Bacterial laccase mutant and application thereof in degrading mycotoxin
By genetically modifying bacterial laccase, a bacterial laccase mutant that efficiently degrades AFB1 and ZEN was prepared, solving the problems of yield and environmental adaptability of fungal laccase in large-scale applications. This achieved efficient and safe removal of mycotoxins, maintaining the quality of food and medicinal materials.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-12
- Publication Date
- 2026-04-14
AI Technical Summary
In existing technologies, fungal laccases have low yields and poor environmental adaptability when degrading mycotoxins AFB1 and ZEN, making it difficult to achieve large-scale economical applications. Furthermore, physical and chemical methods may cause changes in the properties of food and medicinal materials and cytotoxic effects during the removal process.
Bacterial laccase mutants were developed, and various bacterial laccase mutants CotA-1 to CotA-7 were prepared by genetic engineering. Mutations were made at amino acid positions 127, 228 and/or 379 to improve their degradation efficiency against AFB1 and ZEN. Large-scale production was achieved through plasmids and engineered bacteria.
The bacterial laccase mutant achieved a degradation rate of over 98% for AFB1 and ZEN, and the degradation products were not hepatotoxic, thus maintaining the quality and nutritional value of food and medicinal materials and avoiding the side effects of traditional methods.
Smart Images

Figure CN121852340A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to bacterial laccase mutants and their application in the degradation of mycotoxins. Background Technology
[0002] Mycotoxins are toxic secondary metabolites produced by fungi, seriously endangering human and animal health. According to a report by the Food and Agriculture Organization of the United Nations (FAO), approximately 25% of global food crops are infected with mycotoxins annually, and more than 70% of feed and feed ingredients contain at least one mycotoxin, causing hundreds of billions of dollars in economic losses. Aflatoxin and zearalenone (ZEN) are two of the most common mycotoxins, causing serious contamination in grains, feed, and traditional Chinese medicine, and exhibiting various toxic effects on humans and animals.
[0003] Aflatoxins are ranked first among biological toxins due to their severe damage to the livers of humans and animals. Aflatoxins (Afs) are mainly divided into four types: AFB1, AFB2, AFG1, and AFG2. Among them, AFB1 is the most toxic and carcinogenic, with a toxicity 68 times that of arsenic and 10 times that of potassium cyanide. More than 75% of all aflatoxin-related food, drug, and feed contamination is caused by AFB1. The International Agency for Research on Cancer (IARC) has classified AFB1 as a Group 1 carcinogen. More than 5 billion people worldwide are chronically exposed to AFB1, and long-term exposure can lead to hepatotoxicity, immunotoxicity, neuroendocrine disorders, and neuronal dysregulation. ZEN, produced by Fusarium spp., is a non-steroidal estrogen mycotoxin. Its structure and function are similar to endogenous estrogen, and it has functions such as interfering with sex hormone secretion, causing DNA damage, and affecting the immune system. Zearalenone (ZEN) and its metabolites can competitively bind to estrogen receptors in animals, competing with estrogen for binding sites. This causes estrogen syndrome in livestock, leading to excessive estrogen levels and resulting in infertility, abortion, and stillbirth. ZEN is also highly carcinogenic, seriously endangering the health of livestock and humans. Given the hazards of AFB1 and ZEN, it is necessary to detoxify food, medicinal materials, and water bodies contaminated with AFB1 and ZEN to effectively avoid the health risks and mitigate the economic losses caused by AFB1 and ZEN contamination.
[0004] Several strategies for the removal of AFB1 and ZEN have been developed and optimized over the past few years, broadly categorized into physical, chemical, and biological methods. Physical and chemical methods, including adsorption, irradiation, ozonation, peroxidation, and ammoniation, can partially or completely eliminate AFB1 and ZEN. However, these methods, while adsorbing or oxidizing aflatoxins, also damage other nutrients, causing unnecessary changes in the properties of food and medicinal materials, such as decreased sensory quality, alterations in the content of active ingredients in medicinal materials, and flavor changes. Furthermore, they may induce cytotoxic effects such as oxidative stress, reduced cell viability, apoptosis, and DNA damage, creating new safety hazards. Biodegradation offers a more promising alternative for the removal of AFB1 and ZEN because it provides a means to convert AFB1 and ZEN into non-toxic or less toxic metabolites under mild conditions, while preserving the quality and nutritional value of agricultural products.
