QTN fragments associated with corn row number, molecular markers and applications thereof

Abstract

This invention belongs to the field of maize breeding technology, specifically involving QTN fragments, molecular markers, and their applications related to maize row kernel number. This invention locates the C / T allelic variation at position 19082358 on chromosome 8, which expresses different maize row kernel number traits. When the allelic variation at position 19082358 is C, the maize has a higher row kernel number; when the allelic variation at position 19082358 is T, the maize has a lower row kernel number. This provides an effective molecular-assisted selection method for selecting maize lines with superior row kernel number traits. Applied to maize row kernel number genetic improvement and breeding, it improves selection efficiency and accelerates the maize row kernel number breeding process. Furthermore, pollinating and preserving maize plants carrying allelic variations with multiple row kernel numbers for breeding hybrids with multiple row kernel numbers shows broad prospects.

Description

Technical Field

[0001] This invention belongs to the field of maize breeding technology, specifically involving QTN fragments, molecular markers and their applications related to maize row kernel number. Background Technology

[0002] Maize is a globally important food, feed, and energy crop, playing an irreplaceable role in ensuring food security, promoting sustainable livestock development, and driving bioenergy development. With the continued growth of the global population and the intensification of climate change, food security issues are becoming increasingly prominent. Against this backdrop, achieving high and stable maize yields has become a core objective of modern breeding. Kernel number per row, as an important component of maize yield, exhibits high heritability and is significantly positively correlated with yield; therefore, breeding maize varieties with high kernel number per row is of great significance for increasing yield. However, kernel number per row is a typical complex quantitative trait, jointly regulated by multiple gene loci with minor effects and environmental factors. Therefore, analyzing the genetic segments controlling kernel number per row and using molecular-assisted selection to identify and screen germplasm resources with high kernel number per row are key approaches to promoting the breeding of new high-yielding maize varieties.

[0003] The number of kernels per row in maize is a typical quantitative trait, easily influenced by environmental conditions. Traditional breeding methods for screening germplasm resources with high kernel counts often suffer from limitations such as long breeding cycles and low efficiency, failing to meet the current demands for efficient breeding. In contrast, molecular marker-assisted selection (MAG) technology offers advantages such as high sensitivity, strong specificity, accuracy, reliability, and independence from the organism's growth stage and environmental conditions. It can significantly accelerate the identification and utilization of maize germplasm resources with high kernel counts, thus providing strong support for the breeding of high-yielding maize varieties. Summary of the Invention

[0004] Based on the above background, this invention not only provides QTN fragments, molecular markers and their applications related to the number of kernels per row in maize, but also provides an effective and reliable molecular-assisted selection method for the genetic improvement or breeding of maize kernel number traits through the application of QTN fragments and their molecular markers.

[0005] The technical solution of this invention is as follows:

[0006] The application of biological materials related to the number of kernels per row in maize, wherein the biological materials are selected from any one of A1) to A4) below;

[0007] A1) Molecular markers related to the number of kernels per row in maize: the molecular markers are located on chromosome 8 of maize, and the nucleotide sequences of the molecular markers are shown in SEQ ID NO.1 or SEQ ID NO.2;

[0008] A2) Primers for amplifying the molecular marker related to maize row kernel number in A1), said primers comprising a left primer with the nucleotide sequence shown in SEQ ID NO.3 and a right primer with the nucleotide sequence shown in SEQ ID NO.4:

[0009] Left primer F SEQ ID NO.3: TCGACATGGCCTCCCTTATG;

[0010] Right primer R SEQ ID NO.4: AACAAGTCTGTAAGCAAACCCC;

[0011] A3) A kit containing the primers described in A2);

[0012] A4) Probes or gene chips that specifically detect SNP site bases, wherein the SNP site is located at position 19082358 on chromosome 8 in the B73 RefGen_v4 reference genome, and it exhibits C / T allelic variation;

[0013] The application includes any one of the following B1) to B6):

[0014] B1) Application of marker-assisted selection breeding for maize row and kernel number traits;

[0015] B2) Application in the genetic improvement of maize row kernel number trait;

[0016] B3) Application in screening maize varieties or lines with a large number of kernels per row;

[0017] B4) Application in identifying and / or predicting the number of kernels per row in maize;

[0018] B5) Application in germplasm resource improvement of maize row kernel number trait;

[0019] B6) Application in detecting the number of kernels per row in maize.

