Use of an inhibitor of lncrna hilar in the preparation of a drug for preventing or / and treating lung adenocarcinoma metastasis
By targeting and inhibiting HILAR with siRNA and shRNA molecules, combined with a vector delivery system, the problem of preventing and treating early micrometastasis of lung adenocarcinoma in existing technologies has been solved. This has achieved effective inhibition of lung adenocarcinoma cell invasion and metastasis, and improved the survival of animals.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are insufficient to effectively prevent and treat early micrometastases of lung adenocarcinoma. Imaging examinations and traditional tumor markers have limited sensitivity, and current treatments are not effective against lung adenocarcinoma metastases, lacking effective intervention strategies.
By using siRNA and shRNA molecules to target and inhibit the long non-coding RNA HILAR, and combining it with liposome, polymer nanoparticle or viral vector delivery systems, specific intervention on HILAR can be achieved, which significantly inhibits the invasion and metastasis of lung adenocarcinoma cells in in vitro and in vivo experiments.
In in vitro experiments, it significantly inhibited the invasive ability of lung adenocarcinoma cells, and in in vivo experiments, it effectively reduced the formation of lung metastases and improved the survival of animals. It achieved effective intervention in lung adenocarcinoma metastasis by delivering shRNA via an adeno-associated virus vector.
Smart Images

Figure CN122104691A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of medical technology, and more particularly to the use of inhibitors of lncRNA HILAR in the preparation of medicaments for the prevention and / or treatment of lung adenocarcinoma metastasis. Background Technology
[0002] Lung cancer is one of the leading causes of death and morbidity among malignant tumors worldwide, characterized by its high invasiveness and heterogeneity. Pathologically, lung cancer is mainly divided into two categories: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), with NSCLC accounting for the vast majority of clinical cases. Lung adenocarcinoma (LUAD) is the most prevalent histological subtype of NSCLC, and its high mortality rate is primarily due to the highly invasive and metastatic nature of its tumor cells. Notably, some patients develop undetectable distant micrometastases in the very early stages of the disease (T1-2 stage), which is a significant cause of postoperative recurrence and death.
[0003] Lung cancer metastasis is a complex biological process involving multiple steps and factors, including primary tumor cell detachment, stromal invasion, entry into the circulatory system, immune escape, distant organ colonization, and proliferation. Current diagnosis of lung cancer metastasis mainly relies on imaging examinations and traditional tumor markers; however, these methods have limited sensitivity in detecting micrometastases and early metastatic events, making it difficult to capture initial signals of metastatic potential at the molecular level. Furthermore, existing treatments, including surgical resection, chemotherapy, radiotherapy, and targeted therapy, remain less than ideal in controlling the progression of lung cancer metastasis, especially for very early-stage patients with micrometastases, where effective intervention strategies are lacking.
[0004] Long non-coding RNAs (lncRNAs) are a class of non-coding RNA molecules longer than 200 nucleotides. They regulate gene expression at the epigenetic, transcriptional, and post-transcriptional levels and participate in various biological processes such as cell proliferation, differentiation, migration, and apoptosis. Recent studies have found that aberrant expression of lncRNAs plays a crucial role in the development and progression of various malignant tumors, including non-sclerotic lung cancer (NSCLC). They can act as oncogenes promoting tumor progression or as tumor suppressor genes inhibiting the metastatic cascade. In the field of lung cancer metastasis, several lncRNAs have been shown to participate in regulating the metastatic process, and some molecules have shown potential as metastasis predictive biomarkers or therapeutic targets.
[0005] The long non-coding RNA transcript encoded by the antisense strand of the SOX21 gene, ENST00000438290.2 (Gene: ENSG00000227640.5), is located in the 13q32.1 region of chromosome 13. The transcript is approximately 3287 bp in length. To distinguish it from other transcripts of the SOX21 gene antisense strand, transcript ENSG00000227640.5 is named... Hypoxia-Induced LncRNA Antagonizing 15-PGDH Regulation (HILAR). Preliminary studies have shown that HILAR is abnormally expressed in various tumors, including lung cancer, suggesting that this molecule may affect tumor progression by regulating microRNAs or signaling pathways. However, its specific mechanism of action in lung adenocarcinoma metastasis, its clinical value, and its therapeutic potential for targeted intervention still lack systematic and in-depth research and experimental verification.
