Spodoptera frugiperda resistant gene cyp6b50 and application thereof
By injecting dsRNA onto the surface of fall armyworm larvae to silence the CYP6B50 gene, combined with chitosan nanocarriers, the problem of pesticide resistance in fall armyworm was solved, and the control effect was improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
- Filing Date
- 2026-01-28
- Publication Date
- 2026-06-12
AI Technical Summary
The fall armyworm has developed resistance to traditional pesticides, resulting in poor control effects. Existing technologies are insufficient to effectively reduce its resistance, thus impacting agricultural production.
A mixture of dsRNA and CS was applied to the surface of fall armyworm larvae using a droplet method to silence the CYP6B50 gene and reduce their resistance to pesticides. Chitosan nanocarriers were used to encapsulate the dsRNA to enhance the effect.
It significantly increased the mortality rate of fall armyworm and reduced its survival rate, achieving the control effect of reducing pesticide use while increasing efficacy.
Smart Images

Figure CN122189015A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the agricultural field, specifically relating to the resistance gene of the fall armyworm. CYP6B50 and its applications. Background Technology
[0002] fall armyworm ( Spodoptera frugiperda Belonging to the genus *Noctuidae* of the family Noctuidae in the order Lepidoptera, this omnivorous agricultural pest is native to tropical and subtropical regions of the Americas. In late December 2018, this pest invaded Yunnan Province in my country and rapidly spread throughout the country, exhibiting an explosive growth trend. Its potential annual economic losses to corn in my country could reach hundreds of millions of US dollars, posing a serious threat to my country's agricultural production.
[0003] Worryingly, the fall armyworm has developed resistance to conventional pesticides. For example, field populations of the fall armyworm have decreased sensitivity to emamectin benzoate at doses ranging from 0.78 to 158.0 μg / mL. Summary of the Invention
[0004] The purpose of this invention is to provide a cloned form from the fall armyworm. CYP6B50 The cDNA sequence of the gene was used to achieve RNAi silencing by applying a mixture of dsRNA and CS to the surface of fall armyworm larvae using a droplet method. CYP6B50 Genes can reduce the resistance of fall armyworm to various pesticides, achieving a control effect of reducing pesticide use while increasing efficacy.
[0005] This invention is achieved through the following technical solution:
[0006] This invention provides a fall armyworm. CYP6B50 The gene, whose nucleotide sequence is shown in SEQ ID NO.1.
[0007] This invention also provides a method to inhibit fall armyworm. CYP6B50 Products that express genes.
[0008] This invention also provides the above-mentioned method for inhibiting fall armyworm. CYP6B50 The application of gene expression products in the preparation of products for any of the following purposes:
[0009] 1) Suppressing the fall armyworm gene CYP6B50 Gene expression;
[0010] 2) Reduce the resistance of fall armyworm to pesticides and increase the mortality rate of fall armyworm larvae;
[0011] 3) Reduce the survival rate of fall armyworm;
[0012] 4) Control fall armyworm.
[0013] Preferably, the product is effective in suppressing the fall armyworm. CYP6B50 dsRNA of gene expression.
[0014] Preferably, the nucleotide sequence of the dsRNA is as shown in SEQ ID NO.2 or SEQ ID NO.3.
[0015] Preferably, the product is an RNA pesticide composed of nanomaterials and dsRNA.
[0016] Further optimization involves dsRNA encapsulated in chitosan nanocarriers.
[0017] The present invention also provides a method for controlling fall armyworm, which involves applying the above-mentioned product to the surface of fall armyworm larvae, causing them to die upon contact.
[0018] Preferably, the fall armyworm larvae are second-instar larvae of the fall armyworm.
[0019] The present invention has the following positive and beneficial technical effects:
[0020] Experiments have shown that this invention has successfully produced the fall armyworm. CYP6B50 The cDNA sequence of the gene was obtained by spotting 1 μL. dsCYP6B50 A mixture of CS and other chemicals was dripped onto the surface of second-instar larvae of the fall armyworm, silencing the fall armyworm. CYP6B50 Genetic factors have led to a significant increase in the mortality rate of the fall armyworm; clearly... dsCYP6B50 When combined with CS, it has important application value in the field of fall armyworm control. Attached Figure Description
[0021] Figure 1 The mortality rate of second-instar larvae of fall armyworm under different concentrations of tetrachlorantraniliprole treatment;
[0022] Figure 2 The mortality rate of second-instar larvae in wild populations treated with different concentrations of tetrachlorantraniliprole is: A. Wengyuan population, B. Lianping population, C. Huadu population.