[0020] Furthermore, maize with the SNP locus genotype CC or CT exhibits a higher number of kernels per row than maize with the genotype TT. That is, when the SNP locus genotype is CC or CT, the maize has a higher number of kernels per row; when the SNP locus genotype is TT, the maize has a lower number of kernels per row.

[0021] Based on the same inventive concept, this invention also provides a method for detecting the row kernel number trait in maize. Using the maize genome as a template, the maize gene is amplified by PCR using the primers described in claim 1 to obtain the amplification product. The amplification product is then sequenced. Maize carrying the molecular marker with the nucleotide sequence SEQ ID NO.1 exhibits a better row kernel number trait than maize not carrying the molecular marker with SEQ ID NO.1; that is, maize carrying the molecular marker with the nucleotide sequence SEQ ID NO.1 has a higher row kernel number.

[0022] Alternatively, probes or gene chips specifically designed to detect SNP genotypes can be used to detect the genomic DNA of maize samples, obtaining the base composition of the SNP sites and identifying the genetic nature of the SNPs. For example, maize with CC or CT allelic variants at SNP sites has a higher number of kernels per row than maize with the TT genotype, meaning that maize with CC or CT allelic variants at SNP sites has a higher number of kernels per row.

[0023] Based on the same inventive concept, this invention provides a method for identifying and / or screening maize with a high number of kernels per row. A maize sample to be tested is taken, and the maize gene is amplified by PCR using the primers described above to obtain the amplification product. The amplification product is sequenced and identified. If the identification result shows that the maize carries the molecular marker whose nucleotide sequence is SEQ ID NO.1, then the maize has a high number of kernels per row. If the result shows that the maize does not carry the molecular marker whose nucleotide sequence is SEQ ID NO.1 as described in claim 1, then the maize has a low number of kernels per row.

[0024] Alternatively, probes or gene chips specifically designed to detect SNP genotypes can be used to detect the genomic DNA of maize samples to obtain the base composition of the SNP sites. If the SNP sites show CC or CT allelic variations, the maize will have a higher number of kernels per row. If the SNP sites show TT genotypes, the maize will have a lower number of kernels per row.

[0025] Furthermore, the corn sample includes leaves or seeds from a single corn plant.

[0026] Based on the same inventive concept, the present invention also provides a method for cultivating maize, which uses maize single plant leaf DNA as a template, performs PCR amplification with the primers mentioned above, and obtains amplification products; the amplification products are sequenced and identified, and if the identification results show that the maize carries the molecular marker whose nucleotide sequence is SEQ ID NO.1, then the maize single plant is self-pollinated to obtain a stable genetic inbred line of the target gene.

[0027] Alternatively, probes or gene chips specifically designed to detect SNP genotypes can be used to detect the DNA of the maize plant leaf genome to obtain the base composition of the SNP sites. If the SNP sites show CC or CT allelic variations, the maize plants can be self-pollinated to obtain stable inbred lines that inherit the target gene.

[0028] Based on the same inventive concept, this invention also provides a maize breeding method, wherein the maize with a higher number of kernels per row obtained above is used as the germplasm parent.

[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0030] This invention provides an effective molecular-assisted selection method for selecting maize lines with superior row kernel number traits. It can be applied to the genetic improvement and breeding of maize row kernel number to improve selection efficiency and accelerate the breeding process. By pollinating and preserving maize individual plants carrying allelic variations of superior row kernel number traits, it can be used to breed hybrids with a large number of rows kernels, which has broad prospects. Attached Figure Description

[0031] Appendix Figure 1 This is a statistical analysis of the site differences and the number of kernels per row in each maize plant material in Example 2 of the present invention. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to its embodiments; it should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0033] Example 1: Determination and development of the QTN fragment and molecular marker of the present invention.