[0006] In conclusion, identifying novel lncRNAs associated with lung adenocarcinoma metastasis and developing treatments based on these lncRNAs is of significant clinical and scientific value for early warning and effective intervention in lung adenocarcinoma metastasis. Summary of the Invention
[0007] This invention aims to overcome the shortcomings of the prior art, and to this end, the following technical solution is adopted: A first aspect of the present invention is to provide an siRNA molecule for the prevention and / or treatment of lung adenocarcinoma metastasis, said siRNA molecule targeting and inhibiting the long non-coding RNA HILAR, the nucleotide sequence of said siRNA molecule being as follows: GAGGGAAUAAGGACAUUCUTT (sense, SEQ ID NO: 5) and AGAUGUCCUUAUUCCCUCTT (antisense, SEQ ID NO: 6).
[0008] A second aspect of the present invention is to provide an shRNA molecule for the prevention and / or treatment of lung adenocarcinoma metastasis, said shRNA molecule targeting and inhibiting the long non-coding RNA HILAR, said shRNA molecule having the following nucleotide sequence: GAGGGAATAAGGACATTCTTTCTCGAGAAAGAATGTCCTTATTCCCTCTTTTTT (SEQ ID NO: 9) or / and GCTGAGGTGAAGGTGTTTATTCTCGAGAATAAACACCTTCACCTCAGCTTTTTT (SEQ ID NO: 10).
[0009] A third aspect of the present invention is to provide a pharmaceutical composition for the prevention and / or treatment of lung adenocarcinoma metastasis, comprising: siRNA molecules as described above and / or shRNA molecules as described above.
[0010] Preferably, it further includes: a carrier.
[0011] Preferably, the carrier is selected from: liposomes, polymer nanoparticles, exosomes, or viral vectors.
[0012] A fourth aspect of the invention is the use of an inhibitor of the long non-coding RNA HILAR, a siRNA molecule as described above, a shRNA molecule as described above, or a pharmaceutical composition as described above in the preparation of a medicament for the prevention and / or treatment of lung adenocarcinoma metastasis.
[0013] Preferably, the lung adenocarcinoma is a T1-2 stage lung adenocarcinoma.
[0014] Compared with the prior art, the beneficial effects of this invention are reflected in: This invention provides a specific intervention method for HILAR and verifies its effectiveness in inhibiting lung adenocarcinoma metastasis: After using small interfering RNA technology to target and silence HILAR expression in vitro, the invasive ability of lung adenocarcinoma cells was significantly inhibited and the metastatic phenotype was significantly reversed; more importantly, in vivo targeted intervention was achieved by delivering short hairpin RNA through an adeno-associated virus vector, which effectively reduced the formation and development of lung metastases in a mouse model of lung adenocarcinoma metastasis. In vivo imaging showed that the tumor luminescence signal intensity in the experimental group was consistently lower than that in the control group, and the overall survival of the animals was improved. Attached Figure Description
[0015] Figure 1 The staining results of the Transwell invasion experiment in Example 1 are shown; Figure 2 The results of in vivo bioluminescence imaging and photon energy statistics curves of the lung metastasis model in immunodeficient mice in Example 2 are shown. Figure 3 The Transwell invasion assay staining results after silencing HILAR expression using small interfering RNA technology in Example 3 are shown. Figure 4 This shows the in vivo imaging results, animal survival curves, and experimental procedure diagram of the HILAR-targeted lung metastasis model in immunodeficient mice based on adeno-associated virus vector delivery of short hairpin RNA in Example 4. Detailed Implementation
[0016] The specific embodiments of the present invention will be described in detail below.
[0017] Unless otherwise defined, the technical or scientific terms used in the claims and description shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0018] The word "comprising" or similar terms used in the specification and claims of this patent application mean that the objects preceding "comprising" include the objects listed after "comprising" or their equivalents, and do not exclude other objects.
