Composition for detecting colorectal cancer in vitro and application thereof
By detecting the methylation status of MSC, FOXE1, GDF6, and C9orf50 genes in the peripheral blood of colorectal cancer patients, the problem of insufficient sensitivity and specificity in existing technologies has been solved, enabling efficient and accurate detection of colorectal cancer and personalized treatment guidance.
Patent Information
- Application Number
- CN202610187001.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-05-12
AI Technical Summary
The lack of highly sensitive and specific methylation gene markers for colorectal cancer detection in existing technologies makes postoperative recurrence monitoring difficult and hinders accurate risk stratification and individualized treatment.
A composition and kit are provided, comprising nucleic acid probes and primers for detecting the methylation status of target sequences of MSC, FOXE1, GDF6 and C9orf50 genes, which, through bisulfite treatment and DNA polymerization reaction, combined with probe detection, enable the detection of the methylation status of cell-free DNA in peripheral blood.
It achieves sensitive and specific detection of colorectal cancer, reduces the harm of invasive testing, enables real-time monitoring and guides individualized treatment, and improves the accuracy and sensitivity of detection.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of molecular biology and relates to gene detection, specifically to a composition for in vitro detection of colorectal cancer and its use. Background Technology
[0002] Colorectal cancer (CRC) is one of the most common and serious malignant tumors threatening human health worldwide. Adenocarcinoma is the most common pathological type of colorectal cancer and a leading cause of death among patients. Surgical resection combined with adjuvant chemotherapy is the main treatment for long-term survival in patients with early-stage colorectal cancer. Even if a patient undergoes seemingly successful surgical resection, the risk of recurrence remains ever-present. While surgery can directly remove visible tumor tissue, it cannot guarantee the complete eradication of all cancer cells. Tiny residual lesions may remain hidden throughout the body, becoming "time bombs" for future recurrence.
[0003] Traditional imaging examinations and serum tumor markers (such as CEA) have significant limitations in early recurrence monitoring: imaging can only detect lesions visible to the naked eye, and CEA has unsatisfactory sensitivity and specificity. Therefore, postoperative detection of highly sensitive molecular markers (such as ctDNA and methylation markers) has important clinical value. These novel biomarkers can detect minimal residual disease (MRD) at the molecular level, providing a warning of recurrence risk months earlier than traditional methods, thus gaining a valuable window for clinical intervention. Simultaneously, MRD detection can achieve precise risk stratification, guiding individualized adjuvant therapy decisions, avoiding overtreatment or undertreatment, thereby significantly improving patient survival outcomes.
[0004] Therefore, there is an urgent need for more precise biomarkers and detection methods to better guide the diagnosis and treatment of colorectal cancer and improve patients' survival rates and quality of life. Recent studies have shown that epigenetics plays a crucial role in the occurrence and development of cancer. As an important mechanism of epigenetics, the regulation of DNA methylation in various cancers has been extensively studied. Research data shows that the regulation of gene methylation is related to biological mechanisms such as chromatin structure and gene expression regulation; changes in cellular gene methylation occur in the early stages of tumor formation and continue throughout the occurrence and development of cancer; and the methylation of tumor suppressor genes is an important molecular mechanism for the transformation of precancerous lesions into malignant tumor cells. However, there is currently a lack of detection technologies, methods, and products specifically for detecting methylation genes in colorectal cancer. Therefore, there is a current demand for methylation gene markers with high sensitivity and specificity for the detection of colorectal cancer recurrence. Summary of the Invention
[0005] In view of the problems existing in the current colorectal cancer detection, the purpose of this application is to provide a composition, a kit for in vitro detection of colorectal cancer, its use and its use in detecting colorectal cancer.
[0006] The specific technical solution of this application is as follows: 1. A composition for in vitro detection of colorectal cancer, said composition comprising: Nucleic acid used to detect the methylation status of a target gene. The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene. The target gene is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene, and C9orf50 gene.
[0007] 2. The composition according to claim 1, wherein the target sequence of the MSC gene is a sequence as shown in any one of SEQ ID NOs: 1-4 or contains a sequence as shown in any one of SEQ ID NOs: 1-4; and / or The target sequence of the FOXE1 gene is a sequence as shown in any one of SEQ ID NOs: 5-8 or contains any one of SEQ ID NOs: 5-8; and / or The target sequence of the GDF6 gene is a sequence as shown in any one of SEQ ID NOs: 9-12 or contains a sequence as shown in any one of SEQ ID NOs: 9-12; and / or The target sequence of the C9orf50 gene is a sequence as shown in any one of SEQ ID NOs: 13-16 or contains any one of SEQ ID NOs: 13-16.
[0008] 3. The composition according to claim 1 or 2, wherein the nucleic acid for detecting the methylation status of the target gene comprises: Primers, wherein the primers are fragments of at least 9 nucleotides from the target sequence of the target gene. The fragment contains at least one CpG dinucleotide sequence.
[0009] 4. The composition according to any one of claims 1-3, wherein the nucleic acid for detecting the methylation status of the target gene comprises: The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately or strictly controlled conditions. The fragment contains at least one CpG dinucleotide sequence.
[0010] 5. The composition according to any one of items 1-4, further comprising: A reagent that converts the 5th unmethylated cytosine base of the target sequence of a target gene into uracil.
[0011] 6. The composition according to claim 3, wherein, The fragment of at least 9 nucleotides is a sequence as shown in SEQ ID NO: 17 and SEQ ID NO: 18, or a sequence as shown in SEQ ID NO: 20 and SEQ ID NO: 21, or a sequence as shown in SEQ ID NO: 23 and SEQ ID NO: 24, or a sequence as shown in SEQ ID NO: 26 and SEQ ID NO: 27.
[0012] 7. The composition according to claim 4, wherein the fragment of at least 15 nucleotides is a sequence as described in SEQ ID NO: 19, or a sequence as described in SEQ ID NO: 22, or a sequence as described in SEQ ID NO: 25, or a sequence as described in SEQ ID NO: 28.
[0013] 8. An oligonucleotide for in vitro detection of colorectal cancer, comprising: A fragment consisting of at least 9 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or A fragment consisting of at least 9 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or Fragments comprising at least 9 nucleotides of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or A fragment of at least 9 nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or their complementary sequence and containing at least one CpG dinucleotide sequence.
[0014] 9. The oligonucleotide according to item 8, further comprising: A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or their complementary sequence under moderate or severe conditions and contains at least one CpG dinucleotide sequence; A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0015] 10. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequences of SEQ ID NO: 17 and SEQ ID NO: 18.
[0016] 11. The oligonucleotide according to claim 10, further comprising: The sequence of SEQ ID NO: 19.
[0017] 12. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequences of SEQ ID NO: 20 and SEQ ID NO: 21.
[0018] 13. The oligonucleotide according to claim 10, further comprising: The sequence of SEQ ID NO: 22.
[0019] 14. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequences of SEQ ID NO: 23 and SEQ ID NO: 24.
[0020] 15. The oligonucleotide according to claim 10, further comprising: The sequence of SEQ ID NO: 25.
[0021] 16. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequences of SEQ ID NO: 26 and SEQ ID NO: 27.
[0022] 17. The oligonucleotide according to claim 10, further comprising: The sequence of SEQ ID NO: 28.
[0023] 18. A kit comprising the composition of any one of items 1-7 or the oligonucleotide of any one of items 8-17.
[0024] 19. The kit according to claim 18, further comprising at least one other component selected from: Nucleoside triphosphate, DNA polymerase, and buffer solution required for the function of the DNA polymerase.
[0025] 20. The kit according to item 18 or 19, wherein the samples for which the kit is used to detect include: cell lines, histological sections, tissue biopsy / paraffin-embedded tissue, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.
[0026] 21. The kit according to any one of items 18-20 further comprises: instructions.
[0027] 22. Use of the composition according to any one of items 1-7 or the oligonucleotide according to any one of items 8-17 in the preparation of a kit for in vitro detection of colorectal cancer.
[0028] 23. The use according to item 22, wherein the kit for in vitro detection of colorectal cancer detects colorectal cancer by means of a method comprising the steps of: 1) Isolate DNA samples containing the target sequence or fragments of the target gene from the biological sample to be tested; 2) Determine the methylation status of the target sequence of the target gene; 3) The state of biological samples is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of colorectal cancer.
