Gene osubc15 for controlling grain length of rice and genetic engineering application thereof

By cloning the rice OsUBC15 gene and knocking it out using CRISPR/Cas9 technology, the uncertainty in rice grain length regulation was resolved, resulting in a significant increase in rice grain length and promoting the high-yield and high-quality development of rice breeding.

CN122189017APending Publication Date: 2026-06-12NANJING AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2024-12-11
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

In the current technology, the regulation mechanism of rice grain length is not fully understood, which affects the improvement of rice yield and quality.

Method used

By cloning the OsUBC15 gene and using CRISPR/Cas9 technology to knock out or silence the OsUBC15 gene, its expression level can be altered to increase rice grain length.

🎯Benefits of technology

It significantly increases rice grain length, provides a new resource for high-yield and high-quality rice, and provides a theoretical basis for rice molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189017A_ABST
    Figure CN122189017A_ABST
Patent Text Reader

Abstract

The present application relates to the field of plant genetic engineering technology, and relates to cloning of OsUBC15 gene and application of the gene in regulating rice kernel type. The cDNA sequence of the gene is as shown in SEQ ID NO. 1. It is found that knocking out rice gene OsUBC15 can significantly increase the length of rice kernels, and the application of the gene in genetic improvement of rice kernel type and creation of germplasm resources is proposed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the cloning of the OsUBC15 gene and its application in regulating grain shape in rice. Background Technology

[0002] Rice is one of the world's major food crops and an important agricultural crop in my country. However, with rapid global population growth and declining arable land area, breeding higher-yielding and higher-quality rice varieties remains a primary goal for breeders. Rice yield mainly involves the number of effective panicles, the number of grains per panicle, and the thousand-grain weight. Among these, grain shape is regulated by multiple genetic networks and has three main components: grain length, grain width, and grain thickness. Grain length is the most important indicator and the most reflective of grain traits. The discovery, localization, and cloning of related genes have become one of the most popular research areas in rice breeding.

[0003] Rice grain length is mainly regulated by major or minor genes. A summary and analysis of the QTL sites that have been identified so far reveals that they mainly involve plant hormone signal transduction pathways, ubiquitin-protein mediating pathways, G protein signal transduction pathways, MAPK signaling pathways, and transcriptional regulatory factors, which control cell division and elongation, and thus control grain length.

[0004] Brassinosteroids (BRs) are a class of steroid hormones found in plants. Recent studies have shown that BR biosynthesis or signal transduction, targets of the BR signaling pathway, and regulators of the BR pathway can directly regulate many key agronomic traits in rice, such as tillering, leaf angle, and grain size (Tong and Chu, 2012). Grain size is a crucial agronomic trait closely related to rice yield and quality; therefore, research on BR biosynthesis and signal transduction pathways is of great significance. D61 encodes the BR signal receptor OsBRI1. Its deletion mutant d61 exhibits a phenotype of inhibited cell division and elongation, leading to reduced grain length (Morinaka et al., 2006). BIN2 has a homolog in rice called OsGSK2, which is also a negative regulator of BR and similarly plays a role in negatively regulating grain length (Tong et al., 2012). qGL3, a homolog of BSU1, a positive regulator of the Arabidopsis thaliana BR signaling pathway, is found in rice. However, overexpression of qGL3 leads to a loss-of-BR function phenotype. The rare mutant gene qgl3... N411OsBZR1 contributes to grain length (Gao et al. 2018). Overexpression of OsBZR1 increases grain length / width / weight, possibly due to enhanced BR signaling, which affects the transcription of downstream genes in the pathway and thus impacts seed development (Zhu et al. 2015). qGL3 can also induce phosphorylation of the 14-3-3 protein OsGF14b, thereby inhibiting OsBZR1 function by promoting cytoplasmic retention and suppressing transcriptional activation activity (Gao et al. 2022). Therefore, studying qGL3 and its closely related genes is of great significance for understanding the regulatory mechanisms of rice grain length.

