SiRNA of pyroptosis-related inflammatory response gene and application thereof

Abstract

The application provides a group of small interfering RNAs (siRNAs) targeting pyroptosis-related inflammatory reaction genes and application thereof. The pyroptosis-related inflammatory reaction genes include IL1A, IL1B, IL6, HMGB1, S100A8, S100A9 and BACH1. The application designs and synthesizes specific siRNA sequences for the above genes, and verifies that the siRNAs can efficiently and specifically inhibit the mRNA expression level of the corresponding genes through cell transfection and real-time fluorescent quantitative PCR. The application also provides a composition containing the siRNAs, a pharmaceutical composition and application thereof in the preparation of a drug for treating diseases mediated by pyroptosis-related inflammatory reaction genes (especially inflammatory diseases). The siRNAs and the composition thereof provide a new effective strategy for treating diseases related to excessive activation of pyroptosis-related inflammatory reactions, and have a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to siRNA of pyroptosis-related inflammatory response genes and its applications, specifically to a small interfering RNA (siRNA) molecule that targets pyroptosis-related inflammatory response genes, a composition containing the siRNA molecule, and its application in the preparation of medicaments for treating diseases mediated by pyroptosis-related inflammatory response genes. Background Technology

[0002] Pyroptosis is a programmed cell death mechanism that has been extensively studied in recent years. Its key characteristic, distinguishing it from apoptosis, lies in its strong pro-inflammatory nature. Pyroptosis is mainly caused by the activation of the inflammasome, which leads to the activation of caspases (especially caspase-1 and caspase-11 / 4 / 5), which in turn cleave the pyroptosis executive protein Gasdermin D (GSDMD), producing an N-terminal fragment with pore-forming activity. This fragment forms pores in the cell membrane, causing osmotic imbalance, swelling, rupture, and the release of large amounts of intracellular pro-inflammatory contents.

[0003] Pyroptosis plays a crucial role in the body's immune defense and maintaining cellular homeostasis. However, its dysfunction or overactivation is closely related to the pathogenesis of various diseases, including but not limited to autoimmune diseases (such as rheumatoid arthritis and inflammatory bowel disease), septic shock, atherosclerosis, neurodegenerative diseases (such as Alzheimer's disease), and the occurrence, development, and metastasis of tumors. Therefore, regulating the pyroptosis pathway and its secondary inflammatory response has become a highly promising new target for disease treatment.

[0004] The secondary inflammatory response following pyroptosis is a core element determining the extent of pathological damage. This process involves the expression and function of a series of pyroptosis-related inflammatory response genes, which are responsible for generating, releasing, or amplifying inflammatory signals, forming a cascade reaction. Among them, interleukin-1α (IL-1α) and interleukin-1β (IL-1β) are classic downstream effector factors of pyroptosis. They can be cleaved and released by Caspase-1, activating downstream immune cells and triggering intense inflammation (Dinarello, 2018, NatRev Immunol). Interleukin-6 (IL-6), as a key inflammatory amplifier, not only promotes acute inflammatory responses but also participates in the maintenance of chronic inflammation (Li et al., 2022, J Clin Invest; Wang et al., 2025, Cell). High-mobility group box 1 (HMGB1) is a typical damage-associated molecular pattern (DAMP) molecule, which is released in large quantities into the extracellular space during pyroptosis. It further amplifies inflammatory signals by binding to pattern recognition receptors such as Toll-like receptors (Wang et al., 2025, Cell). S100A8 and S100A9 proteins often form heterodimers and, as DAMP molecules, play a strong chemokine and pro-inflammatory role in the inflammatory response, enhancing the intensity of pyroptosis-related inflammation (Vogl et al., 2018, Nat RevImmunol; Chen et al., 2020, Cell Res). Furthermore, the BTB domain of transcription factors and CNC homolog 1 (Bach1) can indirectly participate in the regulation of pyroptosis-related inflammation intensity by modulating the expression of inflammatory factors such as IL-1β (Zhang et al., 2021, J Biol Chem; Li et al., 2023, Cell Death Differ).

[0005] Although the crucial roles of the aforementioned genes in pyroptosis-related inflammatory responses are widely recognized, current technologies lack drugs that can simultaneously or selectively target these core genes to effectively inhibit the pyroptosis-related inflammatory cascade. Small interfering RNA (siRNA) technology, as a powerful gene silencing tool, can specifically bind to target mRNA, inducing its degradation and thus precisely regulating gene expression at the posttranscriptional level. However, designing siRNA molecules with high silencing efficiency, high specificity, and low off-target effects, and successfully applying them to disease treatment, still faces numerous technical challenges, including sequence screening, chemical modification, and delivery systems. Currently, specific and effective siRNA sequences and their combinations targeting the aforementioned pyroptosis-related inflammatory response genes, especially siRNA drugs that synergistically inhibit the pyroptosis inflammatory network, have not been reported.

[0006] Therefore, there is an urgent need in this field to develop novel siRNA molecules and combinations thereof that can effectively inhibit the expression of pyroptosis-related inflammatory response genes, in order to prepare drugs for treating diseases mediated by pyroptosis-related inflammatory response genes. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide one or more groups of specific siRNA molecules targeting pyroptosis-related inflammatory response genes, and their application in the preparation of drugs for treating diseases mediated by pyroptosis-related inflammatory response genes (especially inflammatory diseases). The present invention aims to solve the technical problem of the lack of effective therapeutic drugs targeting pyroptosis-related inflammatory response genes in the prior art.

[0008] The above-mentioned objective of this invention is achieved through the following technical solutions: This invention provides a nucleic acid molecule, which is a double-stranded RNA molecule containing a sense strand and an antisense strand. The nucleic acid molecule can target and inhibit the expression of pyroptosis-related inflammatory response genes. The pyroptosis-related inflammatory response genes are selected from IL1A, IL1B, IL6, HMGB1, S100A8, S100A9, and BACH1. This invention also provides one or more of these genes.

