaA-PspA2-F5 (SEQ ID NO:5) + CyaA-PspA4-F5 (SEQ ID NO:6) (10 μg of each protein) as a positive control.

[0095] In all experiments, the control group received purified CyaA-OVA21 (10 μg per dose) or saline. Mice (n=6 per group) received two or three subcutaneous injections at 15-day intervals.

[0096] Fourteen days after the second and third immunizations, blood was collected under local anesthesia via the posterior orbital plexus and administered with 5% chlorpromazine eye drops (Alcon, USA).

[0097] Induction of anti-PspA IgG was assessed by ELISA using plates coated with 1 μg / ml PspA4Pro or PspA2Pro and serially diluted serum from blood samples. Horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma-Aldrich, USA) was used as the secondary antibody. For IgG subtype detection, goat-derived anti-mouse IgG1, anti-mouse IgG2a (Southern Biotec, USA), and HRP-derived anti-goat IgG (Southern) were used. Colorimetric reactions were performed using o-phenylenediamine dihydrochloride as the substrate, and absorbance was measured at 492 nm using a multiskan EX spectrophotometer (Thermo Fisher Scientific, USA).

[0098] Antibody titer was defined as the reciprocal of the dilution that produced 0.1 absorbance. The binding of serum to the surface of different pneumococcal strains was also tested, as described in Salcedo-Rivillas C et al. (2014).

[0099] In short, bacterial suspension (10 8 Samples were incubated on ice for 30 minutes with pooled heat-inactivated serum (CFU / mL) and 5% (v / v) from each experimental group. Samples were washed once with PBS and incubated on ice for 30 minutes with FITC-conjugated goat anti-mouse IgG (MP Biomedicals, USA).

[0100] To analyze the induction of complement deposition, the sample was incubated with serum from naïve mice as a complement source at 37°C for 30 minutes, and then incubated with FITC-conjugated anti-mouse C3 (MP Biomedicals) on ice for 30 minutes.

[0101] Samples were suspended in cytofix (BD Biosciences, USA) and analyzed by flow cytometry on a FACS Canto II instrument (BDBiosciences), recording 15,000 gated events. Median fluorescence intensities were compared using FlowJo 10.1 software.

[0102] - Invasive pneumococcal challenge : Twenty-one days after the last immunization, animals were anesthetized via intraperitoneal (ip) with 100 mg / kg ketamine (Ceva, Brazil) and 20 mg / kg xylazine chloride (Ceva). Streptococcus pneumoniae strain A66.1 was inoculated intranasally (1 × 10⁻⁶ per mouse). 6 CFU), 3JYP2670 (3 × 10⁻⁶ per mouse) 5 CFU) or ATCC6303 (3 × 10⁻⁶ per mouse) 5 CFU), with a volume of 50 μL of saline.

[0103] Animals were monitored twice daily for 10 days. Animals exhibiting signs of illness such as piloerection, abnormal posture, and reduced activity were immediately euthanized with a lethal dose of anesthetic (60 mg / kg xylazine hydrochloride and 300 mg / kg ketamine, intraperitoneally). Mice surviving at the end of the experiment were healthy and active; no animals died before meeting the euthanasia criteria.

[0104] - Statistical analysis : Antibody titers among all groups were compared using one-way ANOVA, and Tukey's post-hoc test was used to compare the results between two groups. Animal survival rates were analyzed using the Mantel-Cox test to compare between groups based on log-rank survival curves. Prism GraphPad 6.0 software was used for analysis, and a p-value ≤ 0.05 was considered statistically significant.

[0105] Experimental results - Expression of PspA2-F5 and PspA4-F5 in the CyaA system: In one embodiment of the invention, PspA fragments from family 1 (PspA2) and family 2 (PspA4) are expressed in the CyaA protein to induce antibodies that react with different pneumococcal isolates.

[0106] PspA2-F5 (SEQ ID NO:1) contains the N-terminal region of PspA2 (RX1 strain), including the clade-defining region and a portion of the proline-rich domain (Figure 1A).

[0107] The PspA4-F5 fragment (SEQ ID NO:2) was defined by amino acid sequence alignment of PspA2-F5 and the PspA4Pro antigen (Figure 1A). Expression of these two fragments in the allowable domain (residues 224-225) of the CyaA protein yielded CyaA-PspA2-F5 (SEQ ID NO:5) and CyaA-PspA4-F5 (SEQ ID NO:6), with predicted masses of 189 kDa and 195 kDa, respectively (Figure 1B). The PspA2-F5 and PspA4-F5 proteins, at 11.3 kDa and 17.4 kDa, respectively (Figure 1B), were used as the control group in immunoassays. All purified proteins were recognized by polyclonal anti-PspA2 or anti-PspA4 antiserum (Figure 1C). PspA2Pro and PspA4Pro contain the entire N-terminal region of their respective PspA, including a portion of the proline-rich region, and are used as reference and positive controls in SDS-PAGE and Western blot (Figures 1B and 1C).

[0108] - Immunization of mice with CyaA-PspA-F5 proteins induces high levels of anti-PspA antibodies: Mice were immunized with each CyaA-PspA-F5 protein, alone or in combination. To assess the CyaA adjuvant effect, two groups of mice were immunized with each PspA-F5 protein, alone or in combination. Mice inoculated with saline or CyaA-OVA21 served as controls.

[0109] No significant increase in anti-PspA2 IgG levels was observed in any group after one dose. Anti-PspA2 IgG levels began to increase after a second dose of immunization with CyaA-PspA2-F5 (SEQ ID NO:5), or in mice immunized with a combination of this protein and CyaA-PspA4-F5 (SEQ ID NO:6) (Figure 2A).