[0019] Example 1 Construction of stable overexpression cell lines: Overexpression of the HILAR gene (HILAR) was mediated using a lentiviral vector system. The control group (Vector) used empty vector lentiviral particles. All viral particles were purchased from Beijing Qingke Biotechnology Co., Ltd. The specific construction process included: using human lung adenocarcinoma A549 cell line as the host cell, and preparing single-cell suspensions by trypsin digestion when cells were in good growth condition, followed by inoculation and culture. When cell confluence reached 20%-30%, the culture medium was replaced with fresh medium, and lentiviral particles of different titers and corresponding infection enhancement reagents were added. GFP expression intensity was observed using fluorescence microscopy to assess infection efficiency. Subsequently, the optimal selection concentration of puromycin was determined, and infected cells were screened for resistance. After screening, HILAR expression levels were detected using real-time quantitative polymerase chain reaction (qPCR). The screening criterion was set as HILAR mRNA expression increasing by at least 50% compared to the control group. Infection uniformity was assessed by combining GFP fluorescence intensity. Finally, cell clones with the most stable and efficient overexpression were selected for subsequent experiments. The primers used for detection include: HILAR-specific primers, with the upstream sequence being CCATCACCTCAGTTCGCAGGT (SEQ ID NO: 1) and the downstream sequence being CTGGAGAGGCTCTCCTACTCGT (SEQ ID NO: 2); and internal reference gene U2 primers, with the upstream sequence being GGCTAAGATCAAGTGTAGTATCTGTTC (SEQ ID NO: 3) and the downstream sequence being GCTCCTATTCCATCTCCCTGCTC (SEQ ID NO: 4).
[0020] Transwell cell invasion assays were performed using Transwell chambers and Matrigel matrix gel manufactured by Corning Incorporated. The specific procedure was as follows: Matrigel matrix gel was melted overnight at 4°C, while serum-free culture medium and Transwell chambers were pre-chilled. Matrigel matrix gel was diluted 1:10 with pre-chilled serum-free culture medium, and 200 μL was added to the center of the bottom of the upper layer of the Transwell chamber, ensuring even coverage of the polycarbonate membrane surface. The chambers were placed in 24-well plates and incubated at 37°C with 5% CO2 for 2 hours to allow Matrigel to fully polymerize. When cell density reached 70%-90%, cells were washed with phosphate-buffered saline, digested with trypsin, and single-cell suspensions were prepared using serum-free culture medium for cell counting. Cells were then counted at a density of 8 × 10⁶ cells per chamber. 4 Cells were seeded at a density of 200 μL of cell suspension into the upper chamber. 700 μL of complete culture medium containing 10% fetal bovine serum was added to the lower chamber as a chemokine, ensuring contact between the upper and lower chamber media. The culture plate was then carefully transferred back to the incubator and cultured for 48 hours. After culture, the chamber was removed, the upper chamber media was discarded, and the plate was gently washed twice with phosphate-buffered saline (PFS) to remove uninvaded cells and residual Matrigel. The chamber was then transferred to a new 24-well plate, and 700 μL of 4% paraformaldehyde solution was added to the lower chamber. After fixation at room temperature for 20 minutes, the fixative was discarded, and the plate was washed twice with PFS. Next, 600 μL of 0.1% crystal violet solution was added to the lower chamber, and staining was performed at room temperature for 15 minutes. The plate was then rinsed repeatedly with PFS or deionized water until the background was colorless. Finally, uninvaded cells on the surface of the polycarbonate membrane at the bottom of the upper chamber were carefully wiped away with a moistened cotton swab. After air drying, five fields of view were randomly selected under an optical microscope at 200x magnification to observe and count the number of invading cells that had penetrated the Matrigel and polycarbonate membrane.
[0021] Figure 1 The staining results of the Transwell invasion assay in Example 1 are shown. The results confirm that, compared with the control group, A549 cells overexpressing HILAR have a significantly enhanced ability to penetrate matrix gel and polycarbonate membranes, indicating that HILAR overexpression can enhance the in vitro invasion ability of lung adenocarcinoma cells.
[0022] Example 2 Construction of stable transfected cell lines: Stable cell lines were constructed using the same lentiviral transfection system as in Example 1. Based on this, the cell line A549-luci-HILAR, which stably overexpresses both HILAR and luciferase reporter genes, and the control cell line A549-luci-Vector were further constructed.
[0023] Establishment of an immunodeficient mouse lung metastasis model: Sixteen healthy male Balb / c nude mice, aged 4-6 weeks, were purchased from the Shanghai Laboratory Animal Center. All experimental animals were housed in a specific pathogen-free (SPF) facility at the Laboratory Animal Center of Shanghai Pulmonary Hospital affiliated with Tongji University. Before the experiment, the nude mice were randomly divided into an experimental group (HILAR) and a control group (Vector) of 8 mice per cage, and underwent a one-week environmental acclimatization period.