[0005] Laccases are a class of multi-copper oxidases characterized by a broad substrate range, high catalytic activity, and water as a catalytic byproduct, making them a recognized green and environmentally friendly enzyme. Laccases are widely distributed in nature, found in bacteria, fungi, insects, and higher plants. Current research indicates that fungal laccases have the potential to degrade AFB1 and ZEN. However, the low yield and poor environmental adaptability of fungal laccases significantly limit their large-scale, cost-effective removal of AFB1 and ZEN. Compared to fungal laccases, bacterial laccases are easier to produce on a large scale, have stronger environmental tolerance, and are more readily commercially viable. However, there are significant differences in laccase production efficiency and enzymatic properties among bacteria from different sources. Therefore, there is an urgent need to find high-quality, inexpensive laccases for the effective removal of mycotoxins, especially AFB1 and ZEN. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a bacterial laccase mutant.
[0007] A second objective of this invention is to provide the encoding gene for the aforementioned bacterial laccase mutant.
[0008] A third objective of this invention is to provide a plasmid containing the above-described encoding gene.
[0009] A fourth objective of this invention is to provide engineered bacteria containing the aforementioned plasmids.
[0010] A fifth objective of this invention is to provide the application of bacterial laccase mutants in the degradation of mycotoxins.
[0011] The technical solution of this invention is summarized as follows:
[0012] Bacterial laccase mutants, which are one of the following:
[0013] CotA-1: The phenylalanine at position 127 of the amino acid sequence of SEQ ID NO.1 is mutated to cysteine;
[0014] CotA-2: The phenylalanine at position 228 of the amino acid sequence of SEQ ID NO.1 is mutated to cysteine;
[0015] CotA-3: The glycine at position 379 of the amino acid sequence of SEQ ID NO.1 is mutated to serine;
[0016] CotA-4: The amino acid sequence of SEQ ID NO.1 shows a mutation where phenylalanine at position 127 is replaced by cysteine, and phenylalanine at position 228 is replaced by cysteine.
[0017] CotA-5: SEQ ID NO.1 amino acid sequence has a mutation at position 127 (phenylalanine) to cysteine and position 379 (glycine) to serine.
[0018] CotA-6: SEQ ID NO.1 amino acid sequence has a mutation at position 228 (phenylalanine) to cysteine and position 379 (glycine) to serine.
[0019] CotA-7: SEQ ID NO.1 amino acid sequence has a mutation at position 127 (phenylalanine) to cysteine, position 228 (phenylalanine) to cysteine, and position 379 (glycine) to serine.
[0020] The encoding gene of the bacterial laccase mutant mentioned above.
[0021] Plasmids containing the above-mentioned encoding genes.
[0022] Genetically engineered bacteria containing the above plasmids.
[0023] Application of the above-mentioned bacterial laccase mutants in the degradation of mycotoxins.
[0024] The mycotoxin is preferably aflatoxin B1 or zearalenone.
[0025] Advantages of this invention:
[0026] Experiments have demonstrated that the bacterial laccase mutant of this invention achieves a degradation rate of over 98% for aflatoxin B1 and over 98% for zearalenone. The degradation products obtained by the bacterial laccase mutant from the degradation of AFB1 or ZEN do not exhibit hepatotoxicity. Attached Figure Description
[0027] Figure 1 This is a liquid chromatogram of aflatoxin B1 degradation at 0h and 6h using a bacterial laccase mutant (CotA-1).
[0028] Figure 2 The images show liquid chromatograms of 0h and 6h of degradation of zearalenone by the bacterial laccase mutant (CotA-1).
[0029] Figure 3 The study investigated the hepatotoxicity of AFB1 and the detoxification effect of the bacterial laccase mutant (CotA-1) on AFB1.
[0030] Figure 4 The study focuses on the hepatotoxicity of ZEN and the detoxification effect of the bacterial laccase mutant (CotA-1) on ZEN. Detailed Implementation
[0031] The present invention will be further described in detail below with reference to specific embodiments, and the technical solutions in the embodiments of the present invention will be clearly and completely described. Unless otherwise specified, the equipment and reagents used in each embodiment are commercially available, and the technical means used in the embodiments are conventional means used by those skilled in the art.