[0110] Three doses of both formulations induced high levels of anti-PspA2 IgG in mice, while the PspA2-F5 and PspA2-F5+PspA4-F5 vaccines showed no significant effect (Figure 2C). On the other hand, a single dose of CyaA-PspA4-F5 or a combination of it with CyaA-PspA2-F5 was sufficient to induce anti-PspA4 IgG (Figure 2B), which increased further after the second dose (Figure 2D).

[0111] Given the high levels of anti-PspA4 IgG, these mice were not given a third dose (as described below) before being challenged with the PspA4-expressing 3JYP2670 pneumococcal strain.

[0112] Anti-PspA IgG subtypes were assessed in mouse serum after three doses of each protein immunized using ELISA (Figure 3). In all cases, IgG1 levels were higher than IgG2a levels, although both subtypes were present. The observed low IgG1 / IgG2a ratio indicates a balanced Th1 / Th2 immune response.

[0113] - The antibodies induced by immunization with CyaA-PspA2-F5 and CyaA-PspA4-F5 proteins recognize PspA expressed by different pneumococcal strains: - The combination of CyaA-PspA2-F5 and CyaA-PspA4-F5 provides protection of mice against challenge with strains expressing homologous and heterologous PspA: To evaluate the ability of antibodies induced by immunization with CyaA-PspA2-F5 (SEQ ID NO:5) and CyaA-PspA4-F5 (SEQ ID NO:6) to recognize naturally expressed PspA in pneumococcus, in vitro binding assays were performed. For these experiments, pooled serum from each group of mice immunized with a three-dose regimen was used.

[0114] The samples were further incubated with FITC-conjugated anti-mouse IgG and analyzed by flow cytometry. The median fluorescence intensity of the bacterial populations was compared. Serum from mice immunized with CyaA-PspA2-F5 (SEQ ID NO:5) specifically bound to strains expressing PspA2 (Fig. 4A), while serum from mice immunized with CyaA-PspA4-F5 (SEQ ID NO:6) reacted with strains expressing PspA3, PspA4, and PspA5 (Fig. 4B, C, and D).

[0115] Furthermore, CyaA-PspA4-F5 (SEQ ID NO:6) serum also showed some reactivity with strains expressing PspA2 (Figure 4A). Notably, serum from mice immunized with the combined CyaA-PspA2-F5 (SEQ ID NO:5) + CyaA-PspA4-F5 (SEQ ID NO:6) formulation was able to bind to the surface of strains expressing PspA2 (A66.1), PspA3 (M10), PspA4 (3JYP2670), and PspA5 (ATCC6303) (Figure 4).

[0116] The median fluorescence intensity of anti-C3-FITC antiserum was also compared by flow cytometry to assess the serum's ability to induce complement deposition on bacterial surfaces.

[0117] Serum from mice immunized with the combined CyaA-PspA2-F5 (SEQ ID NO:5) + CyaA-PspA4-F5 (SEQ ID NO:6) formulation induced complement deposition on the surfaces of strains expressing PspA2 (Fig. 5A), PspA4 (Fig. 5C), and PspA5 (Fig. 5D). Complement deposition was also observed in strains expressing PspA3 (Fig. 5B).

[0118] For single-protein formulations, complement deposition was observed in strains expressing PspA2 incubated with anti-CyaA-PspA2-F5 serum (Fig. 5A) and strains expressing PspA4 or PspA5 incubated with anti-CyaA-PspA4-F5 serum (Fig. 5C and D, respectively).

[0119] - The CyaA-PspA2-F5-PspA4-F5 fusion protein induces antibodies with a broad reactivity and protects mice against pneumococcal challenge: - Methods - Ethical statement: The protective effect of CyaA-PspA protein on immunity was analyzed using an invasive respiratory challenge model of serotype 3 pneumococcal strains expressing different PspA.

[0120] Because high levels of anti-PspA4 antibodies were observed after two doses of CyaA-PspA4-F5 (SEQ ID NO:6) protein (Figure 2D), mice were challenged with strain 3JYP2670 (expressing PspA4) 21 days after the two immunization doses.

[0121] To analyze protection against strain A66.1 (expressing PspA2) or strain ATCC6303 (expressing PspA5), challenge was performed after three doses. Significant protection was observed in all cases, with survival rates ranging from 66% to 100% depending on the test conditions (Figure 6).

[0122] Immunization with CyaA-PspA2-F5 (SEQ ID NO:5) defended mice against challenge from strain A66.1 expressing PspA2 (Fig. 6A), while immunization with CyaA-PspA4-F5 (SEQ ID NO:6) defended mice against challenge from strain 3JYP2670 expressing PspA4 or strain ATCC6303 expressing PspA5 (Figs. 6B and C).

[0123] The formulation of the combined protein CyaA-PspA2-F5 (SEQ ID NO:5) + CyaA-PspA4-F5 (SEQ ID NO:6) enabled mice to defend against attacks from three strains (Figure 6).

[0124] Conversely, no significant protection was observed in mice immunized with PspA2-F5 (SEQ ID NO:1) or PspA4-F5 (SEQ ID NO:2) and CyaA-OVA21 as a negative control for all attacks (Figure 6).

[0125] - Bacteria: - Mouse immunization and immune response analysis To analyze whether a single protein composed of the F5 fragments from PspA2 and PspA4 would produce an effect similar to that of a combination of the two proteins, the CyaA-PspA2-F5-PspA4-F5 protein (SEQ ID NO:7) was prepared and purified (Figure 7A).

[0126] Mice were immunized with three doses of CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7) or a mixture of CyaA-PspA2-F5 and CyaA-PspA4-F5 as a control. Compared with mice immunized with the combined CyaA-PspA2-F5 (SEQ ID NO:5) + CyaA-PspA4-F5 (SEQ ID NO:6), the CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7) fusion protein induced higher levels of anti-PspA2 IgG (Figure 7B).

[0127] The induction of anti-PspA4 IgG was similar in both groups of mice. Furthermore, the CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7) protein provided high protection against challenge with the A66.1 strain expressing PspA2.

