Superior haplotype of gene gmjmj36 significantly improves soybean salt tolerance

By identifying and utilizing the superior allele GmJMJ36Hap2 of the gene GmJMJ36, the KASP molecular marker was developed, which solved the problem of low salt tolerance in soybeans, enabled efficient breeding and screening of salt-tolerant soybean varieties, and improved the salt tolerance of soybeans.

CN122189028APending Publication Date: 2026-06-12NANJING AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2026-04-24
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Soybeans have low tolerance to salt stress and few existing genes, which has led to slow progress in the breeding of salt-tolerant soybean varieties. There is an urgent need to explore salt-tolerant candidate genes and develop molecular marker-assisted breeding technology to address the challenges of salinization.

Method used

We identified the superior allele GmJMJ36Hap2 of the gene GmJMJ36, developed the KASP molecular marker, and improved the salt tolerance of soybeans by overexpressing GmJMJ36Hap2 or silencing GmJMJ36Hap1 using recombinant expression vectors and recombinant bacteria. We also conducted haplotype analysis and screening using the SNP site Chr19_43080069 and developed specific molecular markers for screening salt-tolerant plants.

Benefits of technology

It provides molecular marker-assisted breeding technology for salt-tolerant soybean varieties, which significantly improves the salt tolerance of soybeans, reduces breeding workload, shortens the breeding process, and provides an efficient tool for the research and application of salt tolerance traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a superior haplotype of the gene GmJMJ36 that significantly improves salt tolerance in soybeans. GmJMJ36 For genes GmJMJ36 Hap1 or GmJMJ36 Hap2 Among them, genes GmJMJ36 Hap2 The genome sequence is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2; gene GmJMJ36 Hap1 The genome sequence is shown in SEQ ID NO.8, and the CDS sequence is shown in SEQ ID NO.9. The present invention discloses... GmJMJ36 GmJMJ36 GmJMJ36 GmJMJ36 GmJMJ36 GmJMJ36 GmJMJ36 Gm Salt-tolerant genes, superior haplotypes, and their highly efficient KASP molecular markers associated with salt-tolerant traits have provided strong technical support for the breeding of salt-tolerant soybean varieties. They have profound significance for the study of plant salt tolerance traits and show extremely broad application prospects and high application value in the field of high-yield and salt-tolerant molecular breeding of soybeans.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of gene GmJMJ36 and its encoded protein, the development and breeding application of molecular markers, and particularly to an SNP molecular marker system for regulating the improvement of soybean salt tolerance and its application in crop breeding. Background Technology

[0002] The content in this section is only used to illustrate the technical background relevance of the present invention and does not necessarily constitute prior art.

[0003] Soybeans, as an important dual-purpose crop for both grain and oil, are a core source of high-quality plant protein and edible vegetable oil, and a key raw material for the feed industry. However, soybeans are a low- to medium-salt-tolerant crop, and salt stress affects seed germination efficiency during the seedling stage, root and leaf development during the seedling stage, and stem morphology and agronomic traits at maturity. Given the increasingly severe global salinization problem and the growing urgent need for salt-tolerant soybean breeding, the known genes applicable to salt-tolerant soybean breeding are limited, and progress in developing salt-tolerant soybean varieties is slow. Therefore, identifying salt-tolerant candidate genes and developing molecular marker-assisted breeding technologies have become important strategic directions for addressing the challenges of salinization and ensuring food security. Summary of the Invention

[0004] This study revealed the salt tolerance of the gene GmJMJ36, identified superior alleles of GmJMJ36 that are significantly associated with soybean salt tolerance, developed KASP molecular markers using superior allelic variations of GmJMJ36, and screened for new salt-tolerant soybean materials or varieties, providing important theoretical support for molecular marker-assisted breeding and gene editing improvement of salt-tolerant soybean varieties.

[0005] The first objective of this invention is to provide a salt tolerance-related gene, GmJMJ36. Hap1 or GmJMJ36 Hap2 Among them, the gene GmJMJ36 Hap2 The sequence is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the encoded protein is shown in SEQ ID NO.3; the gene GmJMJ36 Hap1 The genome sequence is shown in SEQ ID NO.8, and the CDS sequence is shown in SEQ ID NO.9.

