A grape seed germination index related snp marker and application thereof
By detecting the genotype of specific SNP markers in grape seeds, the problem of low germination rate of grape seeds was solved, enabling rapid and accurate determination of seed germination index during the seedling stage, thus improving the efficiency and time of grape breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XINJIANG ACAD OF AGRI SCI (XINJIANG BRANCH OF CHINESE ACAD OF AGRI SCI)
- Filing Date
- 2026-05-13
- Publication Date
- 2026-06-16
AI Technical Summary
Low germination rate of grape seeds leads to low efficiency in grape hybridization breeding, prolonged breeding cycle, increased costs, and limited opportunities for screening superior genotypes. Existing technologies make it difficult to quickly and accurately determine the seed germination index.
A SNP marker associated with grape seed germination index is provided, located at a specific locus in the gene VIT_15s0048g02580 on chromosome 15 of the grape reference genome, version 23. Seed germination index is determined by detecting the genotype of this SNP marker locus. Detection is performed using specific primer pairs and kits, and haplotype relationships are identified by combining full-length gene TA cloning, single-clone screening, and sequencing analysis.
This method allows for the rapid and accurate determination of seed germination index during the grape seedling stage, improving the efficiency of grape hybridization breeding, shortening breeding time, and is applicable to grape genetic breeding work.
Smart Images
Figure CN122214535A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and in particular to a SNP marker related to the germination index of grape seeds and its application. Background Technology
[0002] In grape breeding programs, low seed germination rates significantly reduce the efficiency of grape hybridization breeding, leading to longer breeding cycles, increased costs, and limited opportunities for screening superior genotypes. Because grape hybrid seeds inherently possess dormancy characteristics and generally have low germination rates (often only 30%–50%), a large number of hybrid seeds fail to germinate successfully, directly reducing the number of seedlings available for subsequent field evaluation. This not only wastes the manpower and time invested in early hybridization and pollination but may also cause the loss of certain rare or superior gene combinations during the germination stage, severely impacting the breadth and success rate of new variety selection. Germination index is a key indicator in grape hybridization breeding, measuring seed vigor and seedling uniformity, directly affecting breeding efficiency and seedling population quality. A high germination index indicates rapid and uniform seed germination, resulting in consistent and robust seedlings, providing a uniform seedling base for subsequent trait observation and selection, reducing misscreening or management difficulties caused by uneven seedling emergence. Therefore, identifying candidate genes affecting grape seed germination index is of great significance for improving grape breeding efficiency.
[0003] Single nucleotide polymorphism (SNP) molecular markers are genetic markers formed by a single nucleotide variation in the genome. They are known as third-generation DNA molecular markers and have advantages such as large number, wide distribution, genetic stability, and suitability for high-throughput detection. They are widely used in crop breeding and individual identification.
[0004] With the widespread adoption of high-throughput sequencing technologies such as whole-genome resequencing, researchers can rapidly identify a large number of SNP sites across the entire genome, significantly improving the efficiency and density of marker development, thus transitioning it from low-throughput to high-throughput. Therefore, identifying genes related to the grape germination index and their significant impact on significantly improving the efficiency of grape hybridization breeding is crucial. Discovering key candidate genes influencing traits related to seed germination index and developing corresponding molecular markers is a vital task in improving grape breeding efficiency to date. Summary of the Invention
[0005] To address the aforementioned issues, this invention provides a SNP marker related to grape seed germination index and its application. By using this SNP marker in grape hybridization breeding, the uniformity of grape seed germination index can be accurately and quickly determined based on the genotype of the SNP marker locus, without requiring the plant to produce fruit.