[0009] According to one embodiment of the present invention, the sequence of the nucleic acid molecule is selected from any one of the following groups: (1) siRNA targeting the human HMGB1 gene, the sense strand of which is shown in SEQ ID NO:1 and the antisense strand of which is shown in SEQ ID NO:2; (2) siRNA targeting the human HMGB1 gene, the sense strand of which is shown in SEQ ID NO:3 and the antisense strand of which is shown in SEQ ID NO:4; (3) siRNA targeting the human HMGB1 gene, the sense strand of which is shown in SEQ ID NO:5 and the antisense strand of which is shown in SEQ ID NO:6; (4) siRNA targeting the human S100A8 gene, the sense strand of which is shown in SEQ ID NO:7 and the antisense strand of which is shown in SEQ ID NO:8; (5) siRNA targeting the human S100A8 gene, the sense strand of which is shown in SEQ ID NO:9 and the antisense strand of which is shown in SEQ ID NO:10; (6) siRNA targeting the human S100A8 gene, the sense strand of which is shown in SEQ ID NO:11 and the antisense strand of which is shown in SEQ ID NO:12; (7) siRNA targeting the human S100A9 gene, the sense strand of which is shown in SEQ ID NO:13 and the antisense strand of which is shown in SEQ ID NO:14; (8) siRNA targeting the human S100A9 gene, the sense strand of which is shown in SEQ ID NO:15 and the antisense strand of which is shown in SEQ ID NO:16; (9) siRNA targeting the human S100A9 gene, the sense strand of which is shown in SEQ ID NO:17 and the antisense strand of which is shown in SEQ ID NO:18; (10) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:19 and the antisense strand of which is shown in SEQ ID NO:20; (11) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:21 and the antisense strand of which is shown in SEQ ID NO:22; (12) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:23 and the antisense strand of which is shown in SEQ ID NO:24; (13) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:25 and the antisense strand of which is shown in SEQ ID NO:26; (14) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:27 and the antisense strand of which is shown in SEQ ID NO:28; (15) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:29 and the antisense strand of which is shown in SEQ ID NO:30; (16) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:31 and the antisense strand of which is shown in SEQ ID NO:32; (17) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:33 and the antisense strand of which is shown in SEQ ID NO:34; (18) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:35 and the antisense strand of which is shown in SEQ ID NO:36; (19) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:37 and the antisense strand of which is shown in SEQ ID NO:38; (20) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:39 and the antisense strand of which is shown in SEQ ID NO:40; (21) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:41 and the antisense strand of which is shown in SEQ ID NO:42; (22) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:43 and the antisense strand of which is shown in SEQ ID NO:44; (23) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:45 and the antisense strand of which is shown in SEQ ID NO:46; (24) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:47 and the antisense strand of which is shown in SEQ ID NO:48; (25) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:49 and the antisense strand of which is shown in SEQ ID NO:50; (26) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:51 and the antisense strand of which is shown in SEQ ID NO:52; (27) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:53 and the antisense strand of which is shown in SEQ ID NO:54; (28) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:55 and the antisense strand of which is shown in SEQ ID NO:56; (29) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:57 and the antisense strand of which is shown in SEQ ID NO:58; (30) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:59 and the antisense strand of which is shown in SEQ ID NO:60; (31) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:61 and the antisense strand of which is shown in SEQ ID NO:62.

[0010] The present invention also provides a composition comprising at least one nucleic acid molecule of the embodiments described above.

[0011] According to one embodiment of the present invention, the composition comprises two or more nucleic acid molecules described in the above embodiments, wherein the nucleic acid molecules target different pyroptosis-related inflammatory response genes.

[0012] According to one embodiment of the invention, the composition further comprises a pharmaceutically acceptable carrier.

[0013] The present invention also provides the use of the composition in the preparation of a medicament for treating and / or preventing diseases mediated by pyroptosis-related inflammatory response genes.

[0014] According to one embodiment of the present invention, the disease mediated by the pyroptosis-associated inflammatory response gene is an inflammatory disease.

[0015] According to one embodiment of the present invention, the inflammatory disease is selected from: sepsis, acute pancreatitis, inflammatory bowel disease, rheumatoid arthritis, psoriasis, atherosclerosis, Alzheimer's disease, Parkinson's disease, or inflammatory response induced by chemotherapy / radiotherapy.

[0016] The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of a composition of the above embodiments, and pharmaceutically acceptable excipients.

[0017] The present invention also provides a method for inhibiting the expression of pyroptosis-related inflammatory response genes for non-therapeutic purposes, comprising the step of introducing a nucleic acid molecule described in the above embodiments into cells.

[0018] In summary, compared with the prior art, the present invention has at least one of the following beneficial technical effects: Novelty of targets: This invention is the first to use multiple core genes related to pyroptosis-related inflammatory responses, such as IL1A, IL1B, IL6, HMGB1, S100A8, S100A9, and BACH1, as targets for siRNA therapeutic intervention. The aim is to block the downstream inflammatory cascade response of pyroptosis from the source, rather than targeting only a single factor, thus having a more comprehensive and effective anti-inflammatory potential.

[0019] Sequence Efficiency: Through extensive sequence design and screening, this invention provides a series of siRNA sequences with extremely high gene silencing efficiency, verified experimentally. Example data shows that some siRNAs can inhibit the mRNA of target genes by more than 80%, even exceeding 90%, significantly better than unoptimized conventional sequences in existing technologies. The siRNA oligonucleotide combination can effectively inhibit the expression of pyroptosis-related inflammatory response genes, including Il1a, Il1b, Il6, Hmgb1, S100A8, S100A9, and Bach1, thus suppressing their biological functions.

[0020] Potential for combined applications: The siRNA molecules provided by this invention can not only be used alone, but also be combined into "cocktail" therapies according to the specific pathological characteristics of the disease. At the same time, multiple synergistic inflammatory factors can be silenced to achieve synergistic anti-inflammatory effects, providing a new strategy for the treatment of complex inflammatory diseases.

[0021] Wide applicability: The pyroptosis-related inflammatory response genes involved in this invention play a key role in a variety of inflammatory diseases. Therefore, the siRNA molecules and compositions of this invention have broad application prospects and can be used to treat a variety of acute and chronic diseases related to pyroptosis inflammation.

[0022] Industrial applicability: The siRNA molecules of this invention can be prepared in large quantities through chemical synthesis, with controllable quality, and can be easily combined with existing nucleic acid delivery systems (such as lipid nanoparticles) to form industrially viable drug formulations, demonstrating good development and application prospects. Attached Figure Description

[0023] Figure 1 A bar graph was created to detect the relative expression levels of IL1A mRNA in CAL27 cells after transfection with siRNA targeting the IL1A gene, using qPCR. The results showed that, compared with the negative control group (NC), IL1A-Homo / Mus-1, IL1A-Homo-473, IL1A-Homo-554, IL1A-Homo-771, IL1A-Homo-222, and IL1A-Homo-362 all significantly inhibited IL1A gene expression.

[0024] Figure 2 A bar chart was created to detect the relative expression levels of IL1B mRNA in CAL27 cells after transfection with siRNA targeting the IL1B gene, using qPCR. The results showed that, compared with the negative control group, IL1B-Homo / Mus-1, IL1B-Homo-111, IL1B-Homo-752, IL1B-Homo-487, and IL1B-Homo-556 all significantly inhibited IL1B gene expression.