[0032] Example 1
[0033] Cloning, protein expression, and purification of bacterial laccase mutant genes
[0034] Bacillus subtilis (CGMCC 1.15792), purchased from the China General Microbiological Culture Collection Center (cgmcc.net) in June 2019, was cultured overnight on LB broth. After centrifugation at 10,000 rpm for 1 min, the supernatant was discarded, and the sample was extracted using a genomic DNA extraction kit. Genomic DNA was extracted using the Bacteria Genomic DNA Kit (purchased from TransGen Biotech). Using the extracted genome as a template, and with cotA-F (SEQ ID NO. 5) as the upstream primer and cotA-R (SEQ ID NO. 6) as the downstream primer, DNA polymerase was rapidly amplified using PCR. Taq DNA Polymerase (TransGen Biotech Co., Ltd.) amplifies the laccase gene in the genome to obtain the bacterial laccase gene cotA, whose nucleotide sequence is shown in SEQ ID NO.3 (its amino acid sequence is shown in SEQ ID NO.1). Specific reaction conditions are shown in Table 1.
[0035] Table 1
[0036]
[0037] Using the obtained bacterial laccase nucleotide sequence cotA (SEQ ID NO.3) as a template, respectively...
[0038] Using cotA-1-F (SEQ ID NO. 7) as the upstream primer and cotA-1-R (SEQ ID NO. 8) as the downstream primer,
[0039] Using cotA-2-F (SEQ ID NO. 9) as the upstream primer and cotA-2-R (SEQ ID NO. 10) as the downstream primer, and
[0040] PCR amplification was performed using cotA-3-F (SEQ ID NO.4) as the upstream primer and cotA-3-R (SEQ ID NO.2) as the downstream primer to obtain cotA-1, cotA-2, and cotA-3, respectively.
[0041] Using cotA-1 as a template, respectively
[0042] PCR amplification was performed using cotA-2-F (SEQ ID NO. 9) as the upstream primer and cotA-2-R (SEQ ID NO. 10) as the downstream primer, and cotA-3-F (SEQ ID NO. 4) as the upstream primer and cotA-3-R (SEQ ID NO. 2) as the downstream primer, to obtain cotA-4 and cotA-5, respectively.
[0043] Using cotA-2 as a template, PCR amplification was performed with cotA-3-F (SEQ ID NO.4) as the upstream primer and cotA-3-R (SEQ ID NO.2) as the downstream primer to obtain cotA-6.
[0044] Using cotA-6 as a template, cotA-3-F (SEQ ID NO.4) as the upstream primer, and cotA-3-R (SEQ ID NO.2) as the downstream primer, PCR amplification was performed to obtain cotA-7. The primer sequences are shown in Table 2. The amplification reagents and conditions were the same as those used in the first amplification.
[0045] Using a PCR amplification fragment recovery kit The amplified fragments were purified using a PCR Purification Kit (TransGen Biotech Ltd.). The purified PCR amplified fragments and the *E. coli* plasmid pET-28a were digested using restriction endonucleases BamHI and XhoI (purchased from NEB Biotechnology). The endonuclease-digested fragments were then separated using agarose gel electrophoresis and recovered using a gel extraction kit. The correct bands were recovered using the Quick Gel Extraction Kit (TransGen Biotech). Next, the obtained bacterial laccase mutant genes cotA-1 to cotA-7 were ligated with linearized pET-28a using the T4 DNA ligase (Thermo), respectively, to obtain recombinant plasmids pET-28a-cotA-1, pET-28a-cotA-2, pET-28a-cotA-3, pET-28a-cotA-4, pET-28a-cotA-5, pET-28a-cotA-6, and pET-28a-cotA-7. The recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells (purchased from TransGen Biotech). Then, 1 mL of sterile LB liquid medium was added to the transformed cells, and the cells were incubated at 37°C and 220 rpm for 50 min. After centrifugation at 10,000 rpm for 1 min, the supernatant was discarded, and the cells were resuspended in 0.2 mL of sterile LB liquid medium. The cells were then plated on LB solid medium plates containing kanamycin sulfate (50 μg / L) and incubated at 37°C for 12 h. Subsequently, single colonies were picked and placed in 5 mL of LB liquid medium containing kanamycin sulfate (50 μg / L), and incubated at 37°C for 12 h. The resulting bacterial culture was used as the seed culture (resulting in recombinant strains pET-28a-cotA-1, pET-28a-cotA-2, pET-28a-cotA-3, pET-28a-cotA-4, pET-28a-cotA-5, pET-28a-cotA-6, and pET-28a-cotA-7). The seed culture was inoculated at a rate of 1% into 500 mL of LB liquid medium containing kanamycin sulfate (50 μg / L), and incubated at 37°C and 220 rpm until the OD value reached 0.8. IPTG was then added to a final concentration of 0.1 mM, and the culture was continued at 20°C and 220 rpm for another 20 h. Bacterial cells were collected by centrifugation at 8000 rpm for 20 min. The cells were resuspended in 100 mL of cell lysis buffer (50 mM Tris-HCl, pH 8.0, 20 mM imidazole) and disrupted using a high-pressure cell disruptor (Guangzhou Juneng). After centrifugation at 10000 rpm for 20 min, the supernatant was collected and the protein was purified by Ni-NTA affinity chromatography to obtain purified bacterial laccase mutants CotA-1, CotA-2, CotA-3, CotA-4, CotA-5, CotA-6, and CotA-7.