[0006] The gene GmJMJ36 of this invention Hap1It is a haplotype of the negatively regulating soybean salt tolerance gene GmJMJ36, located at position 43080069bp on soybean chromosome 19 (including the SNP region after filtering and selection, with the reference genome being Wm82.a4.v1). In this haplotype, Hap1 undergoes a G-to-A substitution at 43080069bp, leading to premature termination of protein translation. The soybean salt tolerance of Hap2 is significantly higher than that of Hap1, making it a superior haplotype of GmJMJ36.

[0007] A second objective of this invention is to provide a gene containing GmJMJ36. Hap2 The recombinant expression vector, expression cassette, or recombinant bacteria were used. RNA was extracted from Williams 82 soybean material, and cDNA was obtained by reverse transcription. Homologous arms and homologous recombination primers were designed using the XbaI restriction site. PCR amplification was performed using the cDNA from Williams 82 material as a template. The PCR product was separated by agarose gel electrophoresis and recovered. The vector pGmUbi-GFP-3 × FLAG-35S-Mcherry was digested with XbaI restriction endonuclease, and the vector and target fragment were ligated using homologous recombinase to obtain GmJMJ36. Hap1 The recombinant expression vector was named pGmUbi-GmJMJ36. Hap2 The recombinant expression vector or expression cassette was transformed into engineered bacteria to obtain the recombinant bacteria shown. These bacteria contain any of the genes described above, specifically GmJMJ36. Hap2 Expression cassettes, transgenic cell lines, and recombinant bacteria are all within the scope of protection of this invention.

[0008] A third objective of this invention is to provide an amplification of the aforementioned gene GmJMJ36. Hap2 Primers used to amplify the full length or any fragment of the gene GmJMJ36 are also within the scope of protection of this invention.

[0009] The fourth object of this invention is to provide the gene GmJMJ36 described in this invention. Hap2 The primers described in this invention contain GmJMJ36. Hap2 Application of recombinant expression vectors or recombinant bacteria in improving salt tolerance of soybeans, specifically in improving the salt tolerance of GmJMJ36. Hap2 The expression of [a specific substance] in soybeans.

[0010] The fifth objective of this invention is to provide the silenced gene GmJMJ36 described herein. Hap1 Interfering RNA, containing the silenced gene GmJMJ36 Hap1 RNAi interference vectors or recombinant bacteria for interfering RNA; silencing gene GmJMJ36 Hap1The interfering RNA can be designed according to conventional methods in the art, and in one specific example, the sequence of the interfering RNA is shown in SEQ ID NO.4.

[0011] The sixth objective of this invention is to provide a silenced or knockout gene, GmJMJ36. Hap1 or silence gene GmJMJ36 Hap1 Interfering RNA, containing the silenced gene GmJMJ36 Hap1 The application of RNAi interference vectors or recombinant bacteria to improve the salt tolerance of soybeans, specifically the inhibition of the expression of the gene GmJMJ36 in soybean plants.

[0012] The seventh objective of this invention is to provide a method for regulating salt tolerance in soybeans, specifically by overexpressing the gene GmJMJ36 described in this invention in soybean plants. Hap2 .

[0013] The eighth objective of this invention is to provide a method for regulating salt tolerance in soybeans, specifically by inhibiting the growth of the gene GmJMJ36 described in this invention in soybean plants. Hap1 The expression.

[0014] The ninth objective of this invention is to provide a method for breeding salt-tolerant soybean varieties by overexpressing the gene GmJMJ36 described in this invention in soybean plants. Hap2 Salt-tolerant varieties were obtained.

[0015] The tenth objective of this invention is to provide a method for breeding salt-tolerant soybean varieties, specifically, to inhibit the gene GmJMJ36 described in this invention in soybean plants. Hap1 Salt-tolerant varieties were obtained.