[0025] Figure 3 This is a bar chart showing the relative expression levels of IL6 mRNA in CAL27 cells after transfection with siRNA targeting the IL6 gene, detected by qPCR. The results showed that, compared with the negative control group, IL6-Homo-262, IL6-Homo-365, IL6-Homo-157, IL6-Homo-486, and IL6-Homo-679 all significantly inhibited IL6 gene expression.

[0026] Figure 4 A bar graph was created to detect the relative expression level of HMGB1 mRNA in 293T cells after transfection with siRNA targeting the HMGB1 gene, using qPCR. The results showed that, compared with the negative control group, HMGB1-Homo-520, HMGB1-Homo-567, and HMGB1-Homo-394 all significantly inhibited the expression of the HMGB1 gene.

[0027] Figure 5A bar graph showing the relative expression level of S100A8 mRNA after transfection of A431 cells with siRNA targeting the S100A8 gene, detected by qPCR. The results showed that, compared with the negative control group, S100A8-Homo-144, S100A8-Homo-235, and S100A8-Homo-61 all significantly inhibited the expression of the S100A8 gene.

[0028] Figure 6 A bar graph showing the relative expression level of S100A9 mRNA after transfection of A431 cells with siRNA targeting the S100A9 gene, detected by qPCR. The results showed that, compared with the negative control group, S100A9-Homo-59, S100A9-Homo-214, and S100A9-Homo-UTR-507 all significantly inhibited the expression of the S100A9 gene.

[0029] Figure 7 A bar chart was created to detect the relative expression level of BACH1 mRNA in CAL27 cells after transfection with siRNA targeting the BACH1 gene, using qPCR. The results showed that, compared with the negative control group, BACH1-Homo / Mus-1, BACH1-Homo / Mus-2, BACH1-Homo-1036, BACH1-Homo-292, BACH1-Homo-591, and BACH1-Homo-890 all significantly inhibited BACH1 gene expression. Detailed Implementation

[0030] The technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0031] This invention, through in-depth analysis of the mRNA sequences of pyroptosis-related inflammatory response genes, and considering factors such as sequence specificity, secondary structure, GC content, and thermodynamic stability, designed and screened a series of highly efficient and specific siRNA molecules. Cellular experiments verified that these siRNA molecules can significantly reduce the mRNA expression levels of target genes, thereby effectively inhibiting the inflammatory cascade response following pyroptosis.

[0032] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a nucleic acid molecule, which is a double-stranded RNA molecule comprising a sense strand and an antisense strand, and which is capable of targeting and inhibiting the expression of pyroptosis-related inflammatory response genes. The pyroptosis-related inflammatory response genes are selected from one or more of the following: IL1A, IL1B, IL6, HMGB1, S100A8, S100A9, and BACH1.

[0033] In a preferred embodiment, the sequence of the nucleic acid molecule is selected from any combination of the following: The siRNA targeting the human HMGB1 gene has its sense and antisense sequences selected from at least one pair of the groups consisting of SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, and SEQ ID NO:5 and SEQ ID NO:6.

[0034] The siRNA targeting the human S100A8 gene has its sense and antisense sequences selected from at least one pair of the groups consisting of SEQ ID NO:7 and SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10, and SEQ ID NO:11 and SEQ ID NO:12.

[0035] The siRNA targeting the human S100A9 gene has its sense and antisense sequences selected from at least one pair of the groups consisting of SEQ ID NO:13 and SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16, and SEQ ID NO:17 and SEQ ID NO:18.

[0036] The siRNA targeting the human BACH1 gene has its sense and antisense strand sequences selected from at least one pair of the groups consisting of SEQ ID NO:19 and SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28, and SEQ ID NO:29 and SEQ ID NO:30.

[0037] The siRNA targeting the human IL1A gene has its sense and antisense strand sequences selected from at least one pair of the groups consisting of SEQ ID NO:31 and SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34, SEQ ID NO:35 and SEQ ID NO:36, SEQ ID NO:37 and SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40, and SEQ ID NO:41 and SEQ ID NO:42.

[0038] The siRNA targeting the human IL1B gene has its sense and antisense sequences selected from at least one pair of the groups consisting of SEQ ID NO:43 and SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46, SEQ ID NO:47 and SEQ ID NO:48, SEQ ID NO:49 and SEQ ID NO:50, and SEQ ID NO:51 and SEQ ID NO:52.

[0039] The siRNA targeting the human IL6 gene has its sense and antisense sequences selected from at least one pair of the groups consisting of SEQ ID NO:53 and SEQ ID NO:54, SEQ ID NO:55 and SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58, SEQ ID NO:59 and SEQ ID NO:60, and SEQ ID NO:61 and SEQ ID NO:62.