[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a SNP marker related to the germination index of grape seeds, wherein the SNP marker is located on chromosome 15 of the grape reference genome, version 23. VIT_15s0048g02580 The 16705205th, 16705214th, 16705354th, 16705372nd, 16705609th, 16706369th, 16706492nd, 16706571st, 16706878th, 16706880th, 16707205th, 16707333rd, 16707432nd, 16707441st, 16707456th, 16707487th, 16707590th, 16707683rd, 16707763rd, 16707767th, 16707839th, and 16707885th positions; The base at position 16705205 is either A or T; the base at position 16705214 is either T or C; the base at position 16705354 is either T or C; the base at position 16705372 is either C or G; the base at position 16705609 is either T or G; the base at position 16706369 is either A or T; the base at position 16706492 is either A or G; the base at position 16706571 is either G or A; the base at position 16706878 is either G or T; the base at position 16706880 is either A or C; and the base at position 16707205 is either C or T. The base at position 16707333 is C or T; the base at position 16707432 is T or C; the base at position 16707441 is T or C; the base at position 16707456 is G or T; the base at position 16707487 is A or C; the base at position 16707590 is T or A; the base at position 16707683 is T or G; the base at position 16707763 is T or G; the base at position 16707767 is T or A; the base at position 16707839 is T or A; the base at position 16707885 is A or G.
[0007] Preferably, when the 16705205th, 16705214th, 16705354th, 16705372nd, 16705609th, 16706369th, 16706492nd, 16706571st, 16706878th, 16706880th, 16707205th, 16707333rd, and 16707th positions are selected... The highest germination index of grape seeds is achieved when the bases at positions 432, 16707441, 16707456, 16707487, 16707590, 16707683, 16707763, 16707767, 16707839, and 16707885 are TTTGTTGATCCTCCGCAGGTAG, respectively.
[0008] The present invention also provides a primer pair for detecting the SNP marker described in the above technical solution, wherein the sequence of the upstream primer is shown in SEQ ID No. 1 and the sequence of the downstream primer is shown in SEQ ID No. 2.
[0009] The present invention also provides a kit for detecting the SNP markers described in the above-described technical solutions, comprising the primer pairs described in the above-described technical solutions.
[0010] This invention also provides the application of the SNP markers, primer pairs, or kits described in the above-mentioned technical solutions in determining the germination index of grape seeds.
[0011] Preferably, the germination index of grape seeds is determined during the grape seedling stage.
[0012] This invention also provides a method for determining the germination index of grape seeds, comprising the following steps: 1) RNA was extracted from leaves of different grape varieties and reverse transcribed into cDNA; 2) Using the cDNA described in step 1) as a template, perform full-length TA cloning of the gene using the primer pairs described in the above technical solution to obtain the amplification results; 3) Based on the amplification results described in step 2), perform transformation and plating, single clone screening, plasmid extraction and sequencing, sequence analysis and haplotype determination, in order to determine the level of grape seed germination index in advance.
[0013] Preferably, the amplification system in step 2) is: 2.5 µL cDNA, 1.0 µL of upstream primer with a concentration of 7.5 µM, 1.0 µL of downstream primer with a concentration of 7.5 µM, 12.5 µL of 2×q-PCR mixture and 8.0 µL of ddH2O, with a total volume of 25 µL.
[0014] Preferably, the amplification program in step 2) is as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 1 min, 55 °C annealing for 1 min, 72 °C extension for 1.5 min, for 40 cycles.
[0015] Step 3) describes the transformation and plating method as follows: using DH5α chemocompetent cells, incubating on ice for 30 minutes, heat shocking at 42°C for 45 seconds, and then quickly returning to ice for 2-3 minutes; adding 600 μL of LB medium, shaking at 37°C for 1 hour to improve recovery efficiency; plating on LB plates containing ampicillin, and culturing at 37°C for 12-16 hours. Preferably, in step 3), the single clone screening method selects no less than 10 single clones for each sample to cover allele diversity, uses colony PCR for initial screening, uses universal primers for vectors, and confirms that the inserted fragment size is correct. Step 3) The plasmid extraction and sequencing method is as follows: plasmid is extracted using a miniprep kit at a concentration ≥50 ng / μL, with an A260 / A280 ratio between 1.8 and 2.0; M13 universal primers are used for sequencing to ensure full sequence coverage. Step 3) The method for sequence analysis and haplotype determination is to align the sequencing results to the reference sequence, identify SNP sites, and clarify the haplotype relationship between different varieties.