[0034] The inventor 60 Co-γ ray irradiation was used to construct 1335 near-isogenic lines with diverse backgrounds (ZF934, ZF1015, etc.) and 626 ZF6218 mutagenesis populations. Specifically, three warm-climate improved backbone inbred lines with significant genetic background differences—T32, ZH6218, and ZNC442—were selected as recipient materials. 1300 seeds from each inbred line were selected and irradiated with 200 Gy of Co-γ ray irradiation. 60Selected seeds were irradiated with Co-γ rays for 200 minutes. The irradiated seeds were then sown individually. Individual plants exhibiting normal growth and capable of flowering and fruiting were selected for two consecutive generations of self-pollination and evaluation of ear grain number. This resulted in 1355 near-isogenic lines from different backbone lines, including 486 near-isogenic lines of T32 (TF32), 243 near-isogenic lines of ZNC442 (NF442), and 626 near-isogenic lines of ZH6218 (NF442). Genotyping of the tested materials was performed using the Maize SNP 10 chip. Combined with GWAS and linkage analysis, genetic segments closely linked to row grain number variation in maize were identified. A QTN fragment KNR8, with a length of 351 bp, was identified at position 19082182-19082533 (B73 V4) on chromosome 8 of maize, controlling row grain number.

[0035] The QTN fragment exhibits a C / T allelic mutation at the Chr8_S_19082358 locus. Combined with phenotypic analysis, it was found that when the Chr8_S_19082358 locus showed a C allelic variation, the average number of kernels per row in maize was greater than 26, indicating a higher kernel count. Conversely, when all Chr8_S_19082358 loci showed a T allelic variation, the average number of kernels per row in maize was less than 14, indicating a lower kernel count. Specifically, when the genotype of the Chr8_S_19082358 locus in maize is CT or CC, the kernel count is higher; when the genotype is TT, the kernel count is lower. A molecular marker related to maize kernel count was developed accordingly.

[0036] To address the phenotypes corresponding to the QTN and Chr8_S_19082358 allelic variations, molecular markers have been developed. These markers include the Chr8_S_19082358 site. For example, if the Chr8_S_19082358 site exhibits a C allelic variation, a molecular marker with the nucleotide sequence shown in SEQ ID NO. 1 has been developed. Specifically, the nucleotide sequence of SEQ ID NO. 1 is as follows:

[0037] 19082182(bp)TCGACATGGCCTCCCTTATGCTCGCCTCCGCCGACCTCCTCCTCACCTCCCCGTCGCGCGTCTCGGACAAAGGTACCTTTCTTCTCTCTCGTAATTCAGAGATCTTATGTGCTTGAGCCTTTAACTCCGTTTTTGCAGACCTGGAGTGCGTTCTCTCCGTCATCTGCAG CCTCGTCACCAAGGCCGGATCCGAGGACCAGGCGCTGCAGATCACCGAACTCATCTGCGCTAAGCTCACCCAGCAACACGGTGACAAGCCAGCGCTGCGCCTCAAAGTGTAAGCAACAACCGTTAGCTGGGATTTCGATCGTTTGTTTGTGGCTTCCAAAGGGGTTTGCTTACAGACTTGTT 19082533(bp);

[0038] If the Chr8_S_19082358 site exhibits a T allelic variation, the nucleotide sequence is as shown in SEQ ID NO.2. Specifically, the nucleotide sequence of SEQ ID NO.2 is as follows:

[0039] 19082182(bp)TCGACATGGCCTCCCTTATGCTCGCCTCCGCCGACCTCCTCCTCACCTCCCCGTCGCGCGTCTCGGACAAAGGTACCTTTCTTCTCTCTCGTAATTCAGAGATCTTATGTGCTTGAGCCTTTAACTCCGTTTTTGCAGACCTGGAGTGCGTTCTCTCCGTCATCTGCAG CCTCGTTACCAAGGCCGGATCCGAGGACCAGGCGCTGCAGATCACCGAACTCATCTGCGCTAAGCTCACCCAGCAACACGGTGACAAGCCAGCGCTGCGCCTCAAAGTGTAAGCAACAACCGTTAGCTGGGATTTCGATCGTTTGTTTGTGGCTTCCAAAGGGGTTTGCTTACAGACTTGTT 19082533(bp);

[0040] Amplification primers for the aforementioned molecular markers were developed, as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0041] Specifically, the left primer F: TCGACATGGCCTCCCTTATG (SEQ ID NO.3);

[0042] Right primer R: AACAAGTCTGTAAGCAAACCCC (SEQ ID NO.4).

[0043] Example 2: In this example, the following maize inbred lines were used to verify the molecular markers: B104, Mo17, RA775, T32, QB5725, QB7055, QB7551, QB8069, QB7630, C617, C78, ​​CML518, EY680, QB4855, QB5836, QB6942, QB7348, QB7524, and QB8059.