[0029] 24. The use according to item 23, wherein the method comprises the following steps: Extract genomic DNA from the biological sample to be tested; The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases. The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction; Detection of amplification products using probes; and Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.
[0030] 25. The use according to item 24, wherein the reagent is a bisulfite reagent.
[0031] 26. A method for detecting colorectal cancer, comprising the following steps: Isolate DNA samples containing the target sequence or fragments of the target gene from biological samples to be tested; Determine the methylation status of the target sequence of the target gene; and The state of a biological sample is determined by detecting the methylation status of the target sequence of the target gene, thereby enabling in vitro detection of colorectal cancer. The target gene is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene, and C9orf50 gene.
[0032] 27. A method for detecting colorectal cancer, comprising the following steps: Extract genomic DNA from the biological sample to be tested; The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases. The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction; Detection of amplification products using probes; and Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined. The target gene is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene, and C9orf50 gene.
[0033] 28. The method according to item 26 or 27, wherein the target sequence of the RALB gene is a sequence shown in any one of SEQ ID NOs: 1-4 or contains a sequence shown in any one of SEQ ID NOs: 1-4.
[0034] 29. The method according to items 26-28, wherein the target sequence of the RALB gene is a sequence shown in any one of SEQ ID NOs: 5-8 or contains a sequence shown in any one of SEQ ID NOs: 5-8.
[0035] 30. The method according to items 26-29, wherein the target sequence of the RALB gene is a sequence shown in any one of SEQ ID NOs: 9-12 or contains a sequence shown in any one of SEQ ID NOs: 9-12.
[0036] 31. The method according to items 26-30, wherein the target sequence of the RALB gene is a sequence shown in any one of SEQ ID NOs: 13-16 or contains a sequence shown in any one of SEQ ID NOs: 13-16.
[0037] 32. The method according to item 27, wherein the reagent is a bisulfite reagent.
[0038] 33. The method according to item 27, wherein the primer is: A fragment consisting of at least 9 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or A fragment consisting of at least 9 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or Fragments comprising at least 9 nucleotides of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or A fragment of at least 9 nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or their complementary sequence and containing at least one CpG dinucleotide sequence.
[0039] 34. The method according to item 27, wherein the probe is: A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; or A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0040] 35. The method according to item 27, wherein the primers are sequences as shown in SEQ ID NO: 17 and SEQ ID NO: 18, or sequences as shown in SEQ ID NO: 20 and SEQ ID NO: 21, or sequences as shown in SEQ ID NO: 23 and SEQ ID NO: 24, or sequences as shown in SEQ ID NO: 26 and SEQ ID NO: 27.
[0041] 36. The method according to item 27, wherein the probe is a sequence as described in SEQ ID NO: 19, or a sequence as described in SEQ ID NO: 22, or a sequence as described in SEQ ID NO: 25, or a sequence as described in SEQ ID NO: 28.
[0042] 37. A methylation biomarker for in vitro detection of colorectal cancer, wherein the methylation biomarker is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene and C9orf50 gene; Preferably, the target sequence of the MSC gene is a sequence as shown in any one of SEQ ID NOs: 1-4 or contains a sequence as shown in any one of SEQ ID NOs: 1-4; and / or The target sequence of the FOXE1 gene is a sequence shown in any one of SEQ ID NOs: 5-8 or contains a sequence shown in any one of SEQ ID NOs: 5-8; and / or The target sequence of the GDF6 gene is a sequence shown in any one of SEQ ID NOs: 9-12 or contains a sequence shown in any one of SEQ ID NOs: 9-12; and / or The target sequence of the C9orf50 gene is a sequence shown in any one of SEQ ID NOs: 13-16 or contains a sequence shown in any one of SEQ ID NOs: 13-16.
[0043] This application has the following beneficial effects: This application screens biomarkers capable of sensitively and specifically detecting colorectal cancer and identifies the methylation regions of these biomarkers. By detecting the target sequence of the methylated gene in the RALB gene, the methylation status of the gene can be sensitively and specifically detected, thus enabling its use in the detection of cell-free DNA in peripheral blood. Testing of peripheral blood samples from colorectal cancer patients and healthy controls shows that the composition and detection method described in this application can sensitively and specifically detect colorectal cancer, ensuring the accuracy and reliability of the results. Therefore, this application provides a composition, kit, and detection method for in vitro detection of colorectal cancer, enabling convenient, rapid, and effective detection of colorectal cancer, and possessing significant clinical application value.
[0044] This application utilizes epigenomics and bioinformatics techniques to analyze genomic methylation data of colorectal cancer, identify multiple methylation genes associated with colorectal cancer, and determine the target sequences for abnormal methylation of colorectal cancer methylation genes. Furthermore, by using the target sequences of these methylation genes, the methylation status of the genes can be detected sensitively and specifically, which can then be used for the detection of cell-free DNA in peripheral blood.
[0045] The composition described in this application is used in a non-invasive manner for screening asymptomatic individuals, reducing the harm caused by invasive testing. The composition has higher sensitivity and accuracy, enabling real-time monitoring. Detailed Implementation
[0046] Detailed Description of Embodiments. The present application will now be described in detail. While specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.
[0047] Unless otherwise stated, the implementation of this application will employ conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, all of which fall within the scope of conventional techniques in the art. Such techniques are described in detail in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (MJ Gait, 1984); *Animal Cell Culture* (RI Freshney, 1987); *Methods in Enzymology* (Academic Publishing, Inc.); *Current Protocols in Molecular Biology* (FMAusubel et al., 1987, and regularly updated); and *PCR: The Polymerase Chain Reaction* (Mullis et al., 1994). The primers, probes, blocking agents, and kits used in this application can be prepared using standard techniques known in the art.
[0048] Unless otherwise defined, the technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0049] definition In this application, "stringent hybridization conditions" and "highly stringent" refer to the conditions under which the probe hybridizes with its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary under different conditions. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Biochemistry and Molecular Biology Techniques – Nucleic Acid Probe Hybridization, “A Review of Hybridization Principles and Nucleic Acid Assay Strategies.” Typically, stringent conditions are approximately 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength and pH. At Tm (within the defined ionic strength, pH, and nucleic acid concentration), 50% of the probe complementary to the target sequence hybridizes uniformly with the target sequence. Stringent conditions can also be achieved by adding a destabilizing agent. For selective or specific hybridization, the positive signal is twice, preferably ten times, the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization at 42°C in a solution of 50% formamide, 5x SSC and 1% SDS, or hybridization at 65°C in a solution of 5x SSC and 1% SDS, followed by washing at 65°C in a solution of 0.2x SSC and 0.1% SDS.
[0050] Furthermore, if the peptides encoded by the nucleic acids are substantially similar, the nucleic acids that cannot hybridize under stringent conditions are still substantially similar. In this case, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, “moderately stringent hybridization conditions” include hybridization at 37°C in a solution of 40% formamide, 1M sodium chloride, and 1% SDS, followed by washing at 45°C in a solution of 1xSSC. Those skilled in the art will readily obtain guidance in the prior art for achieving conditions with the same stringency. For PCR, temperatures around 36°C are typically suitable for low-stringency amplification, while annealing temperatures range from 32°C to 48°C depending on primer length. For highly stringent PCR amplification, it is generally at 62°C, while annealing temperatures for highly stringent hybridization range from 50°C to 65°C depending on primer length and specificity. Typical cycling conditions for both high-strict and low-strict amplification include: a sustained denaturation phase of 30 seconds to 2 minutes at 90–95°C, a sustained annealing phase of 30 seconds to 2 minutes, and a sustained expansion phase of 1 to 2 minutes at approximately 72°C. Tools and instructions for low- and high-strict amplification reactions are available in the prior art.
[0051] In this application, "oligonucleotide" refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides. Its precise size can depend on many factors, which in turn are determined by the final function and use of the oligonucleotide. In some embodiments, the oligonucleotide may comprise a length of 10 to 100 nucleotides. In some embodiments, the oligonucleotide may comprise a length of 10 to 30 nucleotides, or may have a length of 20 or 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.
[0052] In this application, "primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of a primer extension complementary to a nucleic acid strand—namely, in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at suitable temperature and pH—can serve as a starting point for synthesis, whether it is naturally occurring in purified restriction digests or synthetically produced. Primers can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, 15, 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but they may contain fewer or more nucleotides. Factors involved in determining the appropriate primer length are well known to those skilled in the art.