[0005] Our laboratory previously used m-qgl3 and NIL. qgl3 Phosphorylated proteomics screening was performed on the qGL3 gene and its corresponding wild-type. GO analysis was conducted on cytosolic proteins, and a preliminary regulatory network of qGL3 was constructed. Simultaneously, using qGL3 as bait, yeast two-hybrid screening analysis was used to study proteins interacting with qGL3, and a ubiquitin-conjugating enzyme, OsUBC15, was screened. However, the regulatory effects and mechanisms of this gene on more traits in rice still require further investigation. Summary of the Invention

[0006] The purpose of this invention is to disclose a clone of the rice grain length regulating gene OsUBC15 and the application of its encoded protein in rice grain length.

[0007] The first objective of this invention is to provide the application of the OsUBC15 gene in regulating rice grain shape, the cDNA sequence of which is shown in SEQ ID NO.1.

[0008] Furthermore, the coding region of the rice gene OsUBC15 is shown in SEQ ID NO.2.

[0009] A second objective of this invention is to provide the application of the OsUBC15 protein in regulating rice grain shape, the amino acid sequence of which is shown in SEQ ID NO.3.

[0010] Furthermore, knocking out or silencing the rice gene OsUBC15 or inhibiting the expression of OsUBC15 protein can increase rice grain length.

[0011] Furthermore, a CRISPR / Cas9 knockout vector for the rice OsUBC15 gene was constructed, and deletion mutants of the rice OsUBC15 gene that were knocked out or silenced were obtained.

[0012] Furthermore, the rice OsUBC15 gene CRISPR / Cas9 knockout vector was prepared using the following method:

[0013] (1) Based on the OsUBC15 gene nucleotide sequence SEQ ID NO.1, target sites were designed and PCR primers were designed for amplification to obtain DNA fragments containing the above target sites.

[0014] (2) The above product fragment was ligated into the pHUE411 vector to obtain the rice OsUBC15 gene CRISPR / Cas9 knockout vector pHUE411-OsUBC15.

[0015] Further, the target site sequence in step (1) is: target site 1 shown in SEQ ID NO.4: "CTCAAGGAGCTCAAGGACC" and / or target site 2 shown in SEQ ID NO.5: "CAGATAGCCCTTATGCTGG".

[0016] Furthermore, the PCR primer sequences in step (1) are as follows:

[0017] OsUBC15-BsF:AATAATGGTCTCAGGCGCTCAAGGAGCTCAAGGACC (SEQ ID NO. 6);

[0018] OsUBC15-F0:GCTCAAGGAGCTCAAGGACCGTTTTAGAGCTAGAAATAGC (SEQ ID NO.7);

[0019] OsUBC15-R0: CCAGCATAAGGGCTATCTGCGCTTCTTGGTGCC (SEQ ID NO. 8);

[0020] OsUBC15-BsR:ATTATTGGTCTCTAAACCCAGCATAAGGGCTATCTG (SEQ ID NO. 9).

[0021] The third objective of this invention is to provide the application of the aforementioned rice OsUBC15 gene CRISPR / Cas9 knockout vector in increasing rice grain length through genetic engineering.

[0022] The fourth objective of this invention is to provide the application of the aforementioned CRISPR / Cas deletion mutant of the rice OsUBC15 gene knockout or silence in increasing rice grain length through genetic engineering.

[0023] To further investigate the molecular network of qGL3 regulating BR and the molecular mechanism of rice grain length, this invention used qGL3 / OsPPKL1 as a bait protein to screen a cDNA expression library of rice young panicles, obtaining a gene encoding an E2 ubiquitin-binding enzyme, OsUBC15. Knocking out OsUBC15 in rice using gene editing technology significantly increased rice grain length, providing a theoretical basis for rice molecular breeding.

[0024] Beneficial effects

[0025] 1. This invention discloses the application of the rice OsUBC15 gene in rice grain shape genetic engineering. This gene comes from rice (Oryza sativa L.). Knocking out this gene can increase rice grain length, which is beneficial to the improvement of rice grain length.

[0026] 2. The rice OsUBC15 gene was cloned in this invention, providing new resources for enriching rice genetic engineering research.