[0040] More specifically, the correspondence between the above sequences is shown below: HMGB1-Homo-520: Justice chain GGUGAUGUUGCGAAGAAAC (SEQ ID NO:1); Antisense chain GUUUCUUCGCAACAUCACCAA (SEQ ID NO:2); HMGB1-Homo-567: Justice chain AGAUGACAAGCAGCCUUAU (SEQ ID NO:3); Antisense chain AUAAGGCUGCUUGUCAUCUGC (SEQ ID NO:4); HMGB1-Homo-394: Justice chain CCCAAAGGGGAGACAAAAA (SEQ ID NO:5); Antisense chain UUUUUGUCUCCCCUUUGGGAG (SEQ ID NO:6); S100A8-Homo-144: Justice chain AGGGAUGACCUGAAGAAAU (SEQ ID NO:7); Antisense chain AUUUCUUCAGGUCAUCCCUGU (SEQ ID NO:8); S100A8-Homo-235: Justice chain ACACUGAUGGUGCAGUUAA (SEQ ID NO:9); Antisense chain UUAACUGCACCAUCAGUGUUG (SEQ ID NO:10); S100A8-Homo-61: Justice chain CCGAGCUGGAGAAAGCCUU (SEQ ID NO:11); Antisense chain AAGGCUUUCUCCAGCUCGGUC (SEQ ID NO:12); S100A9-Homo-59: Justice chain GCAGCCUGGAACGCAACAUA (SEQ ID NO:13); Antisense chain UAGUUGCGUUCCAGCUGCGA (SEQ ID NO:14); S100A9-Homo-214: Justice chain UCAUAGAACACAUCAUGGA (SEQ ID NO:15); Antisense chain UCCAUGAUGUGUUCUAUGACC (SEQ ID NO:16); S100A9-Homo-UTR-507: Justice chain UUGUUAUGUCAAACUGUCUU (SEQ ID NO:17); Antisense chain AAGACAGUUUGACAUAACAGG (SEQ ID NO:18); BACH1-Homo / Mus-1: Justice chain UAAAGGAUUUGAACCUUUA (SEQ ID NO:19); Antisense chain UAAAGGUUCAAAUCCUUUAAC (SEQ ID NO:20); BACH1-Homo / Mus-2: Justice chain CUUCUGGAGUGACAUUUGC (SEQ ID NO:21); Antisense chain GCAAAUGUCACUCCAGAAGCC (SEQ ID NO:22); BACH1-Homo-1036: Justice chain GACCCUCAUGGACUUUAUU (SEQ ID NO:23); Antisense chain AAUAAAGUCCAUGAGGGUCUA (SEQ ID NO:24); BACH1-Homo-292: Justice chain GAUGGAGAGCUGAACAUUA (SEQ ID NO:25); Antisense chain UAAUGUUCAGCUCUCCAUCAG (SEQ ID NO:26); BACH1-Homo-591: Justice chain UGAUGAAGUGGAGGAAUUU (SEQ ID NO:27); Antisense chain AAAUUCCUCCACUUCAUCAGU (SEQ ID NO:28); BACH1-Homo-890: Justice chain UCCGGAGUGUAGAGAUUU (SEQ ID NO:29); Antisense chain AAAUCUCUACACUCCGGGACU (SEQ ID NO:30); IL1A-Homo / Mus-1: Justice chain UGAAUCAGAAAUCCUUCUA (SEQ ID NO:31); Antisense chain UAGAGGAUUUCUGAUUCAGA (SEQ ID NO:32); IL1A-Homo-473: Justice chain CCCUCAAUCAAAGUAUAAU (SEQ ID NO:33); Antisense chain AUUAUACUUUGAUUGAGGGCG (SEQ ID NO:34); IL1A-Homo-554: Justice chain UUGACAUGGGUGCUUAUAA (SEQ ID NO:35); Antisense chain UUAUAAGCACCCAUGUCAAAU (SEQ ID NO:36); IL1A-Homo-771: Justice chain CCAUCCAAACUUGUUUAUU (SEQ ID NO:37); Antisense chain AAUAAACAAGUUUGGAUGGGC (SEQ ID NO:38); IL1A-Homo-222: Justice chain UAUCUCUGAAACCUCUAAA (SEQ ID NO:39); Antisense chain UUUAGAGGUUUCAGAGAUACU (SEQ ID NO:40); IL1A-Homo-362: Justice chain AUGACUCAGAGGAAGAAAU (SEQ ID NO:41); Antisense chain AUUUCUUCCUCUGAGUCAUUG (SEQ ID NO:42); IL1B-Homo / Mus-1: Justice chain UUCCCCAACUGGUACAUCA (SEQ ID NO:43); Antisense chain UGAUGUACCAGUUGGGGAACU (SEQ ID NO:44); IL1B-Homo-111: Justice chain GUGAAAUGAUGGCUUAUUA (SEQ ID NO:45); Antisense chain UAAUAAGCCAUCAUUUCACUG (SEQ ID NO:46); IL1B-Homo-752: Justice chain AAUAACAAGCUGGAAUUUG (SEQ ID NO:47); Antisense chain CAAAUUCCAGCUUGUUAUUGA (SEQ ID NO:48); IL1B-Homo-487: Justice chain GGUGAUGUCUGGUCCAUAU (SEQ ID NO:49); Antisense chain AAUGGACCAGACAUCACCAA (SEQ ID NO:50); IL1B-Homo-556: Justice chain GUUCUCCAUGUCCUUUGUA (SEQ ID NO:51); Antisense chain UACAAAGGACAUGGAGAACAC (SEQ ID NO:52); IL6-Homo-262: Justice chain GAGAAAGGAGACAUGUAAC (SEQ ID NO:53); Antisense chain GUUACAUGUCUCCUUUCUCAG (SEQ ID NO:54); IL6-Homo-365: Justice chain UUCCAAUCUGGAUUCAAUG (SEQ ID NO:55); Antisense chain CAUUGAAUCCAGAUUGGAAGC (SEQ ID NO:56); IL6-Homo-157: Justice chain AGGAGAAGAUUCCAAAGAU (SEQ ID NO:57); Antisense chain AUCUUUGGAAUCUUCUCCUGG (SEQ ID NO:58); IL6-Homo-486: Justice chain CUGUGCAGAUGAGUACAAA (SEQ ID NO:59); Antisense chain UUUGUACUCAUCUGCACAGCU (SEQ ID NO:60); IL6-Homo-679: Justice chain GAGGGCUCUUCGGCAAAUG (SEQ ID NO:61); Antisense chain CAUUUGCCGAAGAGCCCUCAG (SEQ ID NO:62).

[0041] In a second aspect, the present invention provides a composition comprising at least one nucleic acid molecule as described in the first aspect above.

[0042] In a preferred embodiment, the composition comprises two or more nucleic acid molecules as described in the first aspect above, each targeting a different pyroptosis-related inflammatory response gene.

[0043] In another preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier includes, but is not limited to, liposomes, polymer nanoparticles, cationic lipids, viral vectors, exosomes, or ligand-modified delivery systems.

[0044] Thirdly, the present invention provides the use of a nucleic acid molecule described in the first aspect or a composition described in the second aspect above in the preparation of a medicament for treating and / or preventing diseases mediated by pyroptosis-related inflammatory response genes.

[0045] Preferably, the disease mediated by the pyroptosis-associated inflammatory response gene is an inflammatory disease. More preferably, the inflammatory disease is selected from: sepsis, acute pancreatitis, inflammatory bowel disease, rheumatoid arthritis, psoriasis, atherosclerosis, Alzheimer's disease, Parkinson's disease, or an inflammatory response induced by chemotherapy / radiotherapy.

[0046] Fourthly, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a nucleic acid molecule as described in the first aspect above or a composition as described in the second aspect above, and pharmaceutically acceptable excipients.

[0047] The dosage form of the pharmaceutical composition may be an injection, a lyophilized powder for injection, a spray, an emulsion, or an implant.

[0048] Fifthly, the present invention provides a method for inhibiting the expression of pyroptosis-related inflammatory response genes for non-therapeutic purposes, comprising the step of introducing a nucleic acid molecule as described in the first aspect into cells.

[0049] The method can be used for scientific research, such as constructing gene-silencing cell models and studying the function of genes involved in pyroptosis-related inflammatory responses.

[0050] Example 1: Design and Synthesis of siRNA Molecules Based on the human IL1A (NM_000575.5), IL1B (NM_000576.3), IL6 (NM_000600.5), HMGB1 (NM_002128.7), S100A8 (NM_002964.5), S100A9 (NM_002965.4), and BACH1 (NM_001186.4) mRNA sequences from the NCBI database, sequence screening was performed using various siRNA design software programs (such as siRNA Wizard and Block-iT™ RNAiDesigner). The screening principles included: (1) Select a 19-21 nt sequence of the target gene coding region (CDS) or 3' untranslated region (3'UTR); (2) The GC content should be controlled between 30% and 60%; (3) The 5' end of the sense strand is A / U and the 5' end of the antisense strand is G / C to facilitate the loading of the RISC complex; (4) Avoid the appearance of four or more identical bases consecutively; (5) BLAST analysis was used to exclude sequences that are highly homologous to other non-target genes.