[0024] Cell seeding preparation: On the day of tumor cell seeding, A549-luci-HILAR or A549-luci-Vector cells in the logarithmic growth phase were digested and collected, resuspended in phosphate buffer, and the cell concentration was adjusted to 2 × 10⁻⁶ cells / year. 7 Cells / mL.
[0025] Tail vein injection: 100 μL of the above cell suspension was drawn using an insulin syringe and slowly injected into the tail vein of nude mice. After injection, the injection site was gently pressed for a few seconds to prevent extravasation of the fluid.
[0026] Tumor metastasis monitoring: Starting from the first month after inoculation, tumor metastasis was monitored weekly using a small animal in vivo imaging system. A lung metastasis model was established using the A549-luci-HILAR cell line via tail vein injection. Lung tumor formation could be detected on day 30 after inoculation. Tumor progression was continuously monitored weekly, and the animals were sacrificed on day 50 for tumor tissue removal.
[0027] Figure 2 The in vivo bioluminescence imaging results and statistical analysis data of the lung metastasis model in Example 2 are presented. The results show that the tumor metastasis level in the control group is significantly lower than that in the HILAR overexpression experimental group, confirming that HILAR has the effect of promoting lung adenocarcinoma metastasis in vivo.
[0028] Example 3 Cell transfection and screening: Small interfering RNA (siRNA) technology was used to specifically silence HILAR gene expression. The siRNA sequences targeting HILAR are shown in SEQ ID NO: 5 and SEQ ID NO: 6. The non-specific control siRNA sequences (siCtrl) are shown below: UUCUCCGAACGUGUCACGUTT (sense, SEQ ID NO: 7) and ACGUGACACGUUCGGAGAATT (antisense, SEQ ID NO: 8), both purchased from Beijing Qingke Biotechnology Co., Ltd. The specific procedure was as follows: A549 cells in logarithmic growth phase were selected, digested with trypsin, resuspended in complete culture medium, and counted. Cells were seeded at an appropriate density in 12-well plates to achieve a confluence of 30%-50% at transfection. Cells were then cultured at 37℃ in a 5% CO2 incubator for 18-24 hours to achieve the desired confluence. Subsequently, a suitable amount of siRNA was diluted with Opti-MEM medium in a sterile microcentrifuge tube and gently mixed to prepare a working solution. In another sterile microcentrifuge tube, a suitable amount of Lipofectamine 3000 transfection reagent was diluted with an equal volume of Opti-MEM medium, gently mixed, and incubated at room temperature for 5 min. The diluted siRNA working solution was then gently mixed with the transfection reagent and incubated at room temperature for 15-20 min to form the siRNA-transfection reagent complex. The old culture medium in each well of the culture plate was discarded, and the cells were gently washed twice with phosphate-buffered saline. Fresh serum-free and antibiotic-free culture medium was added, and the siRNA-transfection reagent complex was added dropwise and evenly to the corresponding wells. The culture plate was gently shaken to mix, and the plate was returned to a 37°C, 5% CO2 incubator for further culture. Eight hours after transfection, the cell status was observed under a microscope. The culture medium containing the complex was discarded, and the medium was replaced with fresh complete culture medium for another 48 hours. The knockdown efficiency of HILAR was detected by real-time quantitative polymerase chain reaction.
[0029] Transwell cell invasion detection: Transwell cell invasion experiments were performed using the method described in Example 1, which will not be repeated here.
[0030] Figure 3 The staining results of the Transwell invasion experiment in Example 3 show that, compared with the control group, the number of A549 cells that penetrated the matrix gel and polycarbonate membrane in the siRNA-mediated HILAR silencing group was significantly reduced, indicating that targeted inhibition of HILAR expression can effectively reduce the in vitro invasive ability of lung adenocarcinoma cells.
[0031] Example 4 AAV-based shRNA delivery intervention system was constructed: A short hairpin RNA (shHILAR) targeting HILAR and its control shCtrl were delivered using an adeno-associated virus vector, both purchased from Shanghai Hanheng Biotechnology Co., Ltd. The HILAR-targeting shRNA contained two oligonucleotide sequences, as shown below: GAGGGAATAAGGACATTCTTTCTCGAGAAAGAATGTCCTTATTCCCTCTTTTTT (SEQ ID NO: 9) and GCTGAGGTGAAGGTGTTTATTCTCGAGAATAAACACCTTCACCTCAGCTTTTTT (SEQ ID NO: 10); the non-specific control shCtrl sequence is shown below: TTCTCCGAACGTGTCACGT (SEQ ID No: 11).