[0128] Importantly, the antibody induced by immunization with CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7) showed broad-spectrum reactivity (Figure 9) and induced complement deposition on the surface of pneumococcal strains expressing different PspA at levels comparable to those induced by the combination of CyaA-PspA2-F5 (SEQ ID NO:5) + CyaA-PspA4-F5 (SEQ ID NO:6) (Figure 10).

[0129] Furthermore, it is important to emphasize that an immune response was induced without the use of adjuvants, confirming the immunomodulatory properties of CyaA.

[0130] Therefore, based on the results obtained, the combination of CyaA-PspA2-F5 (SEQ ID NO:5) and CyaA-PspA4-F5 (SEQ ID NO:6) was observed to confer high survival rates in mice challenged by strains expressing PspA2, PspA4, and PspA5, indicating that this formulation has good potential in covering PspA variants. The fusion CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7) showed similar properties in terms of antibody levels, responsiveness to different strains, and ability to induce complement deposition (Figures 9 and 10).

[0131] The advantage of fusion proteins is the purification of single recombinant proteins, which simplifies the process and the product. In one embodiment of the present invention, efficacy analysis of CyaA-PspA2-F5 (SEQ ID NO:5) and CyaAPspA4-F5 (SEQ ID NO:6) proteins against a systemic pneumococcal infection challenge model has been demonstrated.

[0132] In addition, in vitro results showed the reactivity of the antibody to strains expressing other serotypes (M10 strain, st11A, PspA3; D39 strain, st2, PspA2 and TIGR4 strain, st4, PspA3) (Figures 4 and 8).

[0133] Antibodies induced by immunization with CyaA-PspA2-F5 (SEQ ID NO:5) and CyaA-PspA4-F5 (SEQ ID NO:6) proteins also induced complement deposition on the surface of different strains of pneumococcus, and this ability was associated with protection against invasive attacks.

[0134] In summary, this invention proposes recombinant proteins comprising PspA and CyaA fragments that induce high levels of anti-PspA antibodies. In one embodiment of the invention, a mixture of CyaA-PspA2-F5 (SEQ ID NO:5) and CyaA-PspA4-F5 (SEQ ID NO:6) proteins, or a fusion of CyaA-PspA2-F5-PspA4-F5 (SEQ ID NO:7), is shown to protect mice from systemic infection by pneumococci expressing homologous or heterologous PspA. Furthermore, in vitro results demonstrate that these proteins have the good potential to provide broad protection against various isolates.

[0135] Experimental results for PspA1 and PspA3: In this invention, the adenylate cyclase toxin system (CyaA) of Bordetella pertussis was tested for expression and presentation of a fragment of pneumococcal surface protein A (PspA), with the aim of proposing a universal vaccine against Streptococcus pneumoniae (pneumococcus).

[0136] As previously mentioned, data have shown that CyaA expressing fragments of PspA from families 1 and 2 (specifically fragment 5 of PspA2 (PspA2-F5, also known as A2) and fragment 5 of PspA4 (PspA4-F5, also known as A4)) induces high levels of antibodies in mice. Serum from mice immunized with the CyaA-A2 + CyaA-A4 combination or the fusion protein CyaA-A2-A4 was able to bind to the surface of pneumococcal isolates expressing different serotypes of pspA2, PspA3, PspA4, or PspA5. The candidate vaccine also protects mice against invasive challenge (sepsis model) with pneumococcal isolates expressing PspA2, PspA4, and PspA5.

[0137] We now analyzed the ability of the CyaA-A2-A4 protein to protect mice from lung colonization (pneumonia model) and to induce an immune response in the lungs. This experiment was performed and compared with the commercially available pneumococcal conjugate vaccine PCV13 (Prevnar, Pfizer). The importance of this analysis lies in the fact that pneumococcus is a respiratory pathogen, and pneumonia is a major disease caused by this bacterium, which can lead to death or progress to sepsis or meningitis. Furthermore, protection against the ST3 pneumococcal isolate was tested. Literature data suggests that ST3 may evade immunity induced by conjugate vaccines used in immunized populations in recent years.

[0138] Furthermore, decreased responsiveness of mouse serum immunized with formulations containing PspA2-F5 and PspA4-F5 (CyaA-A2 + CyaA-A4 or CyaA-A2-A4) to PspA1-expressing pneumococcal isolates was observed. Therefore, a novel construct containing the PspA1-F5 fragment (A1) was tested to assess the potential for increased responsiveness and protection against PspA1-expressing pneumococcal isolates.

[0139] Based on this principle, although the reactivity of serum induced by CyaA-A2 + CyaA-A4 or CyaA-A2-A4 to PspA3-expressing pneumococcal isolates was observed, proteins containing the PspA3-F5 fragment (A3) were also tested.

[0140] - Pneumococcal challenge: This study was conducted in accordance with guidelines outlined by the Brazilian National Animal Experimentation Control Committee (CONCEA), which adheres to international animal welfare guidelines and the 3R principle. The experimental protocol complied with the ARRIVE guidelines and was approved by the Animal Use Ethics Committee of the Butantan Institute in São Paulo, Brazil (Agreement Nos. 8112091117 and 5370090919). Mice were housed in a BSL2 animal facility in microisolated enclosures with independent ventilation and temperature and light cycle control. Animals had free access to food and water, and were handled by trained personnel.