[0016] The beneficial effects of this invention are: The SNP markers are located at positions 16705205, 16705214, 16705354, 16705372, 16705609, 16706369, 16706492, 16706571, 16706878, 16706880, 16707205, 16707333, 16707432, 16707441, 16707456, 16707487, 16707590, 16707683, 16707763, 16707767, 16707839, and 16707885 on chromosome 15 of the grape reference genome, version 23. It mainly exists in 6 haplotypes; among them, HAP1 has the following base sequence: A_T_T_C_T_A_A_G_G_A_C_C_T_T_G_A_T_T_T_T_T_A; and HAP2 has the following base sequence: A_T_C_G_G_A_A_G_G_A_T_C_T_T_G_A_T_T_T_T_T_G_A_T_T_T_T_ A_G; where HAP3 has the following base sequence: T_T_T_G_T_T_G_A_T_C_C_T_C_C_T_C _A_G_G_T_A_G; where HAP4 has the following base sequence: A_C_T_G_T_T_G_A_T_C_C_ T_C_C_G_C_A_G_G_A_A_G; where HAP5 has the base sequence A_T_C_G_T_A_G_ A_T_C_C_C_C_T_T_A_T_G_G_T_A_G; where HAP6 has the base sequence T_T_T_G_T_T_G_A_T_C_C_T_C_C_G_C_A_G_G_T_A_G; the dominant haplotype is HAP6.
[0017] Based on the fact that a higher germination index of offspring seeds in grape hybridization during artificial pollination helps improve breeding efficiency, this invention provides a SNP marker related to the grape germination index: by analyzing the haplotype of this SNP marker locus, the uniformity of grape seed germination index can be accurately and quickly determined during the seedling stage, without requiring the plant to develop fruit. This invention can effectively improve the efficiency of grape hybridization breeding to a certain extent, shorten the breeding time, and is applicable to grape genetic breeding work. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0019] Figure 1 The Manhattan plot and QQ plot of grape seed germination index based on genome-wide association study (GWAS) are shown. Figure 1 The left side is the Manhattan plot, which is a genome-wide P-value sorted by chromosomal physical location according to the F-test. The horizontal axis is the genome coordinate, and the vertical axis is -log10P. The smaller the P-value, the stronger the association. The black dashed line is the threshold line for screening significant sites. SNP sites above the threshold line are candidate sites associated with the phenotype. The right side is the Quantile-quantile plot, which shows the distribution of the actual P-value (vertical axis) and the expected P-value of the null hypothesis without association (horizontal axis). It is used to detect the influence of population stratification and individual kinship on association analysis. The closer the blue line is to the red line, the less the results are affected by population stratification.
[0020] Figure 2 A comparison of different haplotype phenotypes of key candidate genes affecting grape seed germination index.
[0021] Figure 3 for VIT_15s0048g02580Comparison of relative gene expression levels in different haplotypes (high seed germination index, HAP6; low seed germination index, other haplotypes HAP1, HAP2, HAP3, HAP4 and HAP5). Detailed Implementation
[0022] This invention provides a SNP marker related to the germination index of grape seeds, wherein the SNP marker is located on chromosome 15 of the grape reference genome, version 23. VIT_15s0048g02580 16705205th, 16705214th, 16705354th, 16705372nd, 16705609th, 16706369th, 16706492nd, 16706571st, 16706878th, 16706880th, 16707205th, 16707333rd, 16707432nd, 16707441st, 16707th The bases at positions 456, 16707487, 16707590, 16707683, 16707763, 16707767, 16707839, and 16707885 are: position 16705205 is A or T; position 16705214 is T or C; position 16705354 is T or C; position 16705372 is C or G; and position 167... The base at position 05609 is T or G; the base at position 16706369 is A or T; the base at position 16706492 is A or G; the base at position 16706571 is G or A; the base at position 16706878 is G or T; the base at position 16706880 is A or C; the base at position 16707205 is C or T; the base at position 16707333 is C or T; the base at position 16707432 is T or C; the 1st The base at position 6707441 is T or C; the base at position 16707456 is G or T; the base at position 16707487 is A or C; the base at position 16707590 is T or A; the base at position 16707683 is T or G; the base at position 16707763 is T or G; the base at position 16707767 is T or A; the base at position 16707839 is T or A; and the base at position 16707885 is A or G.