[0032] Constructing a stable cell line overexpressing luciferase: A549-luci cell line stably expressing the luciferase reporter gene was constructed using the same lentivirus transfection system as in Example 1.
[0033] Establishment of an immunodeficient mouse model of lung metastasis and implementation of AAV treatment: Sixteen healthy male Balb / c nude mice, aged 4-6 weeks, were purchased from the Shanghai Laboratory Animal Center. All experimental animals were housed in the specific pathogen-free (SPathogen-Free) facility of the Laboratory Animal Center of Shanghai Pulmonary Hospital affiliated with Tongji University. Before the experiment, the nude mice were randomly divided into an experimental group (AAV-shHILAR) and a control group (AAV-shCtrl) of 8 mice per cage, and underwent a one-week environmental acclimatization period.
[0034] Cell seeding preparation: On the day of tumor cell seeding, A549-luci cells in the logarithmic growth phase were digested and collected, resuspended in phosphate buffer, and the cell concentration was adjusted to 2 × 10⁻⁶. 7 Cells / mL.
[0035] Tail vein injection: 100 μL of the above cell suspension was drawn using an insulin syringe and slowly injected into the tail vein of nude mice. After injection, the injection site was gently pressed for a few seconds to prevent extravasation of the fluid.
[0036] AAV administration: On the day following cell seeding, 100 μL of AAV-shHILAR or AAV-shCtrl was drawn using an insulin syringe and administered to the experimental animals via intraperitoneal injection.
[0037] Tumor metastasis monitoring: Starting from the first month after inoculation, tumor metastasis was monitored weekly using a small animal in vivo imaging system. A lung metastasis model was established using the A549-luci cell line via tail vein injection, and lung tumor formation was detected on day 30 post-inoculation. Tumor progression was continuously monitored weekly, and the animals were sacrificed on day 60 for tumor tissue removal.
[0038] Figure 4 This diagram shows the in vivo bioluminescence imaging results, animal survival curves, and experimental procedure of the lung metastasis model in Example 4. Compared with the control group, the bioluminescence signal intensity of lung metastases in mice treated with AAV-shHILAR was continuously reduced, and the survival curves indicated that the overall survival of mice in this group was better than that of the control group. This result confirms that targeted silencing of HILAR expression via shRNA delivery using an adeno-associated virus vector can effectively inhibit the in vivo metastasis process of lung adenocarcinoma.
[0039] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.
Claims
1. A siRNA molecule for the prevention and / or treatment of lung adenocarcinoma metastasis, characterized in that, The siRNA molecule targets and inhibits the long non-coding RNA HILAR, and the nucleotide sequence of the siRNA molecule is shown in SEQ ID NO: 5 and SEQ ID NO:
6.
2. A shRNA molecule for the prevention and / or treatment of lung adenocarcinoma metastasis, characterized in that, The shRNA molecule targets and inhibits the long non-coding RNA HILAR, and the nucleotide sequence of the shRNA molecule is shown in SEQ ID NO: 9 or / and SEQ ID NO:
10.
3. A pharmaceutical composition for the prevention and / or treatment of lung adenocarcinoma metastasis, characterized in that, include: The siRNA molecule as described in claim 1 or / and the shRNA molecule as described in claim 2.
4. The pharmaceutical composition according to claim 3, characterized in that, Also includes: Carrier.
5. The pharmaceutical composition according to claim 4, characterized in that, The carrier is selected from liposomes, polymer nanoparticles, exosomes, or viral vectors.
6. The use of an inhibitor of the long non-coding RNA HILAR, the siRNA molecule as claimed in claim 1, the shRNA molecule as claimed in claim 2, or the pharmaceutical composition as claimed in any one of claims 3-5 in the preparation of a medicament for the prevention and / or treatment of lung adenocarcinoma metastasis.
7. The siRNA molecule according to claim 1, the shRNA molecule according to claim 2, the pharmaceutical composition according to any one of claims 3-5, or the application according to claim 6, characterized in that, The lung adenocarcinoma mentioned is stage T1-2 lung adenocarcinoma.