[0053] In this application, "primer pair" refers to a primer pair that hybridizes with the opposite strand of the target DNA molecule or with a target DNA region flanking the nucleotide sequence to be amplified.
[0054] In this application, "primer site" refers to the region of the target DNA or other nucleic acid to which the primer hybridizes.
[0055] In this application, the term "probe," when referring to a nucleic acid sequence, is used in its usual sense to mean a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. Those skilled in the art will understand that, in certain circumstances, a probe can also be used as a primer, and a primer can be used as a probe.
[0056] In this application, "DNA methylation" refers to the addition of a methyl group to the 5th position of cytosine (C), which is typically (but not necessarily) in the case of a CpG (cytosine followed by guanine) dinucleotide. As used herein, "increased degree of methylation" or "significant degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancer cell or tissue sample, or a DNA sample treated with methylation of DNA residues) is unmethylated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.
[0057] In the implementation scheme, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using Southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), and methylation-specific microarrays (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or Southern blot analysis.
[0058] In this application, "methylation assay" refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.
[0059] In this application, "detection" refers to any process of observing a biomarker or a change in a biomarker (e.g., a change in the methylation state of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or the change in the biomarker is actually detected. In other words, the act of detecting a biomarker or a change in a biomarker in a sample is "detection," even if the biomarker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation and can be based on comparison with one or more control samples.
[0060] In this application, "homology," "identity," and "similarity" refer to the sequence similarity between two nucleic acid molecules. Homology, identity, or similarity can be determined by comparing positions in each sequence, and the sequences can be aligned for comparison purposes. When equivalent positions in the compared sequences are occupied by the same bases, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid residues (e.g., similar in spatial or electrical properties), the molecules can be considered homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the number of identical or similar amino acids at shared positions in the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity with the sequences of this application, preferably less than 25%. The absence or presence of extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In specific implementations, for two or more sequences or subsequences, determined by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection provided online, for example, by the National Center for Biotechnology Information (NCBI), if their sequences exhibit approximately 60% identity in the specified region, or approximately 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, when compared and aligned for maximum correspondence within a comparison window or specified region, they can be considered substantially or significantly homologous, similar, or identical. This definition also relates to or can be used to test sequence complements. Therefore, to the extent permitted by the context of this paper, for example, if a nucleotide sequence can be predicted to be naturally present in a DNA duplex, or can be naturally present as one or both of the complementary strands, then a nucleotide sequence complementary to the specified target sequence or a variant thereof is itself considered "similar" to the target sequence, and when "similar" nucleic acid sequences are involved, this includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Similarity must be limited to analyses of single nucleic acid strand sequences, which may include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In the implementation scheme, identity or similarity may be in regions of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides, or in regions of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more nucleotides.
[0061] In this application, "amplification" refers to the process of obtaining multiple copies of a nucleic acid from a specific locus, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known methods, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).
[0062] The "fluorescence-based real-time PCR" described in this application refers to a method that involves adding a fluorescent group to the PCR reaction system, using the accumulation of fluorescence signals to monitor the entire PCR process in real time, and finally performing quantitative analysis of unknown templates using a standard curve. A crucial concept in this PCR technique is the cycle threshold, also known as the Ct value. C stands for Cycle, and t stands for threshold. The Ct value represents the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. For example, the fluorescence threshold can be set as follows: the fluorescence signal from the first 15 cycles of the PCR reaction is used as the fluorescence background signal, and the default setting for the fluorescence threshold is 10 times the standard deviation of the fluorescence signal from 3 to 15 cycles.
[0063] The "cut-off value" of real-time PCR in this application refers to a critical Ct value for determining the positivity or positivity of a sample for a specific biomarker. According to certain specific real-time methods in this application, "the critical Ct value (Cut-off value) is obtained based on a certain number of sample data and statistical processing," and this critical Ct value may vary depending on the required sensitivity or specificity.
[0064] In this application, "sensitivity" refers to the proportion of cancer detected in a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancer / all cancers), while "specificity" refers to the proportion of normal individuals detected in a certain normal sample, and its calculation formula is: Specificity = (detected negatives / total negatives).
[0065] The “label” or “detectable part” in this application refers to a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin, or haptens, and proteins that can be prepared as detectable proteins, for example, by incorporating a radiolabel into a peptide or using an antibody to detect a peptide-specific reaction.
[0066] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides capable of amplifying target nucleic acids (e.g., oligonucleotide primers) can be used in PCR reactions. PCR methods typically include the following steps: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize with the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. The conditions for nucleic acid amplification and detection of the amplification product are known to those skilled in the art. Various improvements to basic PCR techniques have been developed, including but not limited to anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). In the amplification reaction, the primer pair must anneal to the opposite strands of the template nucleic acid and should be kept at an appropriate distance from each other so that the polymerase can efficiently polymerize across regions and so that the amplification product can be easily detected, for example, by electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to facilitate the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9–30, 40, or 50 nucleotides in length (e.g., lengths of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides), but oligonucleotide primers can be longer or shorter, provided appropriate amplification conditions are used.
[0067] Detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label," when referring to nucleic acids, is intended to include both direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent that has directly labeled the detectable substance. Detectable substances include a variety of enzymes, cofactors, fluorescent materials, cryoluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable cofactor complexes include avidin / streptocin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, luciferin, luciferin isothiocyanate, rhodamine, dichlorotriazineamine luciferin, dansyl chloride, or phycoerythrin; examples of cryoluminescent materials include luminol; and examples of bioluminescent materials include luciferase, insect luciferin, and jellyfish protein. Examples of indirect labeling include end-labeling of nucleic acids with biotin, making the nucleic acid detectable using fluorescently labeled avidin streptavidin.
[0068] Overview On one hand, this application provides a composition for in vitro detection of colorectal cancer, the composition comprising nucleic acid for detecting the methylation status of a target sequence of a target gene, wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene and C9orf50 gene.
[0069] This application provides a set of target sequences for target genes that emit abnormal methylation in colorectal cancer. The target genes are selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene, and C9orf50 gene. The target sequence of the MSC gene is a sequence shown in any one of SEQ ID NOs: 1-4 or contains any one of SEQ ID NOs: 1-4; and / or the target sequence of the FOXE1 gene is a sequence shown in any one of SEQ ID NOs: 5-8 or contains any one of SEQ ID NOs: 5-8; and / or the target sequence of the GDF6 gene is a sequence shown in any one of SEQ ID NOs: 9-12 or contains any one of SEQ ID NOs: 9-12; and / or the target sequence of the C9orf50 gene is a sequence shown in any one of SEQ ID NOs: 13-16 or contains any one of SEQ ID NOs: 13-16.
[0070] Those skilled in the art will understand that the target sequences of the MSC gene, FOXE1 gene, GDF6 gene, and C9orf50 gene are not limited to the specific sequences listed above. The target sequences of the MSC gene should encompass sequences that, compared to any one of the sequences shown in SEQ ID NOs: 1-4, contain one, two, or three or more nucleotide mutations, but are substantially functionally identical, and also include sequences with 95%, 96%, 97%, 98%, or 99% sequence identity compared to any one of the sequences shown in SEQ ID NOs: 1-4. The target sequences of the FOXE1 gene should encompass sequences that, compared to any one of the sequences shown in SEQ ID NOs: 5-8, contain one, two, or three or more nucleotide mutations, but are substantially functionally identical, and also include sequences with 95%, 96%, 97%, 98%, or 99% sequence identity compared to any one of the sequences shown in SEQ ID NOs: 5-8. The target sequence of the GDF6 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs: 9-12, but still substantially functionally identical, and also include sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs: 9-12. The target sequence of the C9orf50 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NOs: 13-16, but still substantially functionally identical, and also include sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs: 13-16.