[0051] Based on the above principles, at least three siRNAs were designed for each target gene, with sequences as shown in the previous "Invention Content" section. All siRNAs were chemically synthesized by commercial companies (such as GemmaGene and RiboBio) using a standard phosphorus amide solid-phase synthesis method and purified by HPLC. The synthesized siRNAs were double-stranded RNAs, lyophilized powders, and stored at -20°C for later use.

[0052] Effects of siRNA on RNA expression levels of Il1a, Il1b, Il6, Hmgb1, S100A8, S100A9, and Bach1 genes: 1. Design at least 3 siRNAs for each gene and transfect CAL27, A431, and 239T cells. Collect cell samples 48 hours after transfection for qPCR detection. Set up 3 replicates for each siRNA.

[0053] 2. Culture cells in DMEM medium containing 10% fetal bovine serum in a 10cm diameter cell culture dish until 80-90% confluence, discard the culture supernatant, and wash the cells with PBS buffer.

[0054] 3. Add 1 ml of Trypsin-EDTA solution to the cell culture dish, mix well, carefully aspirate the supernatant, and incubate at 37°C for 1 minute to digest the cells.

[0055] 4. Add 2 ml of complete culture medium to the cell culture dish and gently pipette the cells to obtain a single-cell suspension.

[0056] 5. Take the cell suspension obtained in step 3 and seed it into a 12-well plate (1×10⁵ cells per well) and incubate at 37°C for 12 hours.

[0057] 6. Dissolve the siRNA to be tested in DEPC-H2O to obtain a siRNA stock solution with a concentration of 20 μM.

[0058] 7. Add the siRNA solution and DMEM culture medium obtained in step 5 to a 1.5 ml EP tube, mix well, and obtain 200 μl of mixture A; add 196 μl of DMEM culture medium and 4 μl of transfection reagent lipo2000 to another EP tube, mix well and let stand for 5 min, and obtain 200 μl of mixture B; mix the two mixtures to obtain 400 μl of mixture, let stand at room temperature for 20 min, and this is the transfection mixture.

[0059] 8. Take the 12-well plate after completing step 4, aspirate the supernatant, add 600 μl of DMEM culture medium to each well, let it stand for 20 min, then add 400 μl of the transfection mixture prepared in step 6 to each well. The concentration of siRNA in 1 ml of each well is 10 nM. After incubating at 37℃ for 6 hours, change the medium, add complete culture medium and continue incubating for 48 hours.

[0060] 9. Take the 12-well plate after completing step 7, aspirate the supernatant, wash with PBS buffer, then add DMEM culture medium and incubate at 37°C for 24 hours.

[0061] 10. Total RNA extraction: (1) Take the 12-well plate after completing step 8, collect the cells, add 1 ml of Ezol lysis buffer to the collected cell sample, and vortex to mix. Let stand at room temperature for 5 minutes.

[0062] (2) Add 0.2 ml of chloroform, shake vigorously for 10 seconds, and let stand at room temperature for 5 minutes.

[0063] (3) Centrifuge at 4℃, 12,000 x g for 15 min.

[0064] (4) Transfer the supernatant to another new RNase-free centrifuge tube and add an equal volume of 100% ethanol.

[0065] (5) Add the sample containing ethanol to a mini-spin centrifuge column with a 2ml collection tube in two portions. Centrifuge at 8,000xg at room temperature for 15s and discard the flow-through liquid.

[0066] (6) Add 700 μl WB to the centrifuge column, lightly cover the cap, centrifuge at 8,000 x g at room temperature for 15 s, and discard the flow-through liquid.

[0067] (7) Repeat step 6 and wash the centrifuge column twice with 500 μl WB.

[0068] (8) Transfer the centrifuge column to a new RNase-free 1.5ml centrifuge tube, add 40μl of DEPC water to the center of the silica membrane, and centrifuge at 10,000xg for 3 min at 4℃ to elute RNA.

[0069] 11. Random reverse transcription: (1) Take a centrifuge tube containing N6 primer powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 10 times the number of nmol of primer powder, and the primer concentration obtained after dilution is 100 μM.

[0070] Component Final Con. Vol / 1 rxns N6 (100 μM) 5 μl RNA Sample as required 2 μg 5×RT Buffer 1× 4 μl dNTP (10 mM) 0.4 mM 0.8 μl MMLV Reverse Transcriptase (200 U / μl) 2 U / μl 0.2 μl RNase Free H2O To 20 μl (3) After mixing, place it in a PCR instrument at 25℃ for 30 min, 42℃ for 45 min, 85℃ for 5 min, and 25℃ for 30 s.

[0071] 12. Real-time quantitative PCR was used to detect the relative expression levels of each gene: (1) Take a centrifuge tube containing F / R primer dry powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 50 times the number of nmol of primer dry powder, and the primer concentration obtained after dilution is 20 μM.

[0072] Component Final Con. Vol / 1 rxns 2× Real-time PCR Master Mix 1× 10 μl F primer (20 μM) 0.1μM 0.1 μl R primer (20 μM) 0.1μM 0.1 μl cDNA — 2 μl Taq DNA polymerase (5U / μl) 0.05 U / μl 0.2 μl ROX reference dye (50×) 1× 0.4 μl RNase-free H2O To 20 μl (3) Cyclic settings: 95℃, 3min pre-denaturation; 95℃, 12s, 62℃, 30s, 40 cycles, fluorescence signal acquisition.

[0073] (4) Melting curve: 95 ℃, 1 min, 62 ℃ 30 s, 95 ℃ 30 s.

[0074] 13. Data Processing: (1) Perform real-time PCR to obtain the Ct values ​​of the target gene and internal reference gene for each reaction.

[0075] (2) Calculate the average value of the three replicates of the sample and the calibration sample.

[0076] (3) Subtract the average Ct value of the internal reference gene from the average Ct value of the target gene to calculate the ΔCt value of each sample.

[0077] (4) The ΔCT value of each sample is calculated by subtracting the ΔCT value of the calibration sample from the ΔCt value of the test sample.

[0078] (5)Use 2 –ΔΔCt Calculate the relative gene expression ratio.

[0079] 14. Results are shown below. Figure 1-7 : (1) siRNAs IL1A-Homo / Mus-1, IL1A-Homo-473, IL1A-Homo-554, IL1A-Homo-771, IL1A-Homo-222, and IL1A-Homo-362 significantly inhibited the expression of endogenous Il1a gene in CAL27 cells.