[0016] The eleventh objective of this invention is to provide a screening SNP site Chr19_43080069 for salt-tolerant soybeans. This SNP site is located at 43080069 bp on soybean chromosome 19. The base at this site is either G or A. When the base is A, it indicates a salt-tolerant enhanced variety; when the base is GG, it indicates a salt-sensitive soybean; when the base is AA, it indicates a salt-tolerant soybean; and when the base is GA, it indicates an intermediate type of soybean. The soybean information website is https: / / legacy.soybase.org / , and the chromosome version is Glycine max Wm82.a4.v1.

[0017] The SNP site Chr19_43080069 described in this invention corresponds to the soybean reference genome Wm82.a4.v1.0.

[0018] Haplotype analysis using SNPs present in target genes, and the development of specific KASP molecular markers for screening salt-tolerant plants based on superior haplotypes, is of great significance for reducing the workload of soybean breeding and accelerating the process of molecular breeding for salt tolerance in soybeans. Therefore, the following applications are proposed:

[0019] On the one hand, it provides substances for detecting the SNP site Chr19_43080069, including A1) a set of primers, said set of primers being single-stranded DNA molecules or derivatives thereof shown in SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7; A2) PCR reagents containing said set of primers; and A3) a kit containing either A1) or A2).

[0020] SEQ ID NO .5:5'- GAAGGTGACCAAGTTCATGCT GTAAGTTTTGCTCCTCTTGAGTG-3';

[0021] SEQ ID NO .6:5'- GAAGGTCGGAGTCAACGGATT GTAAGTTTTGCTCCTCTTGAGTA-3';

[0022] SEQ ID NO.7: 5'-AAGCTATCTGATGTGCTCTTCC-3'.

[0023] On the other hand, substances that provide the ability to detect the Chr19_43080069 genotype at the SNP locus can be used in any one or more of the following applications:

[0024] A1: To identify or assist in the identification of salt-tolerant soybean varieties;

[0025] A2: Reagents for preparing, identifying, or assisting in the identification of salt-tolerant soybean varieties;

[0026] A3: Soybean breeding or assisted soybean breeding;

[0027] A4: Preparation of soybean breeding reagents or auxiliary soybean breeding reagents.

[0028] In the above application, the detection of the SNP site Chr19_43080069 genotype specifically refers to the detection of the nucleotide type of the SNP marker Chr19_43080069 in the soybean genome. The genotype of the SNP marker Chr19_43080069 is GG or AA. Specifically, the GG genotype is a homozygous form of the SNP marker Chr19_43080069 in the soybean genome that is G, and the AA genotype is a homozygous form of the SNP marker Chr19_43080069 in the soybean genome that is A.

[0029] In a specific embodiment of the present invention, it was demonstrated by expressing exogenous genes that soybeans with the AA genotype exhibit a stronger salt tolerance phenotype.

[0030] The present invention also provides a method for identifying or assisting in the identification of salt-tolerant soybeans, wherein the method detects the genotype of the soybean SNP site Chr19_43080069 and determines the salt tolerance of the soybean based on the genotype.

[0031] The present invention also provides a method for cultivating salt-tolerant soybeans, which involves detecting the genotype of the SNP site Chr19_43080069 in the genome of the soybean to be tested, and selecting soybeans with the AA genotype for cultivation or hybridization.

[0032] Beneficial effects:

[0033] The salt-tolerant gene GmJMJ36, its superior haplotype, and its highly efficient KASP molecular markers associated with salt tolerance traits disclosed in this invention provide strong technical support for the breeding of salt-tolerant soybean varieties. These molecular markers have profound significance for the study of plant salt tolerance traits and exhibit extremely broad application prospects and high application value in the field of high-yield, salt-tolerant soybean molecular breeding. Attached Figure Description

[0034] Figure 1 For Cl - Results of genome-wide association analysis (GWAS) of the content;

[0035] Figure 2 A schematic diagram showing the results of different haplotype analyses of GmJMJ36;

[0036] Figure 3 Cl for different haplotypes of GmJMJ36 - and chlorophyll content;

[0037] Figure 4 The GmJMJ36 gene in the transgenic plant GmJMJ36 Hap1 -OE and GmJMJ36 Hap2 Expression levels in -OE.