[0141] - Statistical analysis: Streptococcus pneumoniae strains ATCC6303 (st3, PspA5); 122 / 00 (st23F, PspA5); 3JYP2670 (st3, PspA4); 255 / 00 (st14, PspA4); A66.1 (st3, PspA2); ATCC6301 (st1, PspA1); EF3030 (st19F, PspA1); 0603 (st6B, PspA1); D39 (st2, PspA2); M10 (st11A, PspA3); TIGR4 (st4, PspA3) were grown at 37°C on trypsin-soy agar (blood agar, Laborclin, Brazil) containing 5% defibrinated sheep blood. Stock solutions for animal challenge were prepared in liquid Todd-Hewitt medium (Difco) (THY) supplemented with 0.5% yeast extract. The bacteria were grown to the exponential phase (OD600nm = 0.4), centrifuged, and resuspended in 1 / 10 of the initial volume of THY containing 20% ​​glycerol. The stock solution was maintained at -80°C and quantified by inoculation onto blood agar plates.

[0142] - Results: : Female SPF BALB / c mice were produced at the animal facility of the University of São Paulo Medical School (Brazil). Protein doses were adjusted to 50 pmol per mouse based on the molecular weight differences between CyaA-PspA proteins (approximately 200 kDa, 10 μg per dose). For analysis of mixtures of CyaA-A2 + CyaA-A4 (10 μg of each protein), the control group received purified CyaA-OVA21 (10 μg per dose) or saline in all experiments. Residual LPS in all protein formulations was quantified using a quantitative colorimetric LAL assay (QCL-1000, Lonza, USA) according to the manufacturer's instructions. LPS levels in the administered doses to mice were below 1 EU / mL. Mice (n=6 per group) received two or three subcutaneous injections at 15-day intervals. Blood was collected 14 days after each immunization, and the induction of anti-PspA IgG was assessed by ELISA using plates coated with 1 μg / mL PspA1, PspA2Pro, PspA3, PspA4Pro, or PspA5 and serially diluted samples (serum starting at 1:20, or bronchoalveolar lavage fluid (BALF) starting at 1:4). Horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma-Aldrich, USA) was used as the secondary antibody for serum samples, and alkaline phosphatase-conjugated anti-mouse IgG was used as the secondary antibody for BALF samples (Sigma). Colorimetric reactions were performed using o-phenylenediamine dihydrochloride (serum) or 4-nitrophenyl phosphate (Balf) as substrates, and absorbance was measured at 492 nm or 405 nm, respectively, using a multiskan EX spectrophotometer (ThermoFisher Scientific, USA). Antibody titer was defined as the reciprocal of the dilution that produced 0.1 absorbance. As previously mentioned, the binding of serum to the surface of different pneumococcal strains was also tested. In short, bacterial suspensions (10... 8 Samples were incubated on ice for 30 min with 5% (v / v) pooled heat-inactivated serum from each experimental group (CFU / mL). Samples were washed once with PBS and incubated on ice for 30 min with FITC-conjugated goat anti-mouse IgG (MPBiomedicals, USA). Samples were resuspended in cytofix (BD Biosciences, USA) and analyzed by flow cytometry on a FACS Canto II instrument (BD Biosciences, USA), recording 15,000 gated events. Median fluorescence intensities were compared using FlowJo 10.1 software.

[0143] Figure 11C Twenty-one days after the last immunization, animals were anesthetized via intraperitoneal (ip) with 100 mg / kg ketamine (Ceva, Brazil) and 20 mg / kg xylazine hydrochloride (Ceva). Streptococcus pneumoniae 3JYP2670 was inoculated intranasally (3 × 10⁶ per mouse). 5 CFU or EF3030 (1×10⁻⁶ per mouse) 6 CFU were added to 50 μL of saline. Animals were monitored twice daily for 10 days. Animals exhibiting signs of disease such as piloerection, arched back posture, and reduced activity were immediately euthanized with a lethal dose of anesthetic (60 mg / kg xylazine hydrochloride and 300 mg / kg ketamine, ip). Mice surviving at the end of the experiment were healthy and active; no animals died before meeting the euthanasia criteria. For the pneumonia model, bronchoalveolar lavage fluid (BALF) or lung tissue was collected after euthanasia as previously described. Samples were plated on blood agar for CFU counting. BALF supernatant was aliquoted and used for antibody detection by ELISA.

[0144] Figure 11H Antibody titers among all groups were compared using one-way ANOVA, and Tukey's post-hoc test was used to compare the results between two groups. Animal survival rates were assessed using the Mantel-Cox test based on log-rank survival curves for inter-group comparisons. Analysis was performed using Prism GraphPad 6.0 software, and a p-value ≤ 0.05 was considered statistically significant.

[0145] Figure 12 To evaluate the protective activity of CyaA-PspA protein against colonization of *Streptococcus pneumoniae* in the lungs (pneumonia model), animals were immunized with three doses of CyaA-A2-A4 or the control CyaA-OVA21. In this experiment, the pneumococcal conjugate vaccine PCV13 and its corresponding control aluminum adjuvant (Alum) were also tested. High levels of anti-PspA4 and anti-PspA2 IgG induction were observed in mice immunized with CyaA-A2-A4 (Figures 11A and 11B). On the other hand, immunization with PCV13 induced high levels of anti-PS3 IgG (purified polysaccharide from serotype 3 (ST3) *Streptococcus pneumoniae* isolates). Figure 12Notably, antibodies against PS3 were chosen for analysis because the experiment aimed to assess protection against the ST3 pneumococcal isolate. Mice were then infected intranasally with the 3JYP2670 pneumococcal strain (ST3, PspA4), and BALF and lungs were collected 12 hours post-challenge to assess lung colonization (Figs. 11D and 11E). Immunization with CyaA-A2-A4 resulted in a significant reduction in pneumococcal colonization in the mouse respiratory tract at 12 hours post-challenge, reflected in the low number of bacteria recovered from BALF (Fig. 11D) and lungs (Fig. 11E). Interestingly, no reduction was observed in mice immunized with the PCV13 vaccine (Figs. 11D and 11E). The levels of specific antibodies in BALF were also assessed post-challenge. High levels of anti-PspA4 IgG were observed in the respiratory tract of mice immunized with CyaA-A2-A4 after challenge (Fig. 11F). Because immunization is administered subcutaneously, antibodies in the bloodstream may have entered the airways before the attack, or the attack may have induced antibody influx. On the other hand, no anti-PS3 antibodies were observed in the airways of mice immunized with PCV13 (Figure 11G). Therefore, a significant difference between the two vaccines can be observed. At least at the time point tested, the CyaA-A2-A4 vaccine was more effective in reducing lung colonization compared to PCV13, and antibodies may play an important role in this effect. However, when the experiment was repeated to track 10-day survival, both the CyaA-A2-A4 and PCV13 vaccines protected 100% of the mice (…). - Conclusion: In summary, our results indicate that the CyaA-A2-A4 vaccine is more effective against ST3 pneumococcal lung infection than PCV13, but both vaccines are highly effective against systemic infection (sepsis model).