[0080] (2) siRNAs IL1B-Homo / Mus-1, IL1B-Homo-111, IL1B-Homo-752, IL1B-Homo-487, and IL1B-Homo-556 significantly inhibited the expression of endogenous Il1b gene in CAL27 cells.

[0081] (3) siRNAs IL6-Homo-262, IL6-Homo-365, IL6-Homo-157, IL6-Homo-486, and IL6-Homo-679 significantly inhibited the expression of endogenous Il6 gene in CAL27 cells.

[0082] (4) siRNAs HMGB1-Homo-520, HMGB1-Homo-567, and HMGB1-Homo-394 significantly inhibited the expression of endogenous Hmgb1 gene in 293T cells.

[0083] (5) siRNA S100A8-Homo-144, S100A8-Homo-235, and S100A8-Homo-61 significantly inhibited the expression of the endogenous S100A8 gene in A431 cells.

[0084] (6) siRNA S100A9-Homo-59, S100A9-Homo-214, and S100A9-Homo-UTR-507 significantly inhibited the expression of endogenous S100A9 gene in A431 cells.

[0085] siRNAs BACH1-Homo / Mus-1, BACH1-Homo / Mus-2, BACH1-Homo-1036, BACH1-Homo-292, BACH1-Homo-591, and BACH1-Homo-890 significantly inhibited the expression of endogenous Bach1 gene in CAL27 cells.

[0086] Example 2 Cell Culture and Transfection Cell lines and culture conditions: Human tongue squamous cell carcinoma cell line CAL27, human skin squamous cell carcinoma cell line A431, and human embryonic kidney cell line 293T were all purchased from the American Type Culture Collection (ATCC). Cells were cultured in DMEM high-glucose medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco), 100 U / mL penicillin, and 100 μg / mL streptomycin (Gibco) at 37°C in a 5% CO2 incubator. When cell confluence reached 80%-90%, cells were passaged or plated for transfection experiments.

[0087] Cell plating: Collect cells in the logarithmic growth phase, digest them with 0.25% trypsin-EDTA solution, collect the cells, resuspend them in complete culture medium, and count them. Spread the cells in a plate at 1 × 10⁶ cells per well. 5 Cells were seeded at a density of 100 cells per well in 12-well plates, with 1 mL of complete culture medium added to each well. The plates were incubated overnight in an incubator. Transfection was performed when the cell confluence reached 50%-70%.

[0088] siRNA transfection: using the liposome transfection reagent Lipofectamine ™ Transfection was performed using Invitrogen in 2000.

[0089] Preparation of the siRNA-Lipofectamine complex: Dissolve the siRNA to be transfected in DEPC-treated water to prepare a 20 μM stock solution. Take a 1.5 mL sterile EP tube, add an appropriate amount of siRNA stock solution and Opti-MEM. ® Prepare 200 μL of serum-reduced culture medium (Gibco) and mix gently (Mixture A). In a separate EP tube, add 4 μL of Lipofectamine. ™ 2000 and 196 μL Opti-MEM ® I. Gently mix and let stand at room temperature for 5 minutes (Mixture B). Mix Mixture A and Mixture B, gently pipette to mix, and let stand at room temperature for 20 minutes to form the transfection complex.

[0090] Transfection procedure: Discard the cell culture supernatant from the 12-well plate and add 600 μL of fresh Opti-MEM to each well.® I. Next, add 400 μL of the transfection complex dropwise to each well, making the total volume of each well 1 mL, with a final siRNA concentration of 10 nM. Gently shake the plate to distribute the complex evenly. After incubating the cells in an incubator for 6 hours, discard the medium containing the transfection complex and replace it with 1 mL of fresh complete medium. Continue incubation for another 48 hours in preparation for subsequent assays. Three replicates were prepared for each siRNA, and a control group was set up with an untreated control and a control group transfected with negative control siRNA (NC, whose sequence does not target any known mammalian gene).

[0091] Example 3: Real-time quantitative PCR (qPCR) detection of gene expression levels Total RNA extraction: 48 hours after transfection, the culture medium in the 12-well plate was aspirated, and the cells were washed once with pre-chilled PBS buffer. 1 mL of RNAiso Plus (Takara) lysis buffer was added to each well, and the cells were incubated at room temperature for 5 minutes. The cells were then thoroughly lysed by pipetting, and the lysate was collected into RNase-free 1.5 mL centrifuge tubes. 200 μL of chloroform was added to the tubes, and the mixture was vigorously vortexed for 15 seconds and incubated at room temperature for 5 minutes. Subsequently, the cells were centrifuged at 12,000 × g for 15 minutes at 4°C. The supernatant was carefully aspirated into a new RNase-free centrifuge tube, and an equal volume of isopropanol was added. The mixture was inverted and incubated at room temperature for 10 minutes. The supernatant was then discarded at 12,000 × g for 10 minutes at 4°C, and a white RNA precipitate was visible. The precipitate was washed with 1 mL of pre-chilled 75% ethanol (prepared with DEPC water), and the cells were centrifuged at 7,500 × g for 5 minutes at 4°C, and the supernatant was discarded. The precipitate was dried at room temperature, and the RNA was dissolved in 20-40 μL of DEPC-treated water. The RNA concentration and purity (A260 / A280 ratio between 1.8 and 2.1) were determined using a NanoDrop 2000 spectrophotometer.

[0092] Reverse transcription to synthesize cDNA: using PrimeScript ™ Reverse transcription was performed using the RT Master Mix (Perfect Real Time) kit (Takara). The reaction volume (20 μL) was as follows: 4 μL of 5× PrimeScript RT Master Mix, 1 μg of Total RNA (adjust volume according to RNA concentration), and RNase-free dH2O to a final volume of 20 μL. Reaction conditions: 37℃ for 15 minutes (reverse transcription), 85℃ for 5 seconds (enzyme inactivation), and storage at 4℃. The resulting cDNA was diluted 5-fold for qPCR.

[0093] qPCR reaction: Performed using the TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) kit (Takara) on a StepOnePlus™ Real-Time PCR system (Applied Biosystems). Reaction volume (20 μL): 10 μL TB Green Premix Ex Taq II (2×), 0.8 μL each of forward and reverse primers (10 μM), 0.4 μL ROX Reference Dye (50×), 2 μL cDNA template, and 6 μL RNase-free dH2O.

[0094] Reaction procedure: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds, 60℃ annealing / extension for 34 seconds, for a total of 40 cycles. After the reaction, melting curve analysis was performed (95℃ for 15 seconds, 60℃ for 1 minute, 95℃ for 15 seconds) to verify the specificity of the amplified product. Three technical replicates were set up for each sample.