[0038] Figure 5 GmJMJ36 Hap1 -OE and GmJMJ36 Hap2 Phenotypic and physiological parameters of -OE under 0 mM NaCl and 100 mM NaCl conditions;

[0039] Figure 6 GmJMJ36 Hap1 -OE and GmJMJ36 Hap2 -OE under 0 mM NaCl and 100 mM NaCl conditions Na+ / K + Ratio and Cl - content;

[0040] Figure 7 The GmJMJ36 gene in the transgenic plant GmJMJ36 Hap1 -OE and GmJMJ36 Hap1 - Expression levels in RNAi.

[0041] Figure 8 GmJMJ36 Hap1 -OE and GmJMJ36 Hap1 -Phenological and physiological parameters of RNAi under 0 mM NaCl and 100 mM NaCl conditions;

[0042] Figure 9 GmJMJ36 Hap1 -OE and GmJMJ36 Hap1 -RNAi under 0 mM NaCl and 100 mM NaCl conditions + / K + Ratio and Cl - content;

[0043] Figure 10 The results show the KASP genotyping of SNP sites in germplasm resources. Detailed Implementation Plan

[0044] The following will be combined with the appendix Figures 1-10 The preferred embodiments of the present invention are described in detail below, further illustrating the invention. The following embodiments are provided to facilitate a better understanding of the invention, but do not limit the scope of the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods.

[0045] Unless otherwise specified, the experimental materials used in the following examples were all purchased from a regular biochemical reagent store, and the soybean variety Williams82 used for transgenic purposes is a publicly available variety.

[0046] Example 1: Genome-wide association study (GWAS)

[0047] Twenty-seven soybean populations (some varieties are shown in Table 1) were planted in vermiculite. After two weeks of growth, they were treated with 100 mM NaCl for two weeks. Soybean leaf samples were blanched and dried to constant weight. The dried leaves were weighed, ground, and boiled in ultrapure water. The supernatant was transferred to a new centrifuge tube after centrifugation and filtered. Cl- content was detected by chromatography (Thermo Fisher ICS 1100). -The content of [specific components / elements] was determined. Based on the soybean natural population SNP library constructed by previous resequencing in the laboratory, genome-wide association analysis was performed using FarmCPU and MLM in the R language rMVP. Manhattan plots and quantile-quantile (QQ) plots were generated using the CMplot package in R software for visualization verification and reliability assessment of the association analysis results.

[0048] Table 1. Some varieties of soybean population used in genome-wide association (GWAS) analysis

[0049] .

[0050] Example 2: Identification of salt tolerance genes in soybeans

[0051] After salt treatment using a natural population containing 207 soybean materials, Cl - GWAS analysis of the content showed that the QTL loci on soybean chromosome 19 were related to Cl. - Significantly correlated content ( Figure 1 ), among which the SNP site Chr19_43080069 is associated with the Cl after soybean salt stress - The content was significantly correlated and located in gene GmJMJ36. Hap1 At 43080069bp, a mutation from G to A occurs, turning the amino acid into a stop codon, leading to premature termination. Figure 2 ), of which GmJMJ36 Hap1 Cl in haplotype - The content was significantly higher than that of GmJMJ36 Hap2 GmJMJ36 Hap1 The chlorophyll content was significantly lower than that of GmJMJ36. Hap2 ( Figure 3 GmJMJ36 Hap2 The genome sequence of the superior haplotype is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3.

[0052] Example 3 Soybean GmJMJ36 Hap1 Gene overexpression (GmJMJ36) Hap1 Obtaining rooted combination plants (-OE)

[0053] 1. GmJMJ36 Hap1Construction of gene overexpression vectors

[0054] Primer1::5'-ATGGAGTATGGAACAAAGCA-3'

[0055] Primer2::5'-GCCATTAGCTACTTGCACAT-3'

[0056] Using primers 1 and 2, and root cDNA from Williams82 seedlings as a template, PCR amplification was performed to obtain the target gene GmJMJ36. Hap1 Homologous arms and homologous recombination primers were designed using XbaI as the restriction site. The vector pGmUbi-GFP-3 × FLAG-35S-Mcherry was digested with XbaI restriction endonuclease. The digested vector and the target gene GmJMJ36 were obtained. Hap1 GmJMJ36 was obtained by ligation using homologous recombinase. Hap1 The recombinant expression vector was named pGmUbi-GmJMJ36. Hap1 .