[0046] CotA-1: The phenylalanine at position 127 of the amino acid sequence of SEQ ID NO.1 is mutated to cysteine;
[0047] CotA-2: The phenylalanine at position 228 of the amino acid sequence of SEQ ID NO.1 is mutated to cysteine;
[0048] CotA-3: The glycine at position 379 of the amino acid sequence of SEQ ID NO.1 is mutated to serine;
[0049] CotA-4: The amino acid sequence of SEQ ID NO.1 shows a mutation where phenylalanine at position 127 is replaced by cysteine, and phenylalanine at position 228 is replaced by cysteine.
[0050] CotA-5: SEQ ID NO.1 amino acid sequence has a mutation at position 127 (phenylalanine) to cysteine and position 379 (glycine) to serine.
[0051] CotA-6: SEQ ID NO.1 amino acid sequence has a mutation at position 228 (phenylalanine) to cysteine and position 379 (glycine) to serine.
[0052] CotA-7: SEQ ID NO.1 amino acid sequence has a mutation at position 127 (phenylalanine) to cysteine, position 228 (phenylalanine) to cysteine, and position 379 (glycine) to serine.
[0053] Table 2 Primer sequences for bacterial laccase and bacterial laccase mutants
[0054] Primer name Primer sequence CotA-F (SEQ ID NO.5) ATGGGGGAGTTGCATTT CotA-R (SEQ ID NO.6) TTATGGGGATCAGTTATATCCATC CotA-1-F (SEQ ID NO.7) AAGACTGTGAACAAACAGGACC CotA-1-R (SEQ ID NO.8) TTGTTCACAGTCTTTGGAAAACCA CotA-2-F (SEQ ID NO.9) CCGGCTTGTTGCGGAGAAACCATA CotA-2-R (SEQ ID NO.10) TCCGCAACAAGCCGGAACGATTGA CotA-3-F (SEQ ID NO.4) CCCAGAGCGAATACGGCAGAC CotA-3-R (SEQ ID NO.2) TATTCGCTCTGGGTGCCTGCCAGT
[0055] Example 2
[0056] Degradation performance of bacterial laccase mutants on AFB1
[0057] 50 μg of AFB1 and 50 μg of the bacterial laccase mutant CotA-1 purified in Example 1 were added to 5 mL of Tris-HCl buffer and incubated at 40 °C for degradation. At 0, 3, 6, and 12 h, 0.75 mL of the reaction solution was collected in 2 mL EP tubes, and 1.25 mL of methanol was added to terminate the reaction. The liquid was centrifuged at 10000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm polytetrafluoroethylene membrane for high-performance liquid chromatography (HPLC) analysis. The HPLC conditions were as follows: Waters fluorescence detector, excitation wavelength 360 nm, emission wavelength 440 nm; mobile phase A was 0.2% formic acid aqueous solution (v / v), and solution B was acetonitrile, with a mobile phase A:mobile phase B v / v ratio of 70:30 and a flow rate of 1 mL / min. The HPLC analysis results of the degradation of AFB1 by the bacterial laccase mutant CotA-1 at different time points are shown below. Figure 1 As shown, after 6 hours of reaction, AFB1 was almost completely degraded, with a degradation rate of 98.0%.