[0146] Although the present invention proposes a combination of PspA2 and PspA4 in the vaccine to provide cross-reactivity against pneumococcal isolates expressing PspA from families 1 (PspA1 and PspA2) and families 2 (PspA3, PspA4, and PspA5) (containing more than 99% of pathogenic pneumococcal isolates), surprisingly, reactivity to isolates expressing PspA1 is low.

[0147] like ​ As observed, mouse serum immunized with CyaA-A2 alone or in combination with CyaA-A4 showed no reactivity or very low reactivity to the three PspA1-expressing strains. ​Therefore, a CyaA protein containing PspA1-F5 (A1) (seq. ID NO:3) was constructed for testing. Furthermore, the inventors also decided to evaluate a protein containing the PspA3-F5 fragment (A3) (seq. ID NO:4), although the CyaA-A2-A4 protein has shown some reactivity with pneumococci expressing PspA3.

[0148] Figure 13 shows a schematic diagram of constructed proteins containing fragments A1, A3, or both A1 and A3. CyaA-A1 (SEQ.ID NO:8) or CyaA-A1-A3 (SEQ.ID NO:9) with fragments inserted at positions 224-225 of the CyaA protein were constructed to allow for combination testing with CyaA-A2-A4 (SEQ.ID NO:7). Furthermore, inserting A1 or A1-A3 fragments at positions 319-320 yielded CyaA-A2-A4 / A1 proteins (SEQ.ID NO:10) and CyaA-A2-A4 / A1-A3 (SEQ.ID NO:11). Finally, a fusion protein containing the A2-A4-A1-A3 fragment at positions 224-225 was constructed.

[0149] In screening experiments, the protein alone or in combination with CyaA-A2-A4 was initially tested to evaluate antibody induction against PspA1 and PspA3, as well as protection against pulmonary infection in Pneumococcal isolates expressing PspA1. From this screening, the formulations CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, and CyaA-A2-A4 / A1-A3 produced the best results and were selected for further evaluation.

[0150] Mice were immunized with three doses of CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3, and antibody induction against PspA1, PspA2, PspA3, PspA4, and PspA5 was assessed by ELISA (Figure 14). All three formulations induced high levels of anti-PspA1 (Figure 14A), anti-PspA2 (Figure 14B), and anti-PspA4 (Figure 14D). Although CyaA-A2-A4 + CyaA-A1 and CyaA-A2-A4 / A1 induced significant levels of PspA3-responsive IgG, the highest levels were observed in the serum of mice immunized with CyaA-A2-A4 / A1-A3 (Figure 14C). For PspA5, all formulations induced similar levels of IgG responding to the protein, with a slightly higher level induced by CyaA-A2-A4 / A1-A3 (Figure 14E).

[0151] The inventors then used FITC-conjugated secondary antibodies to assess the ability of serum to recognize different PspA conformations of bacterial surfaces by flow cytometry. The mean fluorescence intensity (MFI) of the curves was compared (Figure 15).

[0152] Compared to mouse serum immunized with CyaA-A2-A4, the presence of the A1 fragment in the formulation improved the reactivity of serum with PspA1-expressing pneumococcal isolates (Fig. 15A and B). For both EF3030 and ATCC6301 pneumococcal isolates, the MFI curves of mouse serum immunized with CyaA-A2-A4 were low, very similar to those observed for the negative control (CyaA-OVA21). On the other hand, high MFI levels were observed in mouse serum immunized with CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3 (Fig. 15A and B), with little difference between the curves.

[0153] The same serum was used to test the PspA3-expressing pneumococcal isolates M10 and TIGR4. IgG in the serum of mice immunized with CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3 was able to bind to the surface of both bacteria, producing a higher MFI than the negative control CyaA-OVA21. However, the serum of mice immunized with CyaA-A2-A4 / A1-A3 protein was superior to the other sera, indicating that this serum has a better ability to recognize native PspA3 (Figures 15C and D).

[0154] To assess whether the serum of the selected formulations maintained a high capacity to bind to pneumococcal isolates expressing PspA2, PspA4, or PspA5, flow cytometry experiments were performed using two strains carrying each of these PspA clades (Fig. 16). Overall, mouse sera immunized with the three formulations CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3 showed a high capacity to bind to all tested pneumococcal isolates, whether expressing PspA2 (Fig. 16A and B), PspA4 (Fig. 16C and D), or PspA5 (Fig. 16E and F). No significant differences were observed between the sera.

[0155] Because proteins containing the A1 fragment improve responsiveness to PspA1-expressing pneumococcal isolates, respiratory challenges were performed on mice immunized with CyaA-A2-A4 + CyaA-A1, CyaA-A2-A4 / A1, or CyaA-A2-A4 / A1-A3. The control group was immunized with CyaA-OVA21 protein. EF3030 pneumococcal isolate (ST 19F, PspA1) was inoculated into immunized mice intranasally, and lungs were collected 24 hours later to assess lung colonization. All three formulations significantly reduced the number of pneumococci in the mouse lungs compared to the control group (Fig. 17A). The inventors also evaluated the levels of anti-PspA1 antibodies in the mouse respiratory tract before challenge (0h, Fig. 17B) and 24 hours after challenge (Fig. 17C). Surprisingly, low levels of anti-PspA1 IgG were observed in the BALF of mice before challenge, indicating that subcutaneous immunization with CyaA-PspA protein can induce certain levels of antibodies in the respiratory mucosa (Figure 17B). These levels further increased after challenge (Figure 17C).