[0027] 3. The OsUBC15 gene loss-of-function mutant in this invention has longer grains, providing a new resource for breeding high-yield and high-quality rice. Attached Figure Description

[0028] Figure 1 CRISPR / Cas9 knockout vector pHUE411;

[0029] Figure 2 Sequence analysis of mutation sites in OsUBC15 gene-edited materials;

[0030] Figure 3 Identification of OsUBC15 gene-edited material strains;

[0031] Figure 3 Identification of Acr-osubc15-1 material strains;

[0032] Figure 3 Identification of B cr-osubc15-2 material strains;

[0033] Figure 4 Phenotypic diagram of grain length in wild-type rice plants of Zhonghua 11 (WT) and OsUBC15 knockout mutants;

[0034] Figure 4 Comparison of seeds of A Zhonghua 11 (WT) and OsUBC15 knockout mutant;

[0035] Figure 4 Statistical graph of grain length of B-type flower 11 (WT) and OsUBC15 knockout mutant. Detailed Implementation

[0036] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0037] Example 1. Construction of OsUBC15 gene CRISPR / Cas9 rice knockout vector

[0038] (1) Screening on the website “MMEJ-KO(scau.edu.cn)” yielded target 1 for the rice gene OsUBC15: “CTCAAGGAG CTCAAGGACC (SEQ ID NO.4)”, and target 2: “CAGATAGCCCTTATGCTGG (SEQ ID NO.5)”. The targets end in NGG, indicating strong non-specificity and low off-target rate. Further primer selection was performed, and the primer sequences are as follows:

[0039] OsUBC15-BsF:AATAATGGTCTCAGGCGCTCAAGGAGCTCAAGGACC (SEQ ID NO. 6);

[0040] OsUBC15-F0:GCTCAAGGAGCTCAAGGACCGTTTTAGAGCTAGAAATAGC (SEQ ID NO.7);

[0041] OsUBC15-R0: CCAGCATAAGGGCTATCTGCGCTTCTTGGTGCC (SEQ ID NO. 8);

[0042] OsUBC15-BsR:ATTATTGGTCTCTAAACCCAGCATAAGGGCTATCTG (SEQ ID NO. 9).

[0043] (2) PCR amplification: Four-primer PCR amplification was performed using pCBC-MT1T2 as a template. OsUBC15-BsF / OsUBC15-BsR were the normal primer concentrations; OsUBC15-F0 / OsUBC15-R0 were diluted 20-fold. The PCR system is as follows:

[0044]

[0045] The PCR reaction conditions were 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 30 s, 72℃ for 5 min, and 30 cycles.

[0046] (3) Recover and purify the PCR product from the previous step, and establish the following enzyme digestion and ligation system:

[0047]

[0048] The PCR reaction conditions were 37℃ for 5 hours, 50℃ for 5 minutes, and 80℃ for 10 minutes.

[0049] The above product fragment was ligated into the pHUE411 vector to obtain the rice OsUBC15 gene CRISPR / Cas9 knockout vector pHUE411-OsUBC15( Figure 1 ).

[0050] (4) The knockout vector pHUE411-OsUBC15 was transformed into DH5α competent cells, plated on kanamycin LB agar plates, and incubated at 37°C for 24 h. Single colonies were picked for colony PCR identification using primers OsU3-FD3 and TaU3-RD, and then sent to the company for sequencing confirmation using primers OsU3-FD3 and TaU3-FD2. The required primers are as follows:

[0051] OsU3-FD3: GACAGGCGTCTTCTACTGGTGCTAC (SEQ ID NO. 10);

[0052] TaU3-RD: CTCACAAATTATCAGCACGCTAGTC (SEQ ID NO. 11);

[0053] TaU3-FD2: TTGACTAGCGTGCTGATAATTTGTG (SEQ ID NO. 12).

[0054] The bacterial culture that successfully matched the target sequence was used for propagation and transformed into Agrobacterium to construct transgenic materials, obtaining OsUBC15 loss-of-function mutants cr-osubc15-1 and cr-osubc15-2.

[0055] Example 2: Identification of gene-edited transgenic lines of OsUBC15

[0056] Design primers that target the OsUBC15 gene site:

[0057] CR-OsUBC15-F1: TCCAGAACCTCACACGTCAC (SEQ ID NO. 13);

[0058] CR-OsUBC15-R1:CCCCTCCACTTGCACAGAAA (SEQ ID NO. 14);

[0059] CR-OsUBC15-F2: CCCTACTTTGGGATGGCTGG (SEQ ID NO. 15);

[0060] CR-OsUBC15-R2: CGGTATGGACGCAGCATTTG (SEQ ID NO. 16).