[0057] 2. Obtaining recombinant Agrobacterium

[0058] pGmUbi-GmJMJ36 Hap1 The K599 Agrobacterium strain was transformed to obtain a recombinant strain, named K5-pGmUbi-GmJMJ36. Hap1 .

[0059] 3. Overexpression of GmJMJ36 Hap1 Obtaining genetically modified plants

[0060] K5-pGmUbi-GmJMJ36 Hap1 The strain was transformed into the soybean variety Williams82. Specifically, after mature Williams82 seeds germinated for 3-4 days, hairy root infection was performed. Germinated seeds were selected, and the base was cut off, leaving approximately 2 cm of the hypocotyl. The soybean hypocotyl was then soaked in a solution containing K5-pGmUbi-GmJMJ36. Hap1 The strain was placed in the infection solution. The infected explants were then cultured in moist vermiculite for about a week. During this time, white callus tissue grew from the wound on the soybean hypocotyl. After another week of culture, soybean roots grew from the callus tissue, thus obtaining the rooted strain GmJMJ36. Hap1 Soybean plants with genetically modified genes.

[0061] 4. PCR molecular identification of transgenic plants

[0062] DNA was extracted from the roots of soybean rooting combination plants as a template. A 20 bp sequence of the pGmUbi vector was selected as the upstream primer, and GmJMJ36 was chosen as the primer. Hap1 PCR amplification was performed using a 20 bp gene sequence as a downstream primer.

[0063] The PCR products were detected by 1% agarose gel electrophoresis. The target band could be detected in positive plants, but not in negative plants.

[0064] 5. Detection of gene overexpression levels

[0065] Take GmJMJ36 Hap1 Root samples from soybean rooting hybrids were homogenized by liquid nitrogen freezing and then RNA was extracted using the TRIzol method. An appropriate amount of RNA was used to obtain cDNA using a transcription kit, which was then used as a template for quantitative RT-PCR detection. An appropriate amount of template cDNA was taken, and soybean GmELF was used as an internal control gene for analysis using Hieff. TM qPCR SYBR ® The Green Master Mix (No RoxPlux) kit was used to detect the expression level of the GmJMJ36 gene in a Bio-Rad CFX96 real-time PCR instrument. The sequences of the primers used for quantitative detection of the GmELF gene (primer 3 and primer 4) and the primers used for quantitative detection of the GmJMJ36 gene (primer 5 and primer 6) are as follows:

[0066] Primer3: 5'-GTTGAAAAGCCAGGGGACA-3';

[0067] Primer4: 5'-TCTTACCCCTTGAGCGTGG-3'.

[0068] Primer5:5'-GCTCCTACTTTCCACCCAACA-3';

[0069] Primer6: 5'-GGAGGGACAATACGGCACAT-3'.

[0070] Relative expression level was 2 -△△CT The method is used for quantitative calculation, and the results are as follows: Figure 4 As shown (GmJMJ36) Hap1 -OE).

[0071] Example 4: Soybean GmJMJ36 Hap2 Gene overexpression (GmJMJ36) Hap2 Obtaining rooted combination plants (-OE)

[0072] The obtained GmJMJ36Hap1 Using the gene fragment as a template, the base G at the SNP site Chr19_43080069 was mutated to A, resulting in GmJMJ36. Hap2 The sequence is shown in SEQ ID NO. 2. The hair root obtained according to the method in Example 3 is GmJMJ36. Hap2 Soybean plants with the gene GmJMJ36 were tested. Hap2 The expression level of the GmJMJ36 gene in the -OE rooting combination plants was obtained as follows: Figure 4 As shown (GmJMJ36) Hap2 -OE).