[0156] ​ Along with previous data, the CyaA-PspA protein containing the A2 and A4 fragments induced antibodies recognizing PspA2, PspA3, PspA4, and PspA5. These proteins also conferred protection in mice against invasive challenge with pneumococcal strains expressing PspA2, PspA4, and PspA5 (previous results). Here, we show that the CyaA2-A4 protein also protects mice against lung colonization by pneumococcal isolates expressing PspA4 (pneumonia model). However, CyaA-A2-A4 does not induce antibodies recognizing PspA1. The inclusion of the A1 fragment in the formulation improved reactivity with pneumococcal strains expressing PspA1 and conferred protection against lung colonization by pneumococcal strains expressing PspA1. The inclusion of the A3 fragment also improved reactivity with isolates expressing PspA3. Subcutaneous immunization with CyaA-PspA induced levels of antibodies in the respiratory mucosa, which increased further after challenge. Anti-PspA antibodies induced in the lungs by vaccination with CyaA-PspA protein may be important for protection against lung colonization.

[0157] Therefore, several CyaA-PspA proteins were constructed that allow for different antigen combinations and provide broad protection against pneumococcal infection. The formulations described herein are proposed as universal vaccines against invasive pneumococcal disease and pneumonia caused by different pneumococcal serotypes.

[0158] In summary, the present invention relates to the following aspects, as defined by the following numbered items: 1. A recombinant protein comprising one or more fragments of pneumococcal surface protein A (PspA) and a modified adenylate cyclase (CyaA) from species of the genus Bordetella (especially Bordetella pertussis).

[0159] 2. The recombinant protein according to aspect 1, wherein the Bordetella species is Bordetella pertussis.

[0160] 3. The recombinant protein according to aspect 1 or 2, wherein the enzymatic activity of said CyaA is inactivated.

[0161] 4. The recombinant protein according to any one of aspects 1 to 3, wherein the PspA protein fragment is selected from families 1 and 2, preferably fragments from clades 1 to 4, or a combination of two or more thereof.

[0162] 5. The recombinant protein according to any one of aspects 1 to 4, wherein said fragment is selected from the group consisting of: - Fragments at the end of the N-terminal region of PspA encoding clades 2 (PspA2-F5) and 4 (PspA4-F5), wherein PspA2-F5 consists of the amino acid sequence shown in SEQ ID NO:1 and PspA4-F5 consists of the amino acid sequence shown in SEQ ID NO:2; - Fragments at the end of the N-terminal region of PspA encoding clades 1 (PspA1-F5) and 3 (PspA3-F5), wherein PspA1-F5 consists of the amino acid sequence shown in SEQ ID NO:3 and PspA3-F5 consists of the amino acid sequence shown in SEQ ID NO:4; - Segments at the ends of the N-terminal regions of PspA in clades 2 (PspA2-F5), 4 (PspA4-F5), and 1 (PspA1-F5); and - Segments at the end of the N-terminal region of PspA encoding clades 2 (PspA2-F5), 4 (PspA4-F5), 1 (PspA1-F5), and 3 (PspA3-F5).

[0163] 6. The recombinant protein according to any one of aspects 1 to 5, wherein the PspA fragment is encoded by the following nucleotide sequence: - The DNA sequence shown in SEQ ID NO:29 and its degenerate sequence, which encodes PspA2-F5 shown in SEQ ID NO:1; - The DNA sequence shown in SEQ ID NO:30 and its degenerate sequence, which encodes PspA4-F5 shown in SEQ ID NO:2; - The DNA sequence shown in SEQ ID NO:31 and its degenerate sequence, encoding PspA1-F5 shown in SEQ ID NO:3; and / or - The DNA sequence shown in SEQ ID NO:32 and its degenerate sequence, which encodes PspA3-F5 shown in SEQ ID NO:4.

[0164] 7. The recombinant protein according to any one of aspects 1 to 6 comprises or is composed of the following amino acid sequence: - CyaA-PspA2-F5, which consists of the amino acid sequence shown in SEQ ID NO:5; and / or - CyaA-PspA4-F5, which consists of the amino acid sequence shown in SEQ ID NO:6; and / or - CyaA-PspA2-F5-PspA4-F5, which consists of the amino acid sequence shown in SEQ ID NO:7; and / or - CyaA-PspA1-F5, which consists of the amino acid sequence shown in SEQ ID NO:8; and / or - CyaA-PspA1-F5-PspA3-F5, which consists of the amino acid sequence shown in SEQ ID NO:9; and / or - CyaA-PspA2-F5-PspA4-F5-PspA1-F5, which consists of the amino acid sequence shown in SEQ ID NO:10; and / or - CyaA-PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5, which consists of the amino acid sequence shown in SEQ ID NO:11.

[0165] 8. The recombinant protein according to any one of aspects 1 to 7 is encoded by the following nucleotide sequence: - The DNA sequence shown in SEQ ID NO:12 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA2-F5 shown in SEQ ID NO:5; - The DNA sequence shown in SEQ ID NO:13 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA4-F5 shown in SEQ ID NO:6; - The DNA sequence shown in SEQ ID NO:14 and its degenerate sequence encode the recombinant protein CyaA-PspA2-F5-PspA4-F5 shown in SEQ ID NO:7; - The DNA sequence shown in SEQ ID NO:15 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA1-F5 shown in SEQ ID NO:8; - The DNA sequence shown in SEQ ID NO:16 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA1-F5-PspA3-F5 shown in SEQ ID NO:9; - The DNA sequence shown in SEQ ID NO:17 and its degenerate sequence, encoding the recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5 shown in SEQ ID NO:10; and / or - The DNA sequence shown in SEQ ID NO:18 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5 shown in SEQ ID NO:11.