[0058] Experiments have shown that the temperature for AFB1 degradation can be 30-90℃, preferably 40℃, and the pH value of the Tris-HCl buffer can be 5-10, preferably 7.5.
[0059] CotA-2, CotA-3, CotA-4, CotA-5, CotA-6, and CotA-7 replace CotA-1 in this embodiment, and other parameters are the same as in this embodiment. The reaction time is 6 hours. The results show that CotA-2 has a degradation rate of 98.1% for aflatoxin B1, CotA-3 has a degradation rate of 98.0% for aflatoxin B1, CotA-4 has a degradation rate of 98.3% for aflatoxin B1, CotA-5 has a degradation rate of 98.2% for aflatoxin B1, CotA-6 has a degradation rate of 98.5% for aflatoxin B1, and CotA-7 has a degradation rate of 98.9% for aflatoxin B1.
[0060] Example 3
[0061] Degradation performance of bacterial laccase mutants on ZEN
[0062] 50 μg ZEN and 50 μg of the bacterial laccase mutant CotA-1 purified in Example 1 were added to 5 mL of Tris-HCl buffer and incubated at 40 °C for degradation. At 0, 3, 6, and 12 h, 0.75 mL of the reaction solution was collected in 2 mL EP tubes, and 1.25 mL of methanol was added to terminate the reaction. The liquid was centrifuged at 10000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm polytetrafluoroethylene membrane for high-performance liquid chromatography (HPLC) analysis. The HPLC conditions were as follows: Waters fluorescence detector, excitation wavelength 274 nm, emission wavelength 440 nm; mobile phase A was 0.2% formic acid aqueous solution (v / v), and solution B was acetonitrile, with a mobile phase A:mobile phase B v / v ratio of 60:40 and a flow rate of 1 mL / min. The HPLC analysis results of the degradation of ZEN by the bacterial laccase mutant CotA-1 at different time points are shown below. Figure 2 As shown. After 6 hours of reaction, ZEN was almost completely degraded, with CotA-1 achieving a degradation rate of 98.0% for ZEN.
[0063] Experiments have shown that the temperature for ZEN degradation can be 30-90℃, preferably 40℃, and the pH value of the Tris-HCl buffer can be 5-10, preferably 7.5.
[0064] CotA-2, CotA-3, CotA-4, CotA-5, CotA-6, and CotA-7 replace CotA-1 in this embodiment, and the rest is the same as in this embodiment. The reaction time is 6 hours. The results show that CotA-2 has a degradation rate of 98.3% for ZEN, CotA-3 has a degradation rate of 98.1% for ZEN, CotA-4 has a degradation rate of 98.2% for ZEN, CotA-5 has a degradation rate of 98.6% for ZEN, CotA-6 has a degradation rate of 98.5% for ZEN, and CotA-7 has a degradation rate of 98.8% for ZEN.
[0065] Example 4
[0066] Hepatotoxicity of degradation products of AFB1 obtained by bacterial laccase mutants
[0067] 50 μg of AFB1 and 50 μg of the bacterial laccase mutant CotA-1 purified in Example 1 were added to 5 mL of Tris-HCl buffer and incubated at 40 °C for 12 h to degrade the product. The degradation product was terminated by adding 1.25 mL of methanol, and the supernatant was evaporated to dryness by vacuum distillation after centrifugation at 10000 rpm for 10 min. The powder was dissolved in edible oil (soybean oil was used as an example in this example), and the degradation product was prepared to a concentration of 1 mg / mL based on the amount added before AFB1 degradation. Eighteen 5-week-old male BALB / c mice (weighing 18–22 g) were randomly divided into three groups after acclimatization for one week: a blank control group, an AFB1 group, and a CotA-1+AFB1 group, with six mice in each group. The blank control group received 0.1 mL of edible oil via gavage daily; the AFB1 group received 0.1 mL of edible oil containing AFB1 via gavage daily, with an AFB1 dosage of 1 mg / kg; the CotA-1+AFB1 group received 0.1 mL of edible oil containing AFB1 degradation products via gavage daily, with the degradation products dosage of 1 mg / kg. The gavage was continued for 2 weeks. On day 29, liver samples were collected for pathological sectioning.