[0023] Figure 3 It is the gene expression level of second-instar larvae of fall armyworm treated with tetrachlorantraniliprole;
[0024] Figure 4 These represent gene expression levels at different fragments and concentrations of dsRNA. Note: A represents the first fragment of dsCY6B50; B represents the second fragment of dsCY6B50.
[0025] Figure 5 The effect of dsRNA interference on the mortality rate of second-instar larvae of the fall armyworm;
[0026] Figure 6The study investigated the effects of dsRNA combined with CS nanocarriers and pesticides on the mortality rate of second-instar larvae of the fall armyworm. Detailed Implementation
[0027] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention.
[0028] Unless otherwise specified, the techniques used in the embodiments are conventional techniques well known to those skilled in the art. Unless otherwise specified, all materials and reagents used in the following embodiments are commercially available.
[0029] The fall armyworms used in the following examples are susceptible populations in Guangzhou indoors, and were raised in an incubator at the Institute of Plant Protection, Guangdong Academy of Agricultural Sciences, at a temperature of 27±1°C and a humidity of 70±5%.
[0030] Example 1: Efficacy experiment of tetrachlorantraniliprole against fall armyworm.
[0031] The droplet method was used to treat the susceptible population of fall armyworm larvae in the Guangzhou indoor laboratory. Distilled water containing 0.1% (w / w) acetone was used as the diluent to dilute tetrachlorantraniliprole to five different concentrations: 0.2 µg / mL, 0.4 µg / mL, 0.8 µg / mL, 1.6 µg / mL, and 3.2 µg / mL. Twenty second-instar larvae were treated, and 1 µL was dropped onto the dorsal side of the thorax of each larva. This was repeated three times. The larvae were placed in a sterile 24-well plate and kept in a climate chamber for 96 hours. The larvae were considered dead if they did not move when touched with soft forceps. A mortality rate of less than 10% in the control group was considered effective.
[0032] Corrected mortality rate (%) = (Treatment mortality rate - Control mortality rate) / (1 - Control mortality rate) * 100%
[0033] Experimental results are as follows Figure 1 As shown, the LC50 of tetrachlorantraniliprole for fall armyworm was calculated using a linear regression equation. 50 The value was 2.273 µg / mL.
[0034] Example 2: Determination of mortality rate in wild populations under tetrachlorantraniliprole treatment
[0035] The toxicity of tetrachlorantraniliprole in wild populations was determined using the droplet method. Distilled water containing 0.1% (w / w) acetone was used as the diluent to dilute tetrachlorantraniliprole to five concentrations: 0.4 µg / mL, 0.8 µg / mL, 1.6 µg / mL, 3.2 µg / mL, and 6.4 µg / mL. Twenty second-instar larvae were collected, and 1 µL was dropped onto the dorsal side of the thorax of second-instar larvae from wild populations (Wengyuan, Lianping, and Huadu populations). This was repeated three times. The samples were placed in sterile 24-well plates and stored in an artificial climate chamber for 96 hours. The larvae were considered dead when touched with soft forceps; a mortality rate below 10% in the control group was considered effective.
[0036] Corrected mortality rate (%) = (Treatment mortality rate - Control mortality rate) / (1 - Control mortality rate) * 100%
[0037] Experimental results are as follows Figure 2 As shown, (a) the LC50 of tetrachlorantraniliprole for the Wengyuan population was 4.699 µg / mL, (b) the LC50 of tetrachlorantraniliprole for the Lianping population was 5.402 µg / mL, and (c) the LC50 of tetrachlorantraniliprole for the Huadu population was 4.977 µg / mL.
[0038] Example 3: Gene expression levels of second-instar larvae of fall armyworm treated with tetrachlorantraniliprole
[0039] The LC50 value was calculated using the linear regression equations in Example 1 and Example 2, with the results of untreated indoor susceptible populations and wild populations of fall armyworm 2nd instar larvae, and using LC50. 50 Second-instar larvae of the fall armyworm from both indoor and wild populations were used as samples. RNA was extracted and then reverse transcribed into cDNA. Real-time quantitative PCR was performed using the first-strand cDNA as a template and quantitative primers (Table 1) to determine primer specificity. The GADPH gene was selected as an internal control gene, and cycle numbers were obtained using a qPCR instrument to analyze the expression levels of different genes. The reaction system and reaction procedure are shown in Tables 2 and 3.