[0166] 9. An expression cassette comprising a DNA sequence selected from the nucleotide sequences shown in SEQ ID NO:12 to 18 and a degenerate sequence thereof, which respectively encode the recombinant proteins shown in SEQ ID NO:5 to 11.

[0167] 10. An immunogenic composition comprising a recombinant protein as defined in any one of aspects 1 to 8 or an expression cassette as defined in aspect 9, and additional pharmaceutically acceptable carriers and / or adjuvants.

[0168] 11. The immunogenic composition according to aspect 10, which is in the form of a vaccine.

[0169] 12. The immunogenic composition according to aspect 10 or 11, which is administered via parenteral administration or via mucosal route.

[0170] 13. An immunogenic composition according to any one of aspects 10 to 12, wherein the composition is used for the prevention of Streptococcus pneumoniae infection.

[0171] 14. Use of a recombinant protein as defined in any one of aspects 1 to 8, an expression cassette as defined in aspect 9, or an immunogenic composition as defined in any one of aspects 8 to 11, wherein the recombinant protein is used to manufacture a vaccine for the prevention of pneumococcal infection.

[0172] 15. According to the use of aspect 14, said drug is a vaccine for the prevention of pneumococcal infection, which provides broad-spectrum protection against different pneumococcal isolates, regardless of serotype.

[0173] Therefore, the embodiments presented in this disclosure do not cover all possibilities, and those skilled in the art will understand that various omissions, substitutions and changes can be made without departing from the scope of the invention.

[0174] It should be understood that all combinations of elements that perform the same function or achieve similar results in substantially the same manner are within the scope of this invention. Replacing elements from one described embodiment with another is also entirely intentional and contemplated.

[0175] Those skilled in the art will appreciate the knowledge provided herein and will be able to reproduce the invention in other variations within the scope of the provided embodiments and claims.

[0176] References Vadesilho CF, Ferreira DM, Gordon SB, Briles DE, Moreno AT, et al (2014) Mapping of epitopes recognized by antibodies induced by immunizationof mice with PspA and PspC. Clin Vaccine Immunol 21: 940-948. Darrieux M, Moreno AT, Ferreira DM, Pimenta FC, de Andrade AL, et al (2008) Recognition of pneumococcal isolates by antisera raised against PspAfragments from different clades. J Med Microbiol 57: 273-278. Glaser P, Elmaoglou-Lazaridou A, Krin E, Ladant D, Bârzu O, Danchin A. (1989) Identification of residues essential for catalysis and binding ofcalmodulin in Bordetella pertussis adenylate cyclase by site-directedmutagenesis. The EMBO Journal 8:967-972 Glaser P, Munier H, Gilles AM, Krin E, Porumb T, Bârzu O, Sarfati R, Pellecuer C, Danchin A. (1991) Functional consequences of single amino acid substitutions in calmodulin-activated adenylate cyclase of Bordetella pertussis. The EMBO Journal 10:1683-1688 Guermonprez P, Fayolle C, Karimova G, Ullmann A, Leclerc C, et al. (2000) Bordetella pertussis adenylate cyclase toxin: a vehicle to deliver CD8-positive T cell epitopes into antigen-presenting cells. Methods Enzymol 326: 527-542. Karimova G, Fayolle C, Gmira S, Ullmann A, Leclerc C, et al. (1998) Charge dependent translocation of Bordetella pertussis adenylate cyclase toxin into eukaryotic cells: implication for the in vivo delivery of CD8(+) T cell epitopes into antigen-presenting cells. Proc Natl Acad Sci U S A 95:12532-12537. Ladant, D, Glaser, P, Ullman, A (1992) Insertional mutagenesis of Bordetella pertussis adenylate cyclase. J. Biol. Chem. 267(4): 2244-2250. Ramos CR, Abreu PA, Nascimento AL, Ho PL (2004) A high-copy T7 Escherichia coli expression vector for the production of recombinant proteins with a minimal N-terminal His-tagged fusion peptide. Braz J Med Biol Res 37: 1103 1109. Preville X., Ladant D., Timmerman B., and C. Leclerc. (2005) Eradication of established tumors by vaccination with recombinant Bordetella pertussis adenylate cyclase carrying the human papillomavirus 16 E7 oncoprotein. Cancer Research 65 :641-649 Teodorowicz M, Perdijk O, Verhoek I, Govers C, Savelkoul HF, et al. (2017) Optimized Triton X-114 assisted lipopolysaccharide (LPS) removal method reveals the immunomodulatory effect of food proteins. PLoS One 12:e0173778. Salcedo-Rivillas C, Debrie AS, Miyaji EN, Ferreira JM, Jr., Raw I, et al. (2014) Pertussis toxin improves immune responses to a combined pneumococcal antigen and leads to enhanced protection against Streptococcus pneumoniae. Clin Vaccine Immunol 21: 972-981. Agudelo, C. I. et al. The direct effect of pneumococcal conjugate vaccines on invasive pneumococcal disease in children in the Latin American and Caribbean region (SIREVA 2006-17): a multicentre, retrospective observational study. Lancet Infect Dis, v. 21, n. 3, p. 405-417, Mar. 2021. Sings, H. L. et al. Pneumococcal Conjugate Vaccine Impact on Serotype 3: A Review of Surveillance Data. Infect Dis Ther, v. 10, n. 1, p. 521-539, Mar. 2021. Oliveira ML, Miyaji EN, Ferreira DM, Moreno AT, Ferreira PC, Lima FA, et al. Combination of pneumococcal surface protein A (PspA) with whole cell pertussis vaccine increases protection against pneumococcal challenge in mice. PloS one. 2010;5: e10863.