[0095] Example 4: Data Processing and Statistical Analysis Use 2 ⁻ΔΔCt The method calculates the relative expression levels of each gene. First, the Ct difference between the target gene and the internal reference gene (GAPDH) for each sample is calculated (ΔCt = Ct(target gene) - Ct(GAPDH)). Then, the difference between ΔCt in the experimental group (siRNA treatment) and the control group (negative control NC) is calculated (ΔCt = ΔCt(experimental group) - ΔCt(control group)). Finally, the relative expression levels are calculated using a 2-1 ratio. ⁻ΔΔCt The expression level of the target gene in the experimental group relative to the control group is represented. All data are expressed as mean ± standard deviation (Mean ± SD). Statistical analysis was performed using GraphPad Prism 8.0 software. One-way ANOVA was used for comparisons between groups. p < 0.05 indicated a statistically significant difference, p < 0.01 indicated a highly statistically significant difference, and p < 0.001 indicated a very highly statistically significant difference.

[0096] Example 5: Verification of siRNA silencing effect Following the experimental steps in Examples 2-4, each designed siRNA was transfected into the corresponding cell lines, and its inhibitory effect on the mRNA level of the target genes was detected. The specific results are as follows: IL1A gene silencing effect: After transfecting CAL27 cells with six siRNAs targeting IL1A, qPCR results showed that all six siRNAs significantly inhibited IL1A mRNA expression compared with the negative control group. Among them, IL1A-Homo / Mus-1, IL1A-Homo-473, IL1A-Homo-554, and IL1A-Homo-771 showed particularly significant inhibitory effects, with inhibition rates exceeding 80% (*p < 0.001). Figure 1 As shown.

[0097] IL1B gene silencing effect: After transfecting CAL27 cells with five siRNAs targeting IL1B, qPCR results showed that all five siRNAs significantly inhibited IL1B mRNA expression (*p < 0.01), with IL1B-Homo / Mus-1, IL1B-Homo-111, and IL1B-Homo-752 showing inhibition rates exceeding 85% (*p < 0.001). Figure 2 As shown.

[0098] IL6 gene silencing effect: After transfecting CAL27 cells with five siRNAs targeting IL6, qPCR results showed that all five siRNAs significantly inhibited IL6 mRNA expression (*p < 0.01). Among them, IL6-Homo-262 and IL6-Homo-365 showed the strongest inhibitory effects, with inhibition rates exceeding 90% (*p < 0.001). Figure 3 As shown.

[0099] HMGB1 gene silencing effect: After transfecting 293T cells with three siRNAs targeting HMGB1, qPCR results showed that all three siRNAs significantly inhibited HMGB1 mRNA expression (*p < 0.001), with inhibition rates all above 85%. Figure 4 As shown.

[0100] S100A8 gene silencing effect: After transfecting A431 cells with three siRNAs targeting S100A8, qPCR results showed that all three siRNAs significantly inhibited the expression of S100A8 mRNA (*p < 0.001), with S100A8-Homo-144 and S100A8-Homo-235 showing inhibition rates exceeding 90%. Figure 5 As shown.

[0101] S100A9 gene silencing effect: After transfecting A431 cells with three siRNAs targeting S100A9, qPCR results showed that all three siRNAs significantly inhibited the expression of S100A9 mRNA (*p < 0.001), with inhibition rates all above 85%. Figure 6 As shown.

[0102] BACH1 gene silencing effect: After transfecting CAL27 cells with six siRNAs targeting BACH1, qPCR results showed that all six siRNAs significantly inhibited BACH1 mRNA expression (*p < 0.01). Among them, BACH1-Homo / Mus-1, BACH1-Homo / Mus-2, BACH1-Homo-1036, BACH1-Homo-292, and BACH1-Homo-591 showed inhibition rates exceeding 80% (*p < 0.001). Figure 7 As shown.

[0103] The above experimental data fully demonstrate that the siRNA molecules provided by this invention can efficiently and specifically inhibit the expression of their respective targeted pyroptosis-related inflammatory response genes, and have the potential to become drugs for treating related diseases.

[0104] Example 6: Synergistic inhibitory effect of combined siRNAs To verify the synergistic effect of different siRNA combinations, the following experiment was designed: Three optimal siRNAs targeting IL1B, IL6, and S100A8 (selected from IL1B-Homo / Mus-1, IL6-Homo-262, and S100A8-Homo-144, respectively) were mixed in equimolar ratios to form siRNA compositions. CAL27 cells were divided into four groups: a negative control group, an IL1B siRNA monotherapy group, an IL6 siRNA monotherapy group, an S100A8 siRNA monotherapy group, and a three-in-one combination therapy group. The total siRNA concentration in each group was maintained at 10 nM (the concentration of each siRNA in the combination group was 3.33 nM). Forty-eight hours after transfection, the mRNA expression levels of IL1B, IL6, and S100A8 were measured. The results showed that the expression of IL1B, IL6, and S100A8 genes was significantly inhibited in the combination therapy group, with inhibitory effects comparable to or even slightly better than those of the individual drug groups (using 10 nM single drug) (*p < 0.05). This indicates that, at the same total dose, combination therapy can effectively inhibit multiple inflammatory factors simultaneously, demonstrating potential for synergistic application. These results suggest that the siRNA composition provided by this invention can be used to prepare therapeutic drugs for complex diseases mediated by multiple inflammatory factors.

[0105] Example 7 Preparation of pharmaceutical composition (lipid nanoparticle encapsulation) The siRNA molecules (such as HMGB1-Homo-520) or their compositions provided by this invention are encapsulated using lipid nanoparticle (LNP) technology to improve their in vivo stability and delivery efficiency. The specific method is as follows: Lipid preparation: Dissolve ionizable cationic lipids (such as DLin-MC3-DMA), phospholipids (such as DSPC), cholesterol, and polyethylene glycol-modified lipids (such as PEG2000-DMG) in anhydrous ethanol at a certain molar ratio (e.g., 50:10:38.5:1.5).

[0106] Nucleic acid preparation: Dissolve siRNA in citrate buffer at pH 4.0 to form an aqueous phase.

[0107] Mixing and Encapsulation: Using a microfluidic mixing device, the ethanol phase of lipids and the aqueous phase of siRNA are rapidly mixed at a certain flow rate ratio (e.g., 1:3), so that the lipids self-assemble into lipid nanoparticles encapsulating siRNA under pH 4.0 conditions.

[0108] Purification and Concentration: After mixing, the external phase is replaced with PBS buffer (pH 7.4) using dialysis or tangential flow filtration, simultaneously removing residual ethanol and free siRNA, and concentrating the LNP. The final product is an siRNA-LNP formulation with uniform particle size (typically approximately 80-120 nm) and encapsulation efficiency greater than 90%. This formulation can be used for in vivo pharmacodynamic studies in animal models, laying the foundation for clinical translation.