[0023] In this invention, when the 16705205th bit, 16705214th bit, 16705354th bit, 16705372nd bit, 16705609th bit, 16706369th bit, 16706492nd bit, 16706571st bit, 16706878th bit, 16706880th bit, 16707205th bit, 16707333rd bit, 16707th bit... When the bases at positions 432, 16707441, 16707456, 16707487, 16707590, 16707683, 16707763, 16707767, 16707839, and 16707885 are preferably TTTGTTGATCCTCCGCAGGTAG, the grape seed germination index is the highest.
[0024] The present invention also provides a primer pair for detecting the SNP marker described in the above technical solution, wherein the sequence of the upstream primer is shown in SEQ ID No. 1 and the sequence of the downstream primer is shown in SEQ ID No. 2.
[0025] SEQ ID No. 1: 5'-TCACGCGCTGAGTAAAGGAG-3'; SEQ ID No. 2: 5'CCGAAGTTGCCCTCAAATGC-3'.
[0026] The present invention also provides a kit for detecting the SNP markers described in the above-described technical solutions, comprising the primer pairs described in the above-described technical solutions.
[0027] This invention also provides the application of the SNP markers, primer pairs, or kits described in the above-described technical solutions in determining the germination index of grape seeds. In this invention, it is preferable to determine the germination index of grape seeds during the grape seedling stage.
[0028] This invention also provides a method for determining the germination index of grape seeds, comprising the following steps: 1) RNA was extracted from leaves of different grape varieties and reverse transcribed into cDNA; 2) Using the cDNA described in step 1) as a template, perform full-length TA cloning of the gene using the primer pair described in claim 3 to obtain the amplification result; 3) Based on the amplification results described in step 2), perform transformation and plating, single clone screening, plasmid extraction and sequencing, sequence analysis and haplotype determination, in order to determine the level of grape seed germination index in advance.
[0029] In this invention, the preferred amplification system consists of: 2.5 µL cDNA, 1.0 µL of 7.5 µM upstream primer, 1.0 µL of 7.5 µM downstream primer, 12.5 µL of 2×q-PCR mixture, and 8.0 µL of ddH2O, for a total volume of 25 µL. The preferred amplification program is: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 1 min, 55 °C annealing for 1 min, and 72 °C extension for 1.5 min, for 40 cycles. In this invention, the transformation and plating method preferably uses DH5α chemocompetent cells, which are placed on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and quickly returned to ice for 2-3 minutes; 600 μL of LB medium is added, and the cells are shaken at 37°C for 1 hour to improve recovery efficiency; the cells are then plated on LB plates containing ampicillin and incubated at 37°C for 12-16 hours; the single-clone screening method preferably involves picking no less than 10 single clones from each sample to cover allele diversity, using colony PCR for initial screening, and using universal primers to confirm the correct size of the inserted fragment; the plasmid extraction and sequencing method preferably uses a miniprep kit to extract plasmids at a concentration ≥50 ng / μL, with an A260 / A280 ratio between 1.8 and 2.0; universal M13 primers are used for sequencing to ensure full sequence coverage; the sequence analysis and haplotype determination method preferably involves aligning the sequencing results to a reference sequence, identifying SNP sites, and clarifying the haplotype relationship between different varieties.
[0030] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0031] Example 1 This embodiment provides a specific method for mining SNP markers related to grape seed germination index based on GWAS analysis.
[0032] 1. Preparation of test materials The test materials consisted of 269 natural grape populations obtained from the experimental nursery of the Grape and Fruit Research Institute of Xinjiang Uygur Autonomous Region (see Table 1).
[0033] Table 1. Seed germination index of 269 grape natural population materials Note: NA indicates missing data.
[0034] Table 2 Key candidate genes affecting grape seed germination index VIT_15s0048g02580 Different haplotype distributions of (pyruvatedehydrogenase E1 component subunit alpha-like) 2. Determination of seed germination index of natural grape population materials.