[0071] The nucleotide sequence (5'-3') of the MSC gene is as follows: GTAACTGGAAGCCAGCCGGAGCGTGTCCAGCTTGGAGAGCTTAGTGTCGGGGGGCACCCAGGGCAGGCTGGTCTTGAGCCTGGAGAAGGCTTTGCTCAGCACGCGCATCCGGGCACGCTCACGGGCGTTGGCCGCGTTCCGCTGCGACTGCTTGCACTCTGCGGCTGAGCCCTTGGCCGGGAGGGGCTTCTTGCCACCACCGCCCGCGCTACCACCTGCGCCGCCGCCCCCAGCCACACGGGGCCGCTTCCTCTTGCAGCCTTCCGCGCTGCCGGCTGTGCCCAGAGCGCAGCGCTCCTCCTCGCCGTCGGGGTCCTCCTCCTCTGCCGACGAGTTGTCACTGGGCGAGGCGTAGCTGCGCTCTACGCCGCGGAGGGGCGGCCTCTTGGAGGCGGGGACCGGGTACTCCCGCTGCAGCCCCCGAAGCTCCATCTCCTCCGGATCACTCACCGAGCCCGTGGACATCCCGTTGTCCCCCTTGCCCACACGCGTCCTCTTTCCTCCCCCCTGGCCAGTCTCGCTGTCTCCGCCTTCCGCTCCCTGGCGGAGGCGGAGGCCAGAGAGCGCTCCAAGGAAGACTAAAAACCCAGGCCGGGAAGCGCGGGGTGAGAAAGCGAGGTGGGTGGCGAGAGCGTGAGCGCCCCTCTGCTGACCCCGGGGAGCGTGGACTACGAGTTGGCGCCCAAGTCCAGAATCCGCGCGCACCGCGGTAAGCTGCGCCTTTTGAAAAGGCTATCTGTACTCCTTGGAACAAACCACCCCGGGCAAAGAAGAGGGGGTTGTAAAGGGGGCCAAGAGGTGGGGCAGGGGCGTGGAAGGG The nucleotide sequence of the MSC gene after bisulfite treatment (5'-3') is as follows: GTAATTGGAAGTTAGTCGGAGCGTGTTTAGTTTGGAGAGTTTAGTGTCGGGGGGTATTTAGGGTAGGTTGGTTTTGAGTTTGGAGAAGGTTTTGTTTAGTACGCGTATTCGGGTACGTTTACGGGCGTTGGTCGCGTTTCGTTGCGATTGTTTGTATTTTGCGGTTGAGTTTTTGGTCGGGAGGGGTTTTTTGTTATTATCGTTCGCGTTATTATTTGCGTCGTCGTTTTTAGTTATACGGGGTCGTTTTTTTTTGTAGTTTTTCGCGTTGTCGGTTGTGTTTAGAGCGTAGCGTTTTTTTTCGTCGTCGGGGTTTTTTTTTTTTGTCGACGAGTTGTTATTGGGCGAGGCGTAGTTGCGTTTTACGTCGCGGAGGGGCGGTTTTTTGGAGGCGGGGATCGGGTATTTTCGTTGTAGTTTTCGAAGTTTTATTTTTTTCGGATTATTTATCGAGTTCGTGGATATTTCGTTGTTTTTTTTGTTTATACGCGTTTTTTTTTTTTTTTTTTGGTTAGTTTCGTTGTTTTCGTTTTTCGTTTTTTGGCGGAGGCGGAGGTTAGAGAGCGTTTTAAGGAAGATTAAAAATTTAGGTCGGGAAGCGCGGGGTGAGAAAGCGAGGTGGGTGGCGAGAGCGTGAGCGTTTTTTTGTTGATTTCGGGGAGCGTGGATTACGAGTTGGCGTTTAAGTTTAGAATTCGCGCGTATCGCGGTAAGTTGCGTTTTTTGAAAAGGTTATTTGTATTTTTTGGAATAAATTATTTCGGGTAAAGAAGAGGGGGTTGTAAAGGGGGTTAAGAGGTGGGGTAGGGGCGTGGAAGGG The reverse complementary sequence (5'-3') of the nucleotide sequence of the MSC gene is as follows: CCCTTCCACGCCCCTGCCCCACCTCTTGGCCCCCTTTACAACCCCCTCTTCTTTGCCCGGGGTGGTTTGTTCCAAGGAGTACAGATAGCCTTTTCAAAAGGCGCAGCTTACCGCGGTGCGCGCGGATTCTGGACTTGGGCGCCAACTCGTAGTCCACGCTCCCCGGGGTCAGCAGAGGGGCGCTCACGCTCTCGCCACCCACCTCGCTTTCTCACCCCGCGCTTCCCGGCCTGGGTTTTTAGTCTTCCTTGGAGCGCTCTCTGGCCTCCGCCTCCGCCAGGGAGCGGAAGGCGGAGACAGCGAGACTGGCCAGGGGGGAGGAAAGAGGACGCGTGTGGGCAAGGGGGACAACGGGATGTCCACGGGCTCGGTGAGTGATCCGGAGGAGATGGAGCTTCGGGGGCTGCAGCGGGAGTACCCGGTCCCCGCCTCCAAGAGGCCGCCCCTCCGCGGCGTAGAGCGCAGCTACGCCTCGCCCAGTGACAACTCGTCGGCAGAGGAGGAGGACCCCGACGGCGAGGAGGAGCGCTGCGCTCTGGGCACAGCCGGCAGCGCGGAAGGCTGCAAGAGGAAGCGGCCCCGTGTGGCTGGGGGCGGCGGCGCAGGTGGTAGCGCGGGCGGTGGTGGCAAGAAGCCCCTCCCGGCCAAGGGCTCAGCCGCAGAGTGCAAGCAGTCGCAGCGGAACGCGGCCAACGCCCGTGAGCGTGCCCGGATGCGCGTGCTGAGCAAAGCCTTCTCCAGGCTCAAGACCAGCCTGCCCTGGGTGCCCCCCGACACTAAGCTCTCCAAGCTGGACACGCTCCGGCTGGCTTCCAGTTAC The reverse complementary sequence of the nucleotide sequence of the MSC gene after bisulfite treatment (5'-3') is as follows: TTTTTTTACGTTTTTGTTTTATTTTTTGGTTTTTTTTATAATTTTTTTTTTTTTGTTCGGGGTGGTTTGTTTTAAGGAGTATAGATAGTTTTTTTAAAAGGCGTAGTTTATCGCGGTGCGCGCGGATTTTGGATTTGGGCGTTAATTCGTAGTTTACGTTTTTCGGGGTTAGTAGAGGGGCGTTTACGTTTTCGTTATTTATTTCGTTTTTTTATTTCGCGTTTTTCGGTTTGGGTTTTTAGTTTTTTTTGGAGCGTTTTTTGGTTTTCGTTTTCGTTAGGGAGCGGAAGGCGGAGATAGCGAGATTGGTTAGGGGGGAGGAAAGAGGACGCGTGTGGGTAAGGGGGATAACGGGATGTTTACGGGTTCGGTGAGTGATTCGGAGGAGATGGAGTTTCGGGGGTTGTAGCGGGAGTATTCGGTTTTCGTTTTTAAGAGGTCGTTTTTTCGCGGCGTAGAGCGTAGTTACGTTTCGTTTAGTGATAATTCGTCGGTAGAGGAGGAGGATTTCGACGGCGAGGAGGAGCGTTGCGTTTTGGGTATAGTCGGTAGCGCGGAAGGTTGTAAGAGGAAGCGGTTTCGTGTGGTTGGGGGCGGCGGCGTAGGTGGTAGCGCGGGCGGTGGTGGTAAGAAGTTTTTTTCGGTTAAGGGTTTAGTCGTAGAGTGTAAGTAGTCGTAGCGGAACGCGGTTAACGTTCGTGAGCGTGTTCGGATGCGCGTGTTGAGTAAAGTTTTTTTTAGGTTTAAGATTAGTTTGTTTTGGGTGTTTTTCGATATTAAGTTTTTTAAGTTGGATACGTTTCGGTTGGTTTTTAGTTAT The nucleotide sequence (5'-3') of the FOXE1 gene is as follows: CCCCCGACAGCCGCGGGGATCCAGAGCCCGGGGGTGCGGGACGCCCGCGCCATGACTGCCGAGAGCGGGCCGCCGCCGCCGCAGCCGGAGGTGCTGGCTACCGTGAAGGAAGAGCGCGGCGAGACGGCAGCAGGGGCCGGGGTCCCAGGGGAGGCCACGGGCCGCGGGGCGGGCGGGCGGCGCCGCAAGCGCCCCCTGCAGCGCGGGAAGCCGCCCTACAGCTACATCGCGCTCATCGCCATGGCCATCGCGCACGCGCCCGAGCGCCGCCTCACGCTGGGCGGCATCTACAAGTTCATCACCGAGCGCTTCCCCTTCTACCGCGACAACCCCAAAAAGTGGCAGAACAGCATCCGCCACAACCTCACACTCAACGACTGCTTCCTCAAGATCCCGCGCGAGGCCGGCCGCCCGGGTAAGGGCAAC The nucleotide sequence of the FOXE1 gene after bisulfite treatment (5'-3') is as follows: TTTTCGATAGTCGCGGGGATTTAGAGTTCGGGGGTGCGGGACGTTCGCGTTATGATTGTCGAGAGCGGGTCGTCGTCGTCGTAGTCGGAGGTGTTGGTTATCGTGAAGGAAGAGCGCGGCGAGACGGTAGTAGGGGTCGGGGTTTTAGGGGAGGTTACGGGTCGCGGGGCGGGCGGGCGGCGTCGTAAGCGTTTTTTGTAGCGCGGGAAGTCGTTTTATAGTTATATCGCGTTTATCGTTATGGTTATCGCGTACGCGTTCGAGCGTCGTTTTACGTTGGGCGGTATTTATAAGTTTATTATCGAGCGTTTTTTTTTTTATCGCGATAATTTTAAAAAGTGGTAGAATAGTATTCGTTATAATTTTATATTTAACGATTGTTTTTTTAAGATTTCGCGCGAGGTCGGTCGTTCGGGTAAGGGTAAT The reverse complementary sequence (5'-3') of the nucleotide sequence of the FOXE1 gene is as follows: GTTGCCCTTACCCGGGCGGCCGGCCTCGCGCGGGATCTTGAGGAAGCAGTCGTTGAGTGTGAGGTTGTGGCGGATGCTGTTCTGCCACTTTTTGGGGTTGTCGCGGTAGAAGGGGAAGCGCTCGGTGATGAACTTGTAGATGCCGCCCAGCGTGAGGCGGCGCTCGGGCGCGTGCGCGATGGCCATGGCGATGAGCGCGATGTAGCTGTAGGGCGGCTTCCCGCGCTGCAGGGGGCGCTTGCGGCGCCGCCCGCCCGCCCCGCGGCCCGTGGCCTCCCCTGGGACCCCGGCCCCTGCTGCCGTCTCGCCGCGCTCTTCCTTCACGGTAGCCAGCACCTCCGGCTGCGGCGGCGGCGGCCCGCTCTCGGCAGTCATGGCGCGGGCGTCCCGCACCCCCGGGCTCTGGATCCCCGCGGCTGTCGGGGG The reverse complementary sequence of the nucleotide sequence of the FOXE1 gene after bisulfite treatment (5'-3') is as follows: GTTGTTTTTATTCGGGCGGTCGGTTTCGCGCGGGATTTTGAGGAAGTAGTCGTTGAGTGTGAGGTTGTGGCGGATGTTGTTTTGTTATTTTTTGGGGTTGTCGCGGTAGAAGGGGAAGCGTTCGGTGATGAATTTGTAGATGTCGTTTAGCGTGAGGCGGCGTTCGGGCGCGTGCGCGATGGTTATGGCGATGAGCGCGATGTAGTTGTAGGGCGGTTTTTCGCGTTGTAGGGGGCGTTTGCGGCGTCGTTCGTTCGTTTCGCGGTTCGTGGTTTTTTTTGGGATTTCGGTTTTTGTTGTCGTTTCGTCGCGTTTTTTTTTTACGGTAGTTAGTATTTTCGGTTGCGGCGGCGGCGGTTCGTTTTCGGTAGTTATGGCGCGGGCGTTTCGTATTTTCGGGTTTTGGATTTTCGCGGTTGTCGGGGG The nucleotide sequence of the GDF6 gene (5'-3') is as follows: GCGGTTGCTGGGGTCCCCGCGCGCGCCTCGGCCTCCCCGGCGTCCAGCTCGCCCCATGCGGCCCGCAGCTCCAAGCACAGCTGCTTCCAGGGCTGGTGGCGCAGGCCCTGCCACACGTCGAAGACTTCCCAGCCGGCCGGCGGCGCCCCCTGCGGGTCCAGGGTCCGCGCGTCCAGCAGTAGGGGCG AAAGGCAAGGGAAGAGCTGCACGTGGAGCGGCCCGGCTGGTGGCCCCCAGGGCGCTGAGGGCGCCTGGCGAAAGAGCCGCAGCTCCGCGCCCACCAGCTCTTCTTTGTCTGAGAGCATGGACACATCAAACAAATACTTCTGTCTCCGGAGAGGAGTGTGCGAGAGATCGTCTGCGAGATAAAAAATAAT The nucleotide sequence of the GDF6 gene after bisulfite treatment (5'-3') is as follows: GCGGTTGTTGGGGTTTTCGCGCGCGCGTTTCGGTTTTTTCGGCGTTTAGTTCGTTTTATGCGGTTCGTAGTTTTAAGTATAGTTGTTTTTAGGGTTGGTGGCGTAGGTTTTGTTATACGTCGAAGATTTTTTAGTCGGTCGGCGGCGTTTTGCGGGTTTAGGGTTCGCGCGTTTAGTAGTAGGGGCG AAAGGTAAGGGAAGAGTTGTACGTGGAGCGGTTCGGTTGGTGGTTTTTAGGGCGTTGAGGGCGTTTGGCGAAAGAGTCGTAGTTTCGCGTTTATTAGTTTTTTTTTGTTTTGAGAGTATGGATATATTAAATAAATATTTTTGTTTTCGGAGAGGAGTGTGCGAGAGATCGTTTGCGAGATAAAAAATAAT The reverse complementary sequence (5'-3') of the nucleotide sequence of the GDF6 gene is as follows: ATTATTTTTTATCTCGCAGACGATCTCTCGCACACTCCTCTCCGGAGACAGAAGTATTTGTTTGATGTGTCCATGCTCTCAGACAAAGAAGAGCTGGTGGGCGCGGAGCTGCGGCTCTTTCGCCAGGCGCCCTCAGCGCCCTGGGGGCCACCAGCCGGGCCGCTCCACGTGCAGCTCTTCCCTTGCCTTTCGCCCCTACTGCTGGACGCGCGGACCCTGGACCCGCAGGGGGCGCCGCCGGCCGGCTGGGAAGTCTTCGACGTGTGGCAGGGCCTGCGCCACCAGCCCTGGAAGCAGCTGTGCTTGGAGCTGCGGGCCGCATGGGGCGAGCTGGACGCCGGGGAGGCCGAGGCGCGCGCGCGGGGACCCCAGCAACCGC The reverse complementary sequence of the nucleotide sequence of the GDF6 gene after bisulfite treatment (5'-3') is as follows: ATTATTTTTTATTTCGTAGACGATTTTTCGTATATTTTTTTTCGGAGATAGAAGTATTTGTTTGATGTGTTTATGTTTTTAGATAAAGAAGAGTTGGTGGGCGCGGAGTTGCGGTTTTTTCGTTAGGCGTTTTTAGCGTTTTGGGGGTTATTAGTCGGGTCGTTTTACGTGTAGTTTTTTTTTTGTTTTTCGTTTTTATTGTTGGACGCGCGGATTTTGGATTCGTAGGGGGCGTCGTCGGTCGGTTGGGAAGTTTTCGACGTGTGGTAGGGTTTGCGTTATTAGTTTTGGAAGTAGTTGTGTTTGGAGTTGCGGGTCGTATGGGGCGAGTTGGACGTCGGGGAGGTCGAGGCGCGCGCGCGGGGATTTTAGTAATCGT The nucleotide sequence of the C9orf50 gene (5'-3') is as follows: CCGCGGGGCCTCACTCAGTGGCTCCGGCTCCTCGGCGCACTTCTCCTGGAGCTGGTGCAGGAACTCACGGAACCTGCTGGGGAGGAGCTCTCCTAGGAAGGCGCCCAAGAAGTCGGGGTCCTCCCTGGCCACGCGCCTCCGGGGGCGCTCGCGCTCTCCAGGCCCTGGCTGCCTGGGCGCCGATTCCCGGGACGCGCCGGCCGACAGCAGGGGAGGCGGCAGCAGGGACCGCAGCAGCCCCCGCTTCCGCACGGCCCGCCGGGTCGCGGTGAGCAAGGCGGGCAGGCGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGCGCCGCCCCCCGGGATCCTCCAGTCCCCGGAGCCCCGCGCGCCCAGAGCCGCTCGGAGCGCGGGCGGGGTCAGCTTGGGCAGCCGCGGGTCGCTGCTGCGTCGGAAGTCTCCGTCGCCAGGGAGCCCCTTGGGCGCCAGGTCCTGGGCCCCTGGGCGAAGTCGACGCCAGAACATGCTTGGCCCCGCACTCAGCTCACCGCACCCTCAGCGCGCGTGGGTGGGGGGCGCCGGCTGAGGTGGGGAGGGCATAGTCCAGCCCCAGGCCATAGTGCCCCGGGCGGGGCAGCGCGGTGCGGGGTGAACGCCACCGGCCCGGCGGACAGCGAGTGGC The nucleotide sequence of the C9orf50 gene after bisulfite treatment (in the 5'-3' direction) is as follows: TCGCGGGGTTTTATTTAGTGGTTTCGGTTTTTCGGCGTATTTTTTTTGGAGTTGGTGTAGGAATTTACGGAATTTGTTGGGGAGGAGTTTTTTTAGGAAGGCGTTTAAGAAGTCGGGGTTTTTTTTGGTTACGCGTTTTCGGGGGCGTTCGCGTTTTTTAGGTTTTGGTTGTTTGGGCGTCGATTTTCGGGACGCGTCGGTCGATAGTAGGGGAGGCGGTAGTAGGGATCGTAGTAGTTTTCGTTTTCGTACGGTTCGTCGGGTCGCGGTGAGTAAGGCGGGTAGGCGCGGCGGGAGGCGTTCGACGTTTATTTCGGGTTTGGCGTTTTTTTTCGGTTATTACGCGGCGTCGTTTTTCGGGATTTTTTAGTTTTCGGAGTTTCGCGCGTTTAGAGTCGTTCGGAGCGCGGGCGGGGTTAGTTTGGGTAGTCGCGGGTCGTTGTTGCGTCGGAAGTTTTCGTCGTTAGGGAGTTTTTTGGGCGTTAGGTTTTGGGTTTTTGGGCGAAGTCGACGTTAGAATATGTTTGGTTTCGTATTTAGTTTATCGTATTTTTAGCGCGCGTGGGTGGGGGGCGTCGGTTGAGGTGGGGAGGGTATAGTTTAGTTTTAGGTTATAGTGTTTCGGGCGGGGTAGCGCGGTGCGGGGTGAACGTTATCGGTTCGGCGGATAGCGAGTGGT The reverse complementary sequence (5'-3') of the nucleotide sequence of the C9orf50 gene is as follows: GCCACTCGCTGTCCGCCGGGCCGGTGGCGTTCACCCCGCACCGCGCTGCCCCGCCCGGGGCACTATGGCCTGGGGCTGGACTATGCCCTCCCCACCTCAGCCGGCGCCCCCCACCCACGCGCGCTGAGGGTGCGGTGAGCTGAGTGCGGGGCCAAGCATGTTCTGGCGTCGACTTCGCCCAGGGGCCCAGGACCTGGCGCCCAAGGGGCTCCCTGGCGACGGAGACTTCCGACGCAGCAGCGACCCGCGGCTGCCCAAGCTGACCCCGCCCGCGCTCCGAGCGGCTCTGGGCGCGCGGGGCTCCGGGGACTGGAGGATCCCGGGGGGCGGCGCCGCGTGGTGGCCGGAAGGGGACGCCAAGCCCGGGGTGGGCGTCGGACGCCTCCCGCCGCGCCTGCCCGCCTTGCTCACCGCGACCCGGCGGGCCGTGCGGAAGCGGGGGCTGCTGCGGTCCCTGCTGCCGCCTCCCCTGCTGTCGGCCGGCGCGTCCCGGGAATCGGCGCCCAGGCAGCCAGGGCCTGGAGAGCGCGAGCGCCCCCGGAGGCGCGTGGCCAGGGAGGACCCCGACTTCTTGGGCGCCTTCCTAGGAGAGCTCCTCCCCAGCAGGTTCCGTGAGTTCCTGCACCAGCTCCAGGAGAAGTGCGCCGAGGAGCCGGAGCCACTGAGTGAGGCCCCGCGG