[0068] HE staining results of livers in different groups of mice are as follows Figure 3 As shown, liver tissue in the AFB1 group exhibited cell swelling and vacuolar degeneration, accompanied by severe nuclear fragmentation and inflammatory cell infiltration; no abnormal changes in hepatocytes were observed in the liver of the CotA-1+AFB1 group, indicating a significant reduction in the toxicity of degradation products. CotA-2, CotA-3, CotA-4, CotA-5, CotA-6, and CotA-7 were treated using the method described in this embodiment. On day 29, liver samples were collected for pathological sections, and the HE staining results of their mouse livers were similar to those of CotA-1.
[0069] Example 5
[0070] Hepatotoxicity of degradation products of ZEN obtained by bacterial laccase mutants
[0071] 50 μg of ZEN and 50 μg of the bacterial laccase mutant CotA-1 purified in Example 1 were added to 5 mL of Tris-HCl buffer and incubated at 40 °C for 12 h to degrade the product. The reaction was terminated by adding 1.25 mL of methanol to the degradation product. The supernatant was evaporated to dryness by vacuum distillation after centrifugation at 10000 rpm for 10 min. The powder was dissolved in edible oil (soybean oil was used as an example in this example), and the degradation product was prepared to a concentration of 4 mg / mL based on the amount of ZEN added before degradation. Eighteen 5-week-old male BALB / c mice (weighing 18–22 g) were randomly divided into three groups (n=6 each) after acclimatization for one week: a blank control group, a ZEN group, and a CotA-1+ZEN group. The blank control group received 0.1 mL of edible oil via gavage daily; the ZEN group received 0.1 mL of ZEN-containing edible oil via gavage daily, with a ZEN dosage of 40 mg / kg; the CotA-1+ZEN group received 0.1 mL of ZEN degradation products via gavage daily, with a degradation product dosage of 40 mg / kg. The gavage was continued for 2 weeks. On day 29, liver samples were collected for pathological sectioning.
[0072] HE staining results of livers in different groups of mice are as follows Figure 4 As shown, liver tissue in the ZEN group exhibited cell swelling and vacuolar degeneration, accompanied by severe cell swelling and vacuolar degeneration, and inflammatory cell infiltration; no abnormal changes in hepatocytes were observed in the liver of the CotA-1+ZEN group, indicating a significant reduction in the toxicity of degradation products. CotA-2, CotA-3, CotA-4, CotA-5, CotA-6, and CotA-7 were processed using the method described in this embodiment. On day 29, liver samples were collected for pathological sections, and the HE staining results of their mouse livers were similar to those of CotA-1.
Claims
1. A bacterial laccase mutant, characterized in that... The bacterial laccase mutant is one of the following: CotA-1: The phenylalanine at position 127 of the amino acid sequence of SEQ ID NO.1 is mutated to cysteine; CotA-2: The phenylalanine at position 228 of the amino acid sequence of SEQ ID NO.1 is mutated to cysteine; CotA-3: The glycine at position 379 of the amino acid sequence of SEQ ID NO.1 is mutated to serine; CotA-4: The amino acid sequence of SEQ ID NO.1 shows a mutation where phenylalanine at position 127 is replaced by cysteine, and phenylalanine at position 228 is replaced by cysteine. CotA-5: The amino acid sequence of CotA-5 has a mutation at position 127 (phenylalanine) to cysteine and position 379 (glycine) to serine. CotA-6: SEQ ID NO.1 amino acid sequence has a mutation at position 228 (phenylalanine) to cysteine and position 379 (glycine) to serine. CotA-7: SEQ ID NO.1 amino acid sequence has a mutation at position 127 (phenylalanine) to cysteine, position 228 (phenylalanine) to cysteine, and position 379 (glycine) to serine.
2. The encoding gene of the bacterial laccase mutant of claim 1.
3. A plasmid containing the encoding gene as described in claim 2.
4. Genetically engineered bacteria containing the plasmid described in claim 3.
5. The application of the bacterial laccase mutant of claim 1 in the degradation of mycotoxins.
6. The application according to claim 5, characterized in that... The mycotoxin is aflatoxin B1 or zearalenone.