[0035] Mature grape berries collected from the 269 natural populations listed in the table above were manually seeded, washed with tap water to remove shriveled seeds, and then air-dried for later use. For grape seeds that had undergone low-temperature stratification, 30 plump seeds from each variety were selected, with three replicates. The seeds were soaked in a 0.5% (v / v) sodium hypochlorite (NaClO) solution for 10 minutes, followed by thorough rinsing with sterile deionized water. The seeds were evenly placed in 90 mm diameter plastic petri dishes lined with two layers of filter paper. All petri dishes were incubated at 28°C for 20 days, with alternating light and dark cycles for 12 hours. Germination was defined as the radicle penetrating the seed coat and sprouting ≥2 mm. Germination counts were recorded every 24 hours for 20 consecutive days. Germination parameters were evaluated according to the rules of the International Seed Testing Association (ISTA), and the evaluation method is as follows: Germination index (GI) = Σ(Gt / Dt), where: Gt is the number of germinations at different times; Dt is the number of germination days; and Σ is the sum.
[0036] 3. GWAS analysis was performed on 269 natural grape populations using GEMMA software. The results are as follows: Figure 1 .in Figure 1 The left side is a Manhattan plot, which shows the genetic marker effect value, i.e., the genome-wide P-value after the F-test, ordered by the physical location on the chromosome. The horizontal axis is the genome coordinate, and the vertical axis is -log10P. The smaller the P-value, the stronger the association. The black dashed line is the threshold line for screening significant sites; SNP sites above the threshold line are candidate sites associated with the phenotype. As can be seen in the figure, the gene related to grape seed germination index is located on chromosome 5, and there is one significant SNP 5_16708033 in this region.
[0037] 4. Obtaining the target SNP Analysis of the 25,000 bp region upstream and downstream of this significant SNP site revealed that this region contains one gene. VIT_5s0048g02580This gene encodes an α subunit analog of pyruvate dehydrogenase E1 component, which may be associated with grape seed germination index. Haplotype analysis was performed on the identified significant association sites using LDBlockShow (version 1.40) software. The analysis revealed that the haplotype marker associated with grape seed germination index is located on chromosome 15 of the grape reference genome (ftp: / / ftp.ensemblgenomes.org / pub / release-23 / plants / fasta / vitis_vinifera / dna / Vitis_vinifera.IGGP2x.23.dna.toplevel.fa.gz). VIT_ 15s0048g02580 The numbers 16705205, 16705214, 16705354, 16705372, 16705609, 16706369, 16706492, 16706571, 16706878, 16706880, 16707205, 16707333, 16707432, 16707441, 16707456, 16707487, 16707590, 16707683, 16707763, 16707767, 16707839, and 16707885 are listed. It mainly exists in 6 haplotypes; among them, HAP1 has the base sequence A_T_T_C_T_A_A_G_G_A_C_C_T_T_G_A_T_T_T_T_T_A; HAP2 has the base sequence A_T_C_G_G_A_A_G_G_A_T_C_T_T_G_A_T_T_T_T_T_A_G; and HAP3 has the base sequence T_T_T_G_T_T_G_A_T_C_C_T_C_C_T_C_C_T_C_A_G_G_T_ A_G; where HAP4 has the following base sequence: A_C_T_G_T_T_G_A_T_C_C_T_C_C_G_C_ A_G_G_A_A_G; where HAP5 has the following base sequence: A_T_C_G_T_A_G_A_T_C_C_C _C_T_T_A_T_G_G_T_A_G; where HAP6 has the base sequence T_T_T_G_T_T_G_A_ T_C_C_T_C_C_G_C_A_G_G_T_A_G. Gene VIT_5s0048g02580 It mainly includes 6 haplotypes ( Figure 2 By comparing the germination index of different haplotypes, it was found that the dominant haplotype was HAP6, which had a higher seed germination index.