[0073] Example 5: Soybean GmJMJ36 Hap1 and GmJMJ36 Hap2 Salt tolerance identification of rooting combination plants with gene overexpression

[0074] GmJMJ36 was successfully identified Hap1 -OE and GmJMJ36 Hap2 -OE rooting combination plants were cultured until the 2nd-3rd compound leaves unfolded. Soybean rooting combination plants transfected with K599 empty strain were used as controls. Soybean rooting combination plants with consistent growth were selected and transferred to 1 / 2 Hoagland nutrient solution and 1 / 2 Hoagland nutrient solution containing 120 mM NaCl for further culture. After 7-10 days of continued growth, the phenotype of soybean rooting combination plants was observed by taking pictures, and relevant physiological indicators were measured.

[0075] Figure 5 The experimental results showed that, after salt treatment, compared with the empty vector plants, GmJMJ36 Hap1 -OE growth was significantly inhibited, manifested as reduced plant height, stunted root development, and severe yellowing and wilting of leaves, while GmJMJ36 Hap2 -OE growth is weakly inhibited, GmJMJ36 Hap1 -OE plants had significantly lower chlorophyll content than GmJMJ36. Hap2 -OE plants.

[0076] Figure 6 Experimental results showed that after salt treatment, GmJMJ36, whether aboveground or underground, Hap1 Na in OE plants + / K + Ratio and Cl - The content of all samples was significantly higher than that of empty vector plants; GmJMJ36 Hap2 -OE plant aboveground parts Na + / K + The ratio was significantly lower than that of GmJMJ36 Hap1-OE,GmJMJ36 Hap2 -OE plant underground Na + / K + Ratio and Cl - The contents were all significantly lower than those of the empty load and GmJMJ36. Hap1 -OE.

[0077] Therefore, based on these results, it can be clearly stated that the GmJMJ36 gene negatively regulates soybean salt tolerance, and overexpression of GmJMJ36... Hap2 This reduces the salt-sensitive phenotype of soybean rooting combination plants and improves the salt tolerance of soybeans.

[0078] Example 6: Obtaining and salt tolerance identification of RNAi-derived rooting hybrids of the GmJMJ36 gene.

[0079] 1. GmJMJ36 Hap1 - RNAi expression vector construction

[0080] A target sequence for the GmJMJ36 gene was designed, as shown in SEQ ID NO. 4. Using the genomic cDNA of Williams82 roots as a template, PCR amplification was performed using primer7 and primer8 to obtain the target sequence of the GmJMJ36 gene.

[0081] Primer7: 5'-ATGCTTTCCTCTTACTTGTG-3';

[0082] Primer8: 5'-GTCTATAAGCACTAATGTCA-3'.

[0083] The amplified products were ligated into the pFGC5941 vector twice using NcoI and XbaI, and then transformed into *E. coli* DH5α. Positive plasmids were extracted and sequenced. The correctly sequenced recombinant expression vector was named pFGC5941-GmJMJ36. Hap1 .

[0084] 2. Obtaining recombinant Agrobacterium

[0085] pFGC5941-GmJMJ36 Hap1 The K599 Agrobacterium strain was transformed to obtain a recombinant strain, named K5-pFGC5941-GmJMJ36. Hap1 .

[0086] 3. Obtaining and identifying GmJMJ36-RNAi transgenic plants

[0087] K5-pFGC5941-GmJMJ36 Hap1The strain was transformed into soybean variety Williams82, and the transgenic plants were identified by PCR and the overexpression level of the GmJMJ36 gene was detected. Figure 7 For specific implementation methods, please refer to Case Implementation 3.

[0088] Example 7, GmJMJ36 Hap1 Salt tolerance identification of plants with gene overexpression and RNAi rooting combination

[0089] GmJMJ36 was successfully identified Hap1 -OE and GmJMJ36 Hap11 The RNAi rooting combination plants were cultured in 1 / 2 Hoagland nutrient solution until the second and third compound leaves unfolded. Soybean rooting combination plants transfected with empty strain K599 were used as a control. Then, soybean rooting combination plants with relatively uniform growth were selected and transferred to 1 / 2 Hoagland nutrient solution and 1 / 2 Hoagland nutrient solution containing 100mM NaCl for further culture. After 7-10 days of continued growth, the phenotype of soybean rooting combination plants was observed by taking pictures, and relevant physiological indicators were measured.