The reverse complementary sequence of the nucleotide sequence of the C9orf50 gene after bisulfite treatment (5'-3') is as follows: GTTATTCGTTGTTCGTCGGGTCGGTGGCGTTTATTTCGTATCGCGTTGTTTCGTTCGGGGTATTATGGTTTGGGGTTGGATTATGTTTTTTTTATTTTAGTCGGCGTTTTTTATTTACGCGCGTTGAGGGTGCGGTGAGTTGAGTGCGGGGTTAAGTATGTTTTGGCGT CGATTTCGTTTAGGGGTTTAGGATTTGGCGTTTAAGGGGTTTTTTGGCGACGGAGATTTTCGACGTAGTAGCGATTCGCGGTTGTTTAAGTTGATTTCGTTCGCGTTTCGAGCGGTTTTGGGCGCGGGGTTTCGGGGATTGGAGGATTTCGGGGGGCGGCGTCGCGTG GTGGTCGGAAGGGGACGTTAAGTTCGGGGTGGGCGTCGGACGTTTTTCGTCGCGTTTGTTCGTTTTGTTTATCGCGATTCGGCGGGTCGTGCGGAAGCGGGGGTTGTTGCGGTTTTTGTTGTCGTTTTTTGTTGTCGGTCGGCGCGTTTCGGGAATCGGCGTTTAGGT AGTTAGGGTTTGGAGAGCGCGAGCGTTTTCGGAGGCGCGTGGTTAGGGAGGATTTCGATTTTTTGGGCGTTTTTTTAGGAGAGTTTTTTTTTAGTAGGTTTCGTGAGTTTTTGTATTAGTTTTAGGAGAAGTGCGTCGAGGAGTCGGAGTTATTGAGTGAGGTTTCGCGG Table 1: Target sequences of each gene
[0072] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the bisulfite-converted sequence of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.
[0073] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene under moderately or strictly controlled conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene after bisulfite transformation under moderately or strictly controlled conditions, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.
[0074] Preferably, the composition further includes a reagent for converting the 5-position unmethylated cytosine base of the target sequence of the target gene into uracil. More preferably, the reagent is a bisulfite.
[0075] Nucleic acids used to detect the methylation status of a target gene may also include blocking agents that preferentially bind to DNA in an unmethylated state.
[0076] Preferably, the composition includes one or more primers and probes as shown in Table 2.
[0077] Table 2 Primer and probe sequences used in this application
[0078] In Table 2, "F" represents the forward primer; "R" represents the reverse primer; and "P" represents the probe. Preferably, the fluorescent labeling methods of the probes and blocking agent sequences used in this application are shown in Table 3.
[0079] Table 3. One fluorescent labeling method for the probe sequences used in this application.
[0080] In some embodiments, the composition further includes a reagent for converting the unmethylated cytosine base at position 5 of a gene into uracil. Preferably, this reagent is a bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because it has the same base-pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most common method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted into uracil, which corresponds to thymine in its pairing behavior; however, under these conditions, 5-methylcytosine remains unmodified. The original DNA is thus transformed in this way, making 5-methylcytosine, which was previously indistinguishable from cytosine in its hybridization behavior, now detectable as the only remaining cytosine by conventional known molecular biology techniques, such as amplification and hybridization. All these techniques, based on different base-pairing properties, can now be fully utilized. Therefore, typically, this application provides the combined use of bisulfite techniques with one or more methylation assays to determine the methylation status of a CpG dinucleotide sequence within a target sequence of a target gene. Furthermore, the methods of this application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or feces. Therefore, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or extent) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered as referring to a value reflecting the methylation status of a CpG dinucleotide sequence.
[0081] On the other hand, this application provides oligonucleotides for in vitro detection of colorectal cancer, comprising fragments of at least 9 nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or their complementary sequences and containing at least one CpG dinucleotide sequence; or fragments of at least 9 nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or their complementary sequences and containing at least one CpG dinucleotide sequence; or fragments of at least 9 nucleotides of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or their complementary sequences and containing at least one CpG dinucleotide sequence; or fragments of at least 9 nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or their complementary sequences and containing at least one CpG dinucleotide sequence.