[0038] 5. Haplotype analysis and verification of different grape varieties RNA was extracted from leaves of different grape varieties and reverse transcribed into cDNA. Full-length TA cloning was performed using the cDNA as a template, resulting in amplification. Transformation and plating were then performed, followed by single-clone screening, plasmid extraction and sequencing, and sequence analysis and haplotype determination. The amplification system consisted of 2.5 µL cDNA, 1.0 µL of 7.5 µM upstream primer (SEQ ID No. 1), 1.0 µL of 7.5 µM downstream primer (SEQ ID No. 2), 12.5 µL of 2×q-PCR mixture, and 8.0 µL of ddH2O, for a total volume of 25 µL. The amplification program was as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 1 min, annealing at 55℃ for 1 min, extension at 72℃ for 1.5 min, for 40 cycles. Transformation and plating were performed using DH5α chemicompetent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 seconds, and then quickly returned to ice for 2-3 minutes. Add 600 μL of LB medium and incubate at 37°C for 1 hour to improve recovery efficiency. Spread the culture on LB plates containing ampicillin and incubate at 37°C for 12-16 hours. For single-clone screening, select at least 10 single clones from each sample to cover allelic diversity. Use colony PCR for initial screening, using universal vector primers (e.g., M13F / R), and confirm the correct insert size. For plasmid extraction and sequencing, use a miniprep kit to extract plasmids at a concentration ≥50 ng / μL, with an A260 / A280 ratio between 1.8 and 2.0. M13 universal primers are recommended for sequencing to ensure full sequence coverage. For sequence analysis and haplotype determination, align the sequencing results to a reference sequence (e.g., NCBI accession number), identify SNP sites, and clarify the haplotype relationships between different varieties (Table 3). Validation showed (Table 3) that the haplotype analysis and resequencing results for different varieties were consistent.
[0039] Table 3. Haplotype analysis and verification of different grape varieties. 6. Expression analysis of key candidate genes Total RNA was extracted from seed tissues of six different grape varieties (HAP1: "Rebil," HAP2: "Girard," HAP3: "Negáru," HAP4: "Black Grape," HAP5: "Fujiminori," and HAP6: "Señe Blanc"). Total RNA was extracted using the cetyltrimethylammonium bromide (CTAB) method as recommended by the manufacturer, and trace amounts of genomic DNA were removed using DNase I (RNase-free) from Takara (Beijing, China). RNA purity was assessed using a NanoDrop 20-00 ultramicron spectrophotometer, followed by agarose gel electrophoresis of 3 μL samples to verify RNA integrity. The RNA samples were used as templates for cDNA synthesis according to the instructions of the ThermoProduct RNA Reverse Transcription Kit. The obtained cDNA products were stored at -20°C for future use.
[0040] Based on the design principles of quantitative polymerase chain reaction (q-PCR) primers, Beacon Designer was used. TM The software is used in relation to q-PCR primers.
[0041] for VIT_15s0048g02580 Gene: Forward primer sequence (SEQ ID No. 3): 5'-GTAAAGGAGTGCCTGCTCGT-3'; Reverse primer sequence (SEQ ID No. 4): 5'-GCCAAGGTCACCTCATCACA-3'; GAPDH was used as an internal reference gene, and the procedure was performed according to the instructions of the SYBR® Green Fast q-PCR Mixed Kit. The amplification system contained 2.5 μL cDNA; 1.0 μL each of upstream and downstream primers (7.5 μM); 12.5 μL 2×q-PCR mixture; and 8.0 μL ddH2O, for a total volume of 25 μL. The reaction program consisted of pre-denaturation at 95°C for 1 min, denaturation at 95°C for 10 sec, annealing at 60°C for 20 sec, and extension at 72°C for 30 sec (40 cycles). We performed three assays and used 2... -ΔΔCt The method calculated the relative expression of candidate genes in grape varieties with different haplotypes. Results are shown below. Figure 3 ,from Figure 3 As can be seen, the candidate gene expression level in haplotype HAP6, which has a high seed germination index advantage, is relatively lower than that in other haplotypes (HAP1, HAP2, HAP3, HAP4, and HAP5) with low seed germination index, indicating that the expression level of the candidate gene is negatively correlated with the seed germination index.