[0061] Total DNA was extracted from OsUBC15 gene-edited transgenic plants and wild-type Zhonghua 11 (ZH11). PCR amplification was performed on the DNA of OsUBC15 gene-edited transgenic plants and ZH11 using primers CR-OsUBC15-F1 / CR-OsUBC15-R1 and CR-OsUBC15-F2 / CR-OsUBC15-R2. Target fragment 1 (SEQ ID NO.17), 392 bp in length, was used to detect mutations at target site 1; target fragment 2 (SEQ ID NO.18), 739 bp in length, was used to detect mutations at target site 2. Products with the correct band size were sent to the company for sequencing. The sequencing results were used to identify the OsUBC15 gene-edited transgenic lines. Two different mutation types were obtained for target site 2, both involving a single-base insertion of OsUBC15. Figure 2 This ultimately leads to premature termination of protein translation. Figure 3 ).

[0062] Example 3: Observation of the grain phenotype of OsUBC15 gene-edited material

[0063] The gene-edited material of OsUBC15 from Example 2 and wild-type Zhonghua 11 were planted at the Baima Teaching Base of Nanjing Agricultural University. Each line was planted in two rows with eight plants per row, and conventional field management was implemented.

[0064] After the rice matured, seeds of the mutant lines cr-osubc15-1 and cr-osubc15-2 of Zhonghua 11 and OsUBC15 were collected and dried in an oven at 42℃ for 5 days before seed analysis. Thirty mature and plump grains were randomly selected from each sample, and the grain length was measured using calipers. The average length was calculated as the grain length of that sample.

[0065] The results are as follows Figure 4 As shown, compared with the wild-type Zhonghua 11, the CRISPR / Cas9 plants of OsUBC15 had significantly larger grain lengths than the wild-type.

[0066] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the OsUBC15 gene in regulating rice grain shape, characterized by, The cDNA sequence of the OsUBC15 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The coding region of the rice gene OsUBC15 is shown in SEQ ID NO.

2.

3. The application of OsUBC15 protein in regulating rice grain shape, characterized by: The amino acid sequence of the OsUBC15 protein is shown in SEQ ID NO.

3.

4. The application according to any one of claims 1 to 3, characterized in that, Knocking out or silencing the rice gene OsUBC15 or inhibiting the expression of OsUBC15 protein can increase rice grain length.

5. The application according to claim 4, characterized in that, Constructing the rice OsUBC15 gene using CRISPR / Cas9 The vector was knocked out, and deletion mutants of the rice OsUBC15 gene were obtained by knocking out or silencing the gene.

6. According to claim 5, the rice OsUBC15 gene CRISPR / Cas9 knockout vector is prepared using the following method: (1) Based on the OsUBC15 gene nucleotide sequence SEQ ID NO.1, target sites were designed and PCR primers were designed for amplification to obtain DNA fragments containing the above target sites. (2) The above product fragment was ligated into the pHUE411 vector to obtain the rice OsUBC15 gene CRISPR / Cas9. Knockout vector pHUE411-OsUBC15.

7. The application according to claim 6, characterized in that, The target site sequences in step (1) are: target site 1 shown in SEQ ID NO.4: CTCAAGGAGCTCAAGGACC and / or target site 2 shown in SEQ ID NO.5: CAGATAGCCCTTATGCTGG (SEQ ID NO. 4).

8. The application according to claim 6, characterized in that, The PCR primer sequences in step (1) are as follows: OsUBC15-1BsF:AATAATGGTCTCAGGCGCTCAAGGAGCTCAAGGACC (SEQ ID NO.6); OsUBC15-1F0:GCTCAAGGAGCTCAAGGACCGTTTTAGAGCTAGAAATAGC (SEQ ID NO.7); OsUBC15-1R0: CCAGCATAAGGGCTATCTGCGCTTCTTGGTGCC (SEQ ID NO. 8); OsUBC15-1BsR:ATTATTGGTCTCTAAACCCAGCATAAGGGCTATCTG (SEQ ID NO. 9).

9. The application of the rice OsUBC15 gene CRISPR / Cas9 knockout vector as described in claim 5 in increasing rice grain length through genetic engineering.

10. The application of the CRISPR / Cas deletion mutant of the rice OsUBC15 gene knocked out or silenced as described in claim 5 in increasing rice grain length through genetic engineering.