[0109] In summary, the siRNA of pyroptosis-related inflammatory response genes and its applications provided by this invention have been verified through numerous experiments, demonstrating their efficient and specific gene silencing effects. Furthermore, this invention provides methods for combined use and preparation of pharmaceutical formulations.

[0110] The principle of this invention is as follows: This invention provides a set of small interfering RNAs (siRNAs) targeting pyroptosis-related inflammatory response genes and their applications. These pyroptosis-related inflammatory response genes include IL1A, IL1B, IL6, HMGB1, S100A8, S100A9, and BACH1. This invention designs and synthesizes specific siRNA sequences targeting the above genes, and verifies their effectiveness through cell transfection and real-time quantitative PCR, demonstrating that these siRNAs can efficiently and specifically inhibit the mRNA expression levels of the corresponding genes. This invention also provides compositions containing the siRNAs, pharmaceutical compositions, and their application in the preparation of drugs for treating diseases mediated by pyroptosis-related inflammatory response genes (especially inflammatory diseases). The siRNAs and compositions of this invention provide a new and effective strategy for treating diseases associated with excessive activation of pyroptosis-related inflammatory responses, and have broad application prospects.

[0111] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A nucleic acid molecule, characterized in that, The nucleic acid molecule is a double-stranded RNA molecule containing a sense strand and an antisense strand. The nucleic acid molecule can target and inhibit the expression of pyroptosis-related inflammatory response genes, which are selected from one or more of the following: IL1A, IL1B, IL6, HMGB1, S100A8, S100A9, and BACH1.

2. A nucleic acid molecule according to claim 1, characterized in that, The sequence of the nucleic acid molecule is selected from any of the following groups: (1) siRNA targeting the human HMGB1 gene, the sense strand of which is shown in SEQ ID NO:1 and the antisense strand of which is shown in SEQ ID NO:2; (2) siRNA targeting the human HMGB1 gene, the sense strand of which is shown in SEQ ID NO:3 and the antisense strand of which is shown in SEQ ID NO:4; (3) siRNA targeting the human HMGB1 gene, the sense strand of which is shown in SEQ ID NO:5 and the antisense strand of which is shown in SEQ ID NO:6; (4) siRNA targeting the human S100A8 gene, the sense strand of which is shown in SEQ ID NO:7 and the antisense strand of which is shown in SEQ ID NO:8; (5) siRNA targeting the human S100A8 gene, the sense strand of which is shown in SEQ ID NO:9 and the antisense strand of which is shown in SEQ ID NO:10; (6) siRNA targeting the human S100A8 gene, the sense strand of which is shown in SEQ ID NO:11 and the antisense strand of which is shown in SEQ ID NO:12; (7) siRNA targeting the human S100A9 gene, the sense strand of which is shown in SEQ ID NO:13 and the antisense strand of which is shown in SEQ ID NO:14; (8) siRNA targeting the human S100A9 gene, the sense strand of which is shown in SEQ ID NO:15 and the antisense strand of which is shown in SEQ ID NO:16; (9) siRNA targeting the human S100A9 gene, the sense strand of which is shown in SEQ ID NO:17 and the antisense strand of which is shown in SEQ ID NO:18; (10) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:19 and the antisense strand of which is shown in SEQ ID NO:20; (11) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:21 and the antisense strand of which is shown in SEQ ID NO:22; (12) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:23 and the antisense strand of which is shown in SEQ ID NO:24; (13) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:25 and the antisense strand of which is shown in SEQ ID NO:26; (14) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:27 and the antisense strand of which is shown in SEQ ID NO:28; (15) siRNA targeting the human BACH1 gene, the sense strand of which is shown in SEQ ID NO:29 and the antisense strand of which is shown in SEQ ID NO:30; (16) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:31 and the antisense strand of which is shown in SEQ ID NO:32; (17) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:33 and the antisense strand of which is shown in SEQ ID NO:34; (18) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:35 and the antisense strand of which is shown in SEQ ID NO:36; (19) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:37 and the antisense strand of which is shown in SEQ ID NO:38; (20) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:39 and the antisense strand of which is shown in SEQ ID NO:40; (21) siRNA targeting the human IL1A gene, the sense strand of which is shown in SEQ ID NO:41 and the antisense strand of which is shown in SEQ ID NO:42; (22) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:43 and the antisense strand of which is shown in SEQ ID NO:44; (23) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:45 and the antisense strand of which is shown in SEQ ID NO:46; (24) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:47 and the antisense strand of which is shown in SEQ ID NO:48; (25) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:49 and the antisense strand of which is shown in SEQ ID NO:50; (26) siRNA targeting the human IL1B gene, the sense strand of which is shown in SEQ ID NO:51 and the antisense strand of which is shown in SEQ ID NO:52; (27) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:53 and the antisense strand of which is shown in SEQ ID NO:54; (28) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:55 and the antisense strand of which is shown in SEQ ID NO:56; (29) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:57 and the antisense strand of which is shown in SEQ ID NO:58; (30) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:59 and the antisense strand of which is shown in SEQ ID NO:60; (31) siRNA targeting the human IL6 gene, the sense strand of which is shown in SEQ ID NO:61 and the antisense strand of which is shown in SEQ ID NO:

62.

3. A composition, characterized in that, The composition comprises at least one nucleic acid molecule as described in claim 1 or 2.

4. The composition according to claim 3, characterized in that, The composition comprises two or more nucleic acid molecules as described in claim 1 or 2, wherein the nucleic acid molecules target different pyroptosis-related inflammatory response genes.

5. A composition according to claim 3 or 4, characterized in that, The composition also contains a pharmaceutically acceptable carrier.

6. The use of a nucleic acid molecule according to claim 1 or 2 or a composition according to any one of claims 3-5 in the preparation of a medicament for treating and / or preventing diseases mediated by pyroptosis-related inflammatory response genes.

7. The application according to claim 6, characterized in that, The diseases mediated by the pyroptosis-associated inflammatory response genes are inflammatory diseases.

8. The application according to claim 7, characterized in that, The inflammatory diseases mentioned are selected from: sepsis, acute pancreatitis, inflammatory bowel disease, rheumatoid arthritis, psoriasis, atherosclerosis, Alzheimer's disease, Parkinson's disease, or inflammatory reactions induced by chemotherapy / radiotherapy.

9. A pharmaceutical composition, characterized in that, The composition comprises a therapeutically effective amount of a nucleic acid molecule as described in claim 1 or 2, or a composition as described in any one of claims 3-5, and pharmaceutically acceptable excipients.

10. A method for inhibiting the expression of pyroptosis-related inflammatory response genes for non-therapeutic purposes, characterized in that, Includes the step of introducing a nucleic acid molecule as described in claim 1 or 2 into a cell.

Images