[0042] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A SNP marker related to the germination index of grape seeds, characterized in that, The SNP marker is located on chromosome 15 of the grape reference genome, version 23. VIT_15s0048g02580 The 16705205th, 16705214th, 16705354th, 16705372nd, 16705609th, 16706369th, 16706492nd, 16706571st, 16706878th, 16706880th, 16707205th, 16707333rd, 16707432nd, 16707441st, 16707456th, 16707487th, 16707590th, 16707683rd, 16707763rd, 16707767th, 16707839th, and 16707885th positions; The base at position 16705205 is either A or T; the base at position 16705214 is either T or C; the base at position 16705354 is either T or C; the base at position 16705372 is either C or G; the base at position 16705609 is either T or G; the base at position 16706369 is either A or T; the base at position 16706492 is either A or G; the base at position 16706571 is either G or A; the base at position 16706878 is either G or T; the base at position 16706880 is either A or C; and the base at position 16707205 is either C or T. The base at position 16707333 is C or T; the base at position 16707432 is T or C; the base at position 16707441 is T or C; the base at position 16707456 is G or T; the base at position 16707487 is A or C; the base at position 16707590 is T or A; the base at position 16707683 is T or G; the base at position 16707763 is T or G; the base at position 16707767 is T or A; the base at position 16707839 is T or A; the base at position 16707885 is A or G.
2. The SNP marker according to claim 1, characterized in that, When the 16705205th, 16705214th, 16705354th, 16705372nd, 16705609th, 16706369th, 16706492nd, 16706571st, 16706878th, 16706880th, 16707205th, 16707333rd, 1670743rd The highest germination index of grape seeds is achieved when the bases at positions 2, 16707441, 16707456, 16707487, 16707590, 16707683, 16707763, 16707767, 16707839, and 16707885 are TTTGTTGATCCTCCGCAGGTAG, respectively.
3. A primer pair for detecting the SNP marker of claim 1 or 2, characterized in that, The sequence of the upstream primer of the primer pair is shown in SEQ ID No. 1, and the sequence of the downstream primer is shown in SEQ ID No.
2.
4. A kit for detecting the SNP marker of claim 1 or 2, characterized in that, It includes the primer pair as described in claim 3.
5. The application of the SNP marker of claim 1 or 2, the primer pair of claim 3, or the kit of claim 4 in determining the germination index of grape seeds.
6. The application according to claim 5, characterized in that, To determine the germination index of grape seeds during the grape seedling stage.
7. A method for determining the germination index of grape seeds, characterized in that, Includes the following steps: 1) RNA was extracted from leaves of different grape varieties and reverse transcribed into cDNA; 2) Using the cDNA described in step 1) as a template, perform full-length TA cloning of the gene using the primer pair described in claim 3 to obtain the amplification result; 3) Based on the amplification results described in step 2), perform transformation and plating, single clone screening, plasmid extraction and sequencing, sequence analysis and haplotype determination to predict the germination index of grape seeds in advance.
8. The method according to claim 7, characterized in that, Step 2) The amplification system is as follows: 2.5 µL cDNA, 1.0 µL upstream primer with a concentration of 7.5 µM, 1.0 µL downstream primer with a concentration of 7.5 µM, 12.5 µL 2×q-PCR mixture and 8.0 µL ddH2O, with a total volume of 25 µL.
9. The method according to claim 7, characterized in that, The amplification program in step 2) is as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 1 min, 55 °C annealing for 1 min, 72 °C extension for 1.5 min, for 40 cycles.
10. The method according to claim 7, characterized in that, Step 3) The transformation and plating method is as follows: use DH5α chemocompetent cells, place them on ice for 30 minutes, heat shock them at 42°C for 45 seconds, and quickly return them to ice for 2-3 minutes; add 600 μL of LB medium, shake them at 37°C for 1 hour to improve recovery efficiency; plating them on LB plates containing ampicillin, and incubating them at 37°C for 12-16 hours. Step 3) The monoclonal screening method selects no less than 10 monoclonal clones for each sample to cover allele diversity, uses colony PCR for initial screening, uses universal primers for vectors, and confirms that the inserted fragment size is correct. Step 3) The plasmid extraction and sequencing method is as follows: plasmid is extracted using a miniprep kit at a concentration ≥50 ng / μL, with an A260 / A280 ratio between 1.8 and 2.0; M13 universal primers are used for sequencing to ensure full sequence coverage. Step 3) The method for sequence analysis and haplotype determination is to align the sequencing results to the reference sequence, identify SNP sites, and clarify the haplotype relationship between different varieties.