[0090] Figure 8 Experimental results showed that under salt stress, compared with empty vector plants, GmJMJ36 Hap1 -OE plants showed significantly increased salt sensitivity, manifested as yellowing and wilting of leaves; while GmJMJ36 Hap1 RNAi plants exhibited stronger tolerance to salt stress, with less leaf wilting compared to untreated plants. After salt treatment, GmJMJ36... Hap1 -OE plants had significantly lower chlorophyll content than empty vector plants, while GmJMJ36 Hap1 -RNAi plants have significantly higher chlorophyll content than empty vector plants.

[0091] Figure 9 Experimental results showed that after salt treatment, GmJMJ36, whether aboveground or underground, Hap1 Na in OE plants + / K + Ratio and Cl - The content of all samples was significantly higher than that of empty vector plants; GmJMJ36 Hap1 -RNAi plant aboveground parts Na + / K + The ratio was significantly lower than that of empty vector plants and GmJMJ36. Hap1 -OE plant, Na in the underground part + / K + Ratio and Cl - The content was significantly lower than that of GmJMJ36 Hap1 -OE plants.

[0092] Therefore, it can be seen that the GmJMJ36 gene negatively regulates the tolerance of soybean to salt stress. Overexpression of this gene can improve the salt-sensitive phenotype of soybean, while RNAi interference with the GmJMJ36 gene can rescue the salt-sensitive phenotype of soybean and improve the salt tolerance of soybean.

[0093] Example 8: Development and application of molecular markers for superior haplotypes of GmJMJ36

[0094] 1. KASP marker genotyping detection method

[0095] First, obtain the target SNP site information. Based on the base where the SNP is located, select a 20 bp sequence upstream as the forward primer region. Set the SNP base as the 20th base of the forward primer. Based on this, design two upstream primers F1 and F2 (the underlined part is the luminescent group) and one downstream primer R.

[0096] F1: 5'- GAAGGTGACCAAGTTCATGCT GTAAGTTTTGCTCCTCTTGAGTG-3' (SEQ ID NO.5);

[0097] F2: 5'- GAAGGTCGGAGTCAACGGATT GTAAGTTTTGCTCCTCTTGAGT A -3' (SEQ ID NO. 6);

[0098] R: 5'-AAGCTATCTGATGTGCTCTTCC-3' (SEQ ID NO. 7).

[0099] Dissolve the newly synthesized primer powder, with F1 and F2 at a concentration of 36 µM and R at a concentration of 90 µM. Then mix the three primers in a volume ratio of 1:1:1 to form a primer mix; dilute the template DNA concentration to 50 ng / µl.

[0100] The PCR amplification system consisted of 5 µL soybean DNA template, 5 µL 2 × KASP Master Mix, and 0.14 µL KASP Assay Mix (F1:F2:R=1:1:1).

[0101] The KASP reaction program is set as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds; annealing extension at 61-55℃ for 1 minute, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; denaturation at 94℃ for 20 seconds, annealing extension at 55℃ for 1 minute, for a total of 30 reaction cycles; finally, reaction at 30℃ for 1 minute, and fluorescence data are read.

[0102] 2. Specific applications and validation of molecular marker methods

[0103] DNA was extracted from the first compound leaves of 45 soybean samples and diluted to 50 ng / µl as a template for a KASP molecular marker to be developed for the SNP site S19_43080069 (G / A). Using the designed KASP marker primers, amplification was performed on a real-time quantitative PCR instrument, and the fluorescence data were read. This molecular marker can clearly separate the two genotypes.

[0104] Red dots represent salt-tolerant soybean varieties with genotype AA, blue dots represent salt-sensitive soybean varieties with genotype GG, and the black dot in the lower left corner represents the negative control (NTC). Figure 10 The KASP genotyping results obtained from 45 materials were compared with phenotypic information. The selection efficiency of this marker for the salt tolerance phenotype was 55.56% (Table 2). The developed KASP molecular marker can directly and specifically distinguish and detect SNP sites. This KASP marker has high application value and can be used for pre-screening of salt tolerance traits in soybeans and for molecular-assisted breeding.