Claims

1. A recombinant protein, characterized in that, It contains species from the genus Bordetella ( Bordetella species It contains adenylate cyclase (CyaA) and one or more fragments of pneumococcal surface protein A (PspA).

2. The recombinant protein according to claim 1, characterized in that, The species of *Bordezoae* mentioned is *Bordezoae pertussis* (…). Bordetella pertussis ).

3. The recombinant protein according to claim 1 or 2, characterized in that, The enzyme activity of CyaA was inactivated.

4. The recombinant protein according to any one of claims 1 to 3, characterized in that, The PspA protein fragment is selected from families 1 and 2, preferably fragments from clades 1 to 4, or a combination of two or more thereof.

5. The recombinant protein according to any one of claims 1 to 4, characterized in that, The excerpt is selected from: - Fragments at the end of the N-terminal region of PspA encoding clades 2 (PspA2-F5) and 4 (PspA4-F5), wherein PspA2-F5 consists of the amino acid sequence shown in SEQ ID NO:1 and PspA4-F5 consists of the amino acid sequence shown in SEQ ID NO:2; - Fragments at the end of the N-terminal region of PspA encoding clades 1 (PspA1-F5) and 3 (PspA3-F5), wherein PspA1-F5 consists of the amino acid sequence shown in SEQ ID NO:3 and PspA3-F5 consists of the amino acid sequence shown in SEQ ID NO:4; - Segments at the end of the N-terminal region of PspA in clades 2 (PspA2-F5), 4 (PspA4-F5), and 1 (PspA1-F5); and - Segments at the end of the N-terminal region of PspA encoding clades 2 (PspA2-F5), 4 (PspA4-F5), 1 (PspA1-F5), and 3 (PspA3-F5).

6. The recombinant protein according to any one of claims 1 to 5, characterized in that, The PspA fragment is encoded by the following nucleotide sequence: - The DNA sequence shown in SEQ ID NO:29 and its degenerate sequence, which encodes PspA2-F5 shown in SEQ ID NO:1; - The DNA sequence shown in SEQ ID NO:30 and its degenerate sequence, which encodes PspA4-F5 shown in SEQ ID NO:2; - The DNA sequence shown in SEQ ID NO:31 and its degenerate sequence, encoding PspA1-F5 shown in SEQ ID NO:3; and / or - The DNA sequence shown in SEQ ID NO:32 and its degenerate sequence, which encodes PspA3-F5 shown in SEQ ID NO:

4.

7. The recombinant protein according to any one of claims 1 to 6, characterized in that, It contains the following amino acid sequence: - CyaA-PspA2-F5, which consists of the amino acid sequence shown in SEQ ID NO:5; or - CyaA-PspA4-F5, which consists of the amino acid sequence shown in SEQ ID NO:6; or - CyaA-PspA2-F5-PspA4-F5, which consists of the amino acid sequence shown in SEQ ID NO:7; or - CyaA-PspA1-F5, which consists of the amino acid sequence shown in SEQ ID NO:8; or - CyaA-PspA1-F5-PspA3-F5, which consists of the amino acid sequence shown in SEQ ID NO:9; or - CyaA-PspA2-F5-PspA4-F5-PspA1-F5, which consists of the amino acid sequence shown in SEQ ID NO:10; or - CyaA-PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5, which consists of the amino acid sequence shown in SEQ ID NO:

11.

8. The recombinant protein according to any one of claims 1 to 7, characterized in that, It is encoded by the following nucleotide sequence: - The DNA sequence shown in SEQ ID NO:12 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA2-F5 shown in SEQ ID NO:5; - The DNA sequence shown in SEQ ID NO:13 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA4-F5 shown in SEQ ID NO:6; - The DNA sequence shown in SEQ ID NO:14 and its degenerate sequence encode the recombinant protein CyaA-PspA2-F5-PspA4-F5 shown in SEQ ID NO:7; - The DNA sequence shown in SEQ ID NO:15 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA1-F5 shown in SEQ ID NO:8; - The DNA sequence shown in SEQ ID NO:16 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA1-F5-PspA3-F5 shown in SEQ ID NO:9; - The DNA sequence shown in SEQ ID NO:17 and its degenerate sequence, encoding the recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5 shown in SEQ ID NO:10; or - The DNA sequence shown in SEQ ID NO:18 and its degenerate sequence, which encodes the recombinant protein CyaA-PspA2-F5-PspA4-F5-PspA1-F5-PspA3-F5 shown in SEQ ID NO:

11.

9. An expression box, characterized in that, It comprises a DNA sequence and its degenerate sequence selected from the nucleotide sequences shown in SEQ ID NO:12 to 18 that respectively encode the recombinant proteins shown in SEQ ID NO:5 to 11.

10. An immunogenic composition, characterized in that, It comprises a recombinant protein as defined in any one of claims 1 to 8 or an expression cassette as defined in claim 9, and a pharmaceutically acceptable carrier and / or adjuvant.

11. The immunogenic composition according to claim 10, used as a vaccine.

12. The immunogenic composition according to claim 10 or 11, characterized in that, It is administered via parenteral or mucosal routes.

13. The immunogenic composition according to any one of claims 10 to 12, for preventing infection caused by Streptococcus pneumoniae.

14. The recombinant protein as defined in any one of claims 1 to 8, the expression cassette as defined in claim 9, or the immunogenic composition as defined in any one of claims 10 to 13, characterized in that, It is used as a vaccine to prevent infection caused by Streptococcus pneumoniae.

15. The recombinant protein for the use according to claim 14, characterized in that, The vaccine is used to prevent infection caused by Streptococcus pneumoniae and provides broad-spectrum protection against different strains of Streptococcus pneumoniae regardless of serotype.

Images