[0040] Table 1 Quantitative Primer Table
[0041] Table 2 qPCR reaction system
[0042] Table 3 qPCR reaction procedure
[0043] Comparison and calculation of mRNA expression levels:
[0044] The relative expression level of the target gene is 2. -△△Ct ;
[0045] △△Ct = (average Ct of the target gene in the test sample - average Ct of the housekeeping genes in the test sample) (average Ct of the target gene in the control sample - average Ct of the housekeeping genes in the control sample)
[0046] Experimental results are as follows Figure 3 As shown, the control group was the indoor sensitive population, with a gene expression level of 19.54 times; the gene expression level of the Wengyuan population was 23.97 times; the gene expression level of the Lianping population was 25.68 times; and the gene expression level of the Huadu population was 6.42 times.
[0047] Example 4: Gene expression levels of different dsRNA fragments and concentrations
[0048] 1. Using cDNA from the second instar larvae of the common indoor susceptible population of fall armyworm in Guangzhou as a template, PCR amplification was performed using the primers in Table 4 to obtain the PCR amplification product.
[0049] 2. Purify using a DNA gel purification kit (Axygen) and remove impurities according to the instructions.
[0050] 3. Gene cloning was performed using the pEASY-Blunt Zero Cloning Kit (Trans Script® T).
[0051] 4. Extract plasmids according to the instructions of the StarPrep Fast Plasmid Mini Kit (GenStar).
[0052] 5. The dsRNA synthesis method follows the T7 RiboMAX Express RNAi System kit (Promega).
[0053] 6. Using the droplet method, the experimental group consisted of four concentrations of dsCY6B50 fragments (250, 500, 1000, and 2000 ng / μL), diluted to the first and second fragments respectively; the control group consisted of ddH2O treatment on susceptible second-instar larvae of the fall armyworm population in Guangzhou. 1 µL of each solution was applied to 20 second-instar larvae of the fall armyworm, and the procedure was repeated three times. Quantitative real-time PCR was used to verify changes in gene expression levels.
[0054] Table 4 Primers for dsRNA synthesis
[0055] Experimental results are as follows Figure 4 As shown in Figure A, different concentrations were used. dsCYP6B50 The first paragraph of silence CYP6B50 Gene fragment (corresponding to T7) dsCYP6B50 -F1 and T7 dsCYP6B50 -R1, specifically the sequence (SEQ ID NO.2), showed that gene expression levels at concentrations of 250, 500, 1000, and 2000 ng / µL were 1.28, 0.79, 0.63, and 0.24 times that of the control, respectively. The 2000 ng / µL dsRNA concentration had the lowest gene expression among the various dsRNA concentration gradients, thus exhibiting the best interference effect.
[0056] Experimental results are as follows Figure 4 As shown in B, different concentrations were used. dsCYP6B50 The second paragraph of silence CYP6B50 Gene fragment (corresponding to T7) dsCYP6B50-F2 and T7 dsCYP6B50 -R2, specifically the sequence: TACTTGGCCAAAAATCCCGAAAAACAAGATATTCTAATACAAGAAATTGATGAAGTTATACTGAAGCACGATGGCAAATTTTCTTACGAAGCATTGAAAGAAATGAAATATCTAGAGATGGTTTTTGAAGAGACTTTACGTCTGAATCCTATGACAAACGCTGTTGTTAGGAATGCTGCGAGAGATGTGCAGTTGGAAGGTACAGATATCATCGTTCCAAAAAATACTATCCTTGCGATATCTCCATACTCAATCCAGCACGATGAGAAATATTTCCCTGAGCCAGAAAAGTTTAAACCTGAGAGGTTTTCTGCTGAAAACGCGAGGGAAAACCATCCCTGTGCCATGT (SEQ ID NO.2), showed that the gene expression levels at 250, 500, 1000, and 2000 ng / µL were 1.24, 1.43, 0.31, and 0.36 times that of the control, respectively. Therefore, the 1000 ng / µL dsRNA concentration resulted in the lowest gene expression among these dsRNA gradient concentrations, thus exhibiting the best interference effect.
[0057] Example 5: Effect of dsRNA interference on the mortality rate of second instar larvae of the fall armyworm.