[0082] Preferably, the oligonucleotide for in vitro detection of colorectal cancer comprises: a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or their complementary sequences; or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 or their complementary sequences; or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12 or their complementary sequences; or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 or their complementary sequences.
[0083] The oligonucleotide for in vitro detection of colorectal cancer of this application further comprises: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or their complementary sequences, and containing at least one CpG dinucleotide sequence; a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 or their complementary sequences, and containing at least one CpG dinucleotide sequence; a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16. A fragment consisting of at least 15 nucleotides of 16 or its complementary sequence and containing at least one CpG dinucleotide sequence.
[0084] Preferably, the oligonucleotide for in vitro detection of colorectal cancer comprises: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence resulting from bisulfite conversion of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence resulting from bisulfite conversion of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence resulting from bisulfite conversion of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or a fragment hybridized under moderately or strictly controlled conditions to a sequence resulting from bisulfite conversion of SEQ ID NO: 13, SEQ ID NO: 14, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or a fragment hybridized under moderately or strictly controlled conditions to a sequence resulting from bisulfite conversion of SEQ ID NO: 13, SEQ ID NO: 14, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or a fragment hybridized under moderately or strictly controlled conditions to a sequence resulting from bisulfite conversion of SEQ ID NO: 13, SEQ ID NO: 14, or their complementary sequences, and containing at least one CpG dinucleotide sequence. A fragment of at least 15 nucleotides in the bisulfite-converted sequence of SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 or their complementary sequence and containing at least one CpG dinucleotide sequence.
[0085] In one specific embodiment of this application, the oligonucleotide for in vitro detection of colorectal cancer includes the sequences of SEQ ID NO: 17 and SEQ ID NO: 18. It also includes the sequence of SEQ ID NO: 19.
[0086] In one specific embodiment of this application, the oligonucleotide for in vitro detection of colorectal cancer includes the sequences of SEQ ID NO: 20 and SEQ ID NO: 21. It also includes the sequence of SEQ ID NO: 22.
[0087] In one specific embodiment of this application, the oligonucleotide for in vitro detection of colorectal cancer includes the sequences of SEQ ID NO: 23 and SEQ ID NO: 24. It also includes the sequence of SEQ ID NO: 25.
[0088] In one specific embodiment of this application, the oligonucleotide for in vitro detection of colorectal cancer includes the sequences of SEQ ID NO: 26 and SEQ ID NO: 27. It also includes the sequence of SEQ ID NO: 28.
[0089] On the other hand, this application provides a kit comprising the aforementioned composition. The kit further comprises at least one other component selected from: nucleoside triphosphate, DNA polymerase, and a buffer required for the function of the DNA polymerase.
[0090] Typically, the kit also includes a container for holding the patient's biological sample. Furthermore, the kit also includes instructions for using and interpreting the test results.
[0091] This application also relates to the use of the above-described composition and oligonucleotides in the preparation of a kit for the in vitro detection of colorectal cancer.
[0092] This application also relates to the use of one or more genes selected from the MSC gene, FOXE1 gene, GDF6 gene and C9orf50 gene in the preparation of a kit for in vitro detection of colorectal cancer.
[0093] The MSC gene encodes a protein that is a transcriptional repressor capable of binding to E2A E-box elements in vitro in homodimer or heterodimer form. The encoded protein also forms a heterodimer with the E2A protein in vivo. This protein can inhibit the transactivation of E47 (an E2A protein) in mammalian cells. This gene is a downstream target of the B cell receptor signaling pathway.
[0094] The FOXE1 gene encodes a protein belonging to the winged helix transcription factor family. Members of this family contain a conserved 100-amino acid DNA-binding winged helix domain. The encoded protein functions as a thyroid transcription factor, involved in thyroid morphogenesis. Mutations in this gene are associated with susceptibility to Bamforth-Lazarus syndrome and non-medullary thyroid carcinoma.
[0095] The GDF6 gene encodes a secretory ligand of the TGF-β (transforming growth factor-β) protein superfamily. Ligands in this family can bind to various TGF-β receptors, thereby recruiting and activating SMAD family transcription factors to regulate gene expression. The encoded preprotein undergoes proteolytic treatment to generate disulfide-linked homodimer subunits. This protein is essential for the normal formation of certain bones and joints in the limbs, skull, and axial skeleton. Mutations in this gene are associated with Krippel-Fair syndrome, microphthalmia, and Leber congenital amaurosis.
[0096] The C9orf50 gene is located on chromosome 9 of the human genome. The function of the protein it encodes is not fully understood, but current research suggests that this gene may participate in cell regeneration regulation through interaction with endogenous retroviral (ERV) elements.4 In tumor-related research, abnormal expression or epigenetic modifications of C9orf50 (such as methylation status detection) may become potential directions for cancer biomarker screening.
[0097] Furthermore, this application provides a method for in vitro detection of colorectal cancer, the method comprising the following steps: 1) Isolate the target sequence or fragment of the target gene from the biological sample to be tested; 2) Determine the methylation status of the target sequence of the target gene; 3) The state of biological samples is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of colorectal cancer.
[0098] According to certain preferred embodiments, the method further includes the following steps: 1) Extract genomic DNA from the biological sample to be tested; 2) Treat the DNA sample obtained in step 1) with reagents to convert the 5-position unmethylated cytosine base into uracil or other bases. That is, the 5-position unmethylated cytosine base in the target sequence of the target gene is converted into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable. 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target sequence of the target gene, so that the target sequence of the treated target gene is amplified to produce an amplification product or is not amplified; if the target sequence of the treated target gene undergoes DNA polymerization, an amplification product will be produced; if the target sequence of the treated target gene does not undergo DNA polymerization, it will not be amplified. 4) Detect the amplification products using probes; and 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.
[0099] Preferably, the primers typically comprise fragments of the target sequence of the target gene, the target sequence fragment comprising fragments that are equivalent to, complementary to, or hybridize under moderate or severe conditions to at least 9 nucleotides selected from any one of SEQ ID NOs: 1-4; or fragments selected from any one of SEQ ID NOs: 5-8; fragments selected from any one of SEQ ID NOs: 9-12; or fragments selected from any one of SEQ ID NOs: 13-16.
[0100] Preferably, a typical probe comprises a fragment of the target sequence of the target gene, the fragment of the target sequence comprising a fragment that is equivalent to, complementary to, or hybridizes under moderate or severe conditions to at least 15 nucleotides selected from any one of SEQ ID NOs: 1-4; or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs: 5-8; a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs: 9-12; or a fragment of at least 15 nucleotides selected from any one of SEQ ID NOs: 13-16.
[0101] Preferably, one or more of the primers and probes are as shown in Table 2 above.
[0102] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.
[0103] Preferably, PCR is used to determine methylation status. Methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of a target gene. Among these, fluorescence-based real-time PCR is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers with overlapping known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence detection amplification level. The fluorescence-based real-time PCR assay can be used as a quantitative test for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe overlapping a specific CpG dinucleotide. A no-offset control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters the annealed TaqMan probe. The Taq polymerase 5' to 3' endonuclease activity then replaces the TaqMan probe by digesting it, releasing the fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that is no longer quenched. Typical reagents used for fluorescence-based real-time PCR analysis may include, but are not limited to: target sequence PCR primers for the target gene; nonspecific amplification blocking agents; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.
[0104] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By utilizing real-time PCR to analyze DNA in biological samples, the methylation status of the target sequence of the target gene can be conveniently detected, and the positivity of the tested sample can be quickly and easily determined based on the critical Ct value of the PCR reaction. Therefore, this provides a non-invasive and rapid in vitro detection method for colorectal cancer.
[0105] The biological sample is selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof. Plasma is the preferred biological sample.
[0106] This application provides a methylation marker for in vitro esophageal cancer minimal residual disease, wherein the methylation marker is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene and C9orf50 gene; Preferably, the target sequence of the MSC gene is a sequence as shown in any one of SEQ ID NOs: 1-4 or contains a sequence as shown in any one of SEQ ID NOs: 1-4; and / or The target sequence of the FOXE1 gene is a sequence shown in any one of SEQ ID NOs: 5-8 or contains a sequence shown in any one of SEQ ID NOs: 5-8; and / or The target sequence of the GDF6 gene is a sequence shown in any one of SEQ ID NOs: 9-12 or contains a sequence shown in any one of SEQ ID NOs: 9-12; and / or The target sequence of the C9orf50 gene is a sequence shown in any one of SEQ ID NOs: 13-16 or contains a sequence shown in any one of SEQ ID NOs: 13-16.