[0105] Table 2 Soybean varieties and genotypes used in the development of the GmJMJ36 KASP marker.

[0106] .

Claims

1. The soybean salt tolerance gene GmJMJ36, characterized by, Gene GmJMJ36 is gene GmJMJ36 Hap1 Or GmJMJ36 Hap2 Among them, gene GmJMJ36 Hap2 The genome sequence is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2; gene GmJMJ36 Hap1 The genome sequence is shown in SEQ ID NO.8, and the CDS sequence is shown in SEQ ID NO.

9.

2. Silencing the gene GmJMJ36 as described in claim 1 Hap1 The interfering RNA, an RNAi interference vector containing the interfering RNA, or a recombinant bacterium containing the interference vector of the RNAi; preferably, the sequence of the interfering RNA is shown in SEQ ID NO.

4.

3. Silencing or knocking out the gene GmJMJ36 described in SEQ ID NO. 8 or SEQ ID NO.

9. Hap1 Or gene GmJMJ36 Hap1 Application of interfering RNA, RNAi interference vector containing said interfering RNA, or recombinant bacteria containing said RNAi interference vector in improving the salt tolerance of soybeans.

4. A gene comprising the GmJMJ36 described in claim 1 Hap2 Recombinant expression vectors or recombinant bacteria.

5. Overexpression of the gene GmJMJ36 shown in SEQ ID NO.1 or SEQ ID NO.2 Hap2 Or may contain the gene GmJMJ36 Hap2 Application of recombinant expression vectors or recombinant bacteria in improving the salt tolerance of soybeans.

6. A method for improving the salt tolerance of soybeans, characterized in that, Overexpression of the gene GmJMJ36 shown in SEQ ID NO.1 or SEQ ID NO.2 in soybean plants Hap2 Alternatively, the gene GmJMJ36 described in SEQ ID NO. 8 or SEQ ID NO. 9 may be silenced or knocked out. Hap1 This improves the salt tolerance of soybeans.

7. A method for breeding salt-tolerant soybean varieties, characterized in that, Overexpression of the gene GmJMJ36 shown in SEQ ID NO.1 or SEQ ID NO.2 in soybean plants Hap2 Alternatively, the gene GmJMJ36 described in SEQ ID NO. 8 or SEQ ID NO. 9 may be silenced or knocked out. Hap1 Salt-tolerant soybean varieties were obtained.

8. A method for detecting SNP sites for salt tolerance in soybeans, characterized in that, The SNP site is located at 43080069 bp on soybean chromosome 19. When the base at the site is GG, it is a salt-sensitive soybean; when the base at the site is AA, it is a salt-tolerant soybean; and when the base at the site is GA, it is an intermediate soybean.

9. The use of the substance that detects the molecular marker of soybean salt tolerance as described in claim 8 in any one or more of the following: A1: To identify or assist in the identification of salt-tolerant soybean varieties and soybean materials; A2: Reagents for preparing, identifying, or assisting in the identification of salt-tolerant soybean varieties; A3: Soybean breeding or assisted soybean breeding; A4: Preparation of soybean breeding reagents or auxiliary soybean breeding reagents.

10. The application according to claim 9, characterized in that, The substance used to detect the SNP site Chr19_43080069 is A1), A2), or A3): A1) A primer set, wherein the primer set consists of single-stranded DNA molecules or derivatives thereof shown in SEQ ID NO. 5 and SEQ ID NO. 6, and single-stranded DNA molecules or derivatives thereof shown in SEQ ID NO. 7; A2) A PCR reagent containing the primer set; A3) A kit containing A1) or A2); Preferably, the derivative of the single-stranded DNA molecule shown in SEQ ID NO. 5 is a single-stranded DNA molecule shown in SEQ ID NO. 5 with a fluorescent tag attached to the 5' end; The derivative of the single-stranded DNA molecule shown in SEQ ID NO.6 is a single-stranded DNA molecule shown in SEQ ID NO.6 with another fluorescent tag attached to the 5' end.