[0058] The second fragment of dsCY6B50 was selected (see Example 4). dsCY6B50 was diluted to 2000 ng / µL, and then 2000 ng / µL of dsCY6B50 was used to treat susceptible populations of fall armyworm larvae in the laboratory (control). Figure 5 The dsRNA of the fall armyworm (DRM) was used as the experimental group. The prepared drug solution was applied in 1µL to the dorsal side of the thorax of 20 second-instar fall armyworm larvae. The procedure was repeated 3 times. The mortality rate of the fall armyworm was counted 4 days later.
[0059] Experimental results are as follows Figure 5 As shown, the corrected mortality rate of dsRNA in the indoor population was 8.34%; the corrected mortality rate of dsRNA in the Wengyuan population was 40.02%; the corrected mortality rate of dsRNA in the Lianping population was 19.32%; and the corrected mortality rate of dsRNA in the Huadu population was 17.24%.
[0060] Example 6: Effects of dsRNA combined with CS nanocarrier and pesticides on the mortality rate of second-instar larvae of the susceptible species *Fall Armyworm* in Guangzhou indoor environment.
[0061] 1. Preparation of CS-dsRNA nanocarriers: Dissolve 0.0002 g of chitosan in 1 ml of sodium acetate (NaAc) buffer (0.1 mol / mL, pH 4.5) to obtain 0.02% chitosan working solution; pipette 32 μL of dsRNA (selecting the second fragment of dsCY6B50, see Example 4) into a centrifuge tube, add 2 μL of 2.5 mol / L Na2SO4 to the centrifuge tube and make up to 100 μL with DEPC water, and mix thoroughly; add 100 μL of 0.02% chitosan working solution; place the centrifuge tube in a 55°C water bath for 1 min, quickly transfer to a high-speed vortex mixer and shake for 30 s, let stand for 10 min to obtain CS-dsRNA nanoparticles; detect CS-dsRNA nanoparticles by agarose gel electrophoresis, normally there should be no bands.
[0062] 2. Using the drip method, 0.02% chitosan working solution was used to treat the second instar larvae of the susceptible population of fall armyworm in the laboratory as a control; using the drip method, CS- dsCYP6B50 The first treatment group consisted of second-instar larvae of the susceptible population of fall armyworm in the indoor environment, followed by CS- dsCYP6B50 A second treatment group was prepared by directly spraying a mixture of 0.02% chitosan working solution and tetrachlorantraniliprole (2.273 µg / mL) at a 1:1 volume ratio onto susceptible 2-instar larvae of the fall armyworm population in an indoor environment. A second control group was prepared by directly spraying a mixture of 0.02% chitosan working solution and tetrachlorantraniliprole (2.273 µg / mL) at a 1:1 volume ratio onto susceptible 2-instar larvae of the fall armyworm population in an indoor environment. Mortality rates of the fall armyworm were assessed after 4 days.
[0063] Experimental results are as follows Figure 6 As shown, the mortality rate of CS was 13.33%, and CS- dsCYP6B50 The mortality rate was 33.33%, while the mortality rate of CS-tetrachlorantraniliprole was 53.33%. dsCYP6B50 The mortality rate of tetrachlorantraniliprole is 63.33%.
[0064] SEQ ID NO.1
Claims
1. A type of fall armyworm CYP6B50 Genes, characterized by, The nucleotide sequence is shown in SEQ ID NO.
1.
2. A method for inhibiting the fall armyworm as described in claim 1 CYP6B50 Products that express genes.
3. The product according to claim 2, characterized in that, The product described is effective in suppressing the fall armyworm. CYP6B50 dsRNA of gene expression.
4. The product according to claim 3, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO.2 or SEQ ID NO.
3.
5. The product according to claim 3 or 4, characterized in that, The product described is an RNA pesticide composed of nanomaterials and dsRNA.
6. The product according to claim 3 or 4, characterized in that, The product described is dsRNA encapsulated in chitosan nanocarriers.
7. The use of the product according to claim 2, 3, 4, 5 or 6 in the preparation of a product for any of the following purposes: 1) Suppressing the fall armyworm gene CYP6B50 Gene expression; 2) Reduce the resistance of fall armyworm to pesticides and increase the mortality rate of fall armyworm larvae; 3) Reduce the survival rate of fall armyworm; 4) Control fall armyworm.
8. A method for controlling fall armyworm, characterized in that, The product described in claim 2, 3, 4, 5 or 6 is dripped onto the surface of fall armyworm larvae, causing them to die upon contact.
9. The method according to claim 8, characterized in that, The fall armyworm larvae mentioned are second-instar larvae of the fall armyworm.