[0107] In this application, for a given sample, if the methylation status of one of the target genes is positive, the sample is judged as positive; if the methylation status of both target genes is negative, the sample is judged as negative.
[0108] In this application, no restrictions are placed on the interpretation of whether a sample is negative or positive. The interpretation can be made according to conventional standards in the field. For example, the interpretation can be made according to the size of the ct value of a target gene. For example, in this application, the ct value of the target gene channel is used to determine whether the sample is positive or negative. If ct < 45, it is positive.
[0109] Example This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.
[0110] Example 1 Primer and probe testing The DNA from normal human leukocyte cell lines is usually in a low / unmethylated state and can be used as a negative control. In this example, the amount of DNA used was 15.75 ng / reaction. Fully methylated DNA is in a high / fully methylated state and can be used as a positive control. In this example, the amount of DNA used was 200 pg / reaction. The DNA samples were first transformed with bisulfite. Using the transformed BisDNA as a template, real-time PCR amplification was performed using the primers and probes in Table 2. The β-actin (ACTB) gene was used as an internal control. β-actin gene amplicon was created by using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon was detected using a specific probe. Each sample underwent at least one real-time PCR. In some specific embodiments, two or three real-time PCR detections were performed. The PCR system for primer and probe testing is shown in Table 4 below.
[0111] Table 4. PCR system for primer and probe testing.
[0112] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0113] The PCR amplification program used was: 94℃, 20min; (93℃, 30s; 57℃, 35s—read fluorescence signal) 45 cycles; 40℃, 5s.
[0114] The results are shown in Table 5. As shown, when BisDNA of fully methylated DNA is used as a template, the MSC, FOXE1, GDF6 and C9orf50 genes can be effectively amplified; while when BisDNA of WBC is used as a template, except for the internal reference gene ACTB, the other target genes are not amplified.
[0115] Table 5. Results of primer and probe assays for MSC, FOXE1, GDF6, and C9orf50 genes.
[0116] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0117] Example 2 Sixteen colorectal cancer tissue samples (10 ng / reaction) and 16 normal human plasma samples (3.5 mL) were selected. Genomic DNA was extracted and converted to BisDNA using bisulfite. Methylation of the MSC, FOXE1, GDF6, and C9orf50 genes was detected according to the PCR reaction system in Table 6 and the reaction procedure in Example 1. Finally, the Ct values of real-time PCR for the target gene sequences of the 16 colorectal cancer tissue samples and 16 normal human plasma samples were measured. As shown in Tables 7 and 8, the sensitivities of detecting colorectal cancer tissues using MSC, FOXE1, GDF6, and C9orf50 genes individually were 87.50%, 81.25%, 87.50%, and 81.25%, respectively; a positive result for any single gene was interpreted as a positive result, and the final interpretation sensitivity reached 100%. This application uses the Ct values of MSC gene methylation, FOXE1 gene methylation, GDF6 gene methylation and C9orf50 gene methylation detection to calculate the Ct values. If any single marker of the four genes is less than 41, it is considered positive, and the other results are considered negative.
[0118] Table 6 PCR system with optimal primer combinations
[0119] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0120] Table 7. Detection of various genes in colorectal cancer tissue and normal human plasma
[0121] Table 8. Detection of various genes in colorectal cancer tissue and normal human plasma.
[0122] Example 3 Plasma samples (3.5 mL) from 68 pre-treatment colorectal cancer patients and 61 post-operative plasma samples (3.5 mL) from 61 patients with R0 resection colorectal cancer were selected. Genomic DNA was extracted and converted to BisDNA using bisulfite. Methylation detection was performed using the PCR reaction system described in Example 1, along with MSC, FOXE1, GDF6, and C9orf50 gene assays. The Ct values of real-time PCR for the target gene sequences were measured in both the 68 colorectal cancer plasma samples and the 61 post-operative plasma samples from R0 resection colorectal cancer patients. A positive result for any single gene was considered positive, and the remaining results were considered negative. The results are shown in Table 9. The sensitivities of individual detection of colorectal cancer using MSC, FOXE1, GDF6, and C9orf50 genes were 83.82%, 70.59%, 73.53%, and 77.94%, respectively; the overall sensitivity of the four genes reached 92.65%, and the specificity was 85.25%.
[0123] Table 9. Results of combined gene detection in cancer plasma and prognostic plasma samples of rectal cancer after R0 resection.
[0124] The above experimental results demonstrate that methylated DNA of the target gene sequence is a marker for colorectal cancer. By detecting methylated DNA of the target gene sequence according to this invention, we can assess whether residual cancer cells remain in a patient's body after treatment, thereby predicting the likelihood of disease recurrence, guiding subsequent treatment strategies, and improving patient survival rates.
[0125] In summary, this application utilizes the composition, nucleic acid sequence, kit, and their uses described above, as well as the detection method described above, to achieve in vitro detection of colorectal cancer using target sequence methylation biomarkers of target genes by detecting the methylated nucleic acid sequences of target gene fragments, thereby effectively improving the sensitivity and specificity of in vitro detection of rectal cancer.
[0126] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.
Claims
1. A composition for in vitro detection of colorectal cancer, said composition comprising: Nucleic acid used to detect the methylation status of a target gene. The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene. The target gene is selected from one or more of the MSC gene, FOXE1 gene, GDF6 gene, and C9orf50 gene.
2. The composition according to claim 1, wherein, The target sequence of the MSC gene is a sequence as shown in any one of SEQ ID NOs: 1-4 or contains a sequence as shown in any one of SEQ ID NOs: 1-4; and / or The target sequence of the FOXE1 gene is a sequence as shown in any one of SEQ ID NOs: 5-8 or contains a sequence as shown in any one of SEQ ID NOs: 5-8; and / or The target sequence of the GDF6 gene is a sequence as shown in any one of SEQ ID NOs: 9-12 or contains a sequence as shown in any one of SEQ ID NOs: 9-12; and / or The target sequence of the C9orf50 gene is a sequence as shown in any one of SEQ ID NOs: 13-16 or contains any one of SEQ ID NOs: 13-16.
3. The composition according to claim 1 or 2, wherein, The nucleic acids used to detect the methylation status of the target gene include: Primers, wherein the primers are fragments of at least 9 nucleotides from the target sequence of the target gene. The fragment contains at least one CpG dinucleotide sequence.
4. The composition according to any one of claims 1-3, wherein, The nucleic acids used to detect the methylation status of the target gene include: The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately or strictly controlled conditions. The fragment contains at least one CpG dinucleotide sequence.
5. The composition according to any one of claims 1-4, further comprising: A reagent that converts the 5th unmethylated cytosine base of the target sequence of a target gene into uracil.
6. The composition according to claim 3, wherein, The fragment of at least 9 nucleotides is a sequence as shown in SEQ ID NO: 17 and SEQ ID NO: 18, or a sequence as shown in SEQ ID NO: 20 and SEQ ID NO: 21, or a sequence as shown in SEQ ID NO: 23 and SEQ ID NO: 24, or a sequence as shown in SEQ ID NO: 26 and SEQ ID NO:
27.
7. The composition according to claim 4, wherein, The fragment of at least 15 nucleotides is a sequence as described in SEQ ID NO: 19, or a sequence as described in SEQ ID NO: 22, or a sequence as described in SEQ ID NO: 25, or a sequence as described in SEQ ID NO:
28.
8. An oligonucleotide for in vitro detection of colorectal cancer, comprising: A fragment consisting of at least 9 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or A fragment consisting of at least 9 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or their complementary sequence, and containing at least one CpG dinucleotide sequence; or Fragments comprising at least 9 nucleotides of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12, or their complementary sequences, and containing at least one CpG dinucleotide sequence; or A fragment of at least 9 nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or their complementary sequence and containing at least one CpG dinucleotide sequence.
9. The oligonucleotide according to claim 8, further comprising: A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or their complementary sequence under moderate or severe conditions and contains at least one CpG dinucleotide sequence; A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
10. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequences of SEQ ID NO: 17 and SEQ ID NO: 18.