[0044] Primers were used to amplify and sequence maize inbred lines B104, Mo17, RA775, T32, QB5725, QB7055, QB7551, QB8069 (white), QB7630, C617, C78, ​​CML518, EY680, QB4855, QB5836, QB6942, QB7348, QB7524, and QB8059. Sequence comparisons revealed a difference at 19082358 bp, specifically a C / T allelic variation at this position. The maize varieties B104, Mo17, RA775, T32, QB5725, QB7055, QB7551, QB8069 (white), and QB7630, which exhibit a higher number of kernels per row, show C allelic variation at 19082358bp. The average number of kernels per row for these maize materials is greater than 26. The varieties C617, C78, ​​CML518, EY680, QB4855, QB5836, QB6942, QB7348, QB7524, and QB8059, which exhibit a lower number of kernels per row, all show T allelic variation at 19082358bp. Figure 1 The average number of kernels per row in corn material is less than 14.

[0045] Example 3: Reference parameters for the process of amplifying molecular markers using primers of the present invention.

[0046] DNA extraction: Tiangen Biotech's new plant genomic DNA extraction kit (centrifuge column type), DNA concentration was measured afterward.

[0047] Dilute to 15µg / ml;

[0048] 25 μL reaction system (Table 1)

[0049] Table 1: Reaction System

[0050]

[0051] PCR amplification program (Table 2)

[0052] Table 2: PCR amplification program

[0053]

[0054] Electrophoresis: 1% agarose gel; 1×TAE buffer; electrophoresis at 120V and 150mA for 20 minutes.

[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of biomaterials related to the number of kernels per row in maize, characterized in that, The biological material is selected from any one of A1) to A4) below; A1) Molecular markers related to the number of kernels per row in maize: the molecular markers are located on chromosome 8 of maize, and the nucleotide sequences of the molecular markers are shown in SEQ ID NO.1; A2) Primers for amplifying the molecular markers related to maize row kernel number in A1), said primers comprising a left primer with the nucleotide sequence shown in SEQ ID NO.3 and a right primer with the nucleotide sequence shown in SEQ ID NO.4: Left primer F SEQ ID NO.3: TCGACATGGCCTCCCTTATG; Right primer R SEQ ID NO.4: AACAAGTCTGTAAGCAAACCCC; A3) A kit containing the primers described in A2); A4) Probes or gene chips that specifically detect SNP site bases, wherein the SNP site is located at position 19082358 on chromosome 8 in the B73 RefGen_v4 reference genome, and it exhibits C / T allelic variation; The application includes any one of the following B1) to B6): B1) Application of marker-assisted selection breeding for maize row and kernel number traits; B2) Application in the genetic improvement of maize row kernel number trait; B3) Application in screening maize varieties or lines with a large number of kernels per row; B4) Application in identifying and / or predicting the number of kernels per row in maize; B5) Application in germplasm resource improvement of maize row kernel number trait; B6) Application in detecting the number of kernels per row in maize.

2. The application of the biomaterial related to the number of kernels per row of maize according to claim 1, characterized in that, The row kernel number trait of maize with the genotype CC or CT at the SNP locus is superior to that of maize with the genotype TT.

3. The application of the biomaterial related to the number of kernels per row of maize according to claim 2, characterized in that, When the genotype of the SNP locus is CC or CT, the number of kernels per row in maize is relatively high; when the genotype of the SNP locus is TT, the number of kernels per row in maize is relatively low.

4. A method for detecting the number of kernels per row in maize, characterized in that, Using the maize genome to be tested as a template, the maize gene was amplified by PCR using the primers described in claim 1 to obtain the amplification product. The amplification product was sequenced. The maize with the molecular marker carrying the molecular marker with the nucleotide sequence of claim 1 as SEQ ID NO.1 had a better maize row number trait than maize without the molecular marker carrying SEQ ID NO.

1. Alternatively, probes or gene chips specifically designed to detect SNP genotypes can be used to detect the genomic DNA of maize samples to obtain the base information of the SNP sites described in claim 1, thereby identifying the genetic nature of the SNPs. For example, maize with SNP genotypes of CC or CT allelic variants has a higher number of kernels per row than maize with the TT genotype.

5. A method for identifying and / or screening corn with a large number of kernels per row, characterized in that, Take a corn sample to be tested, use its genome as a template, and perform PCR amplification on the corn gene using the primers described in claim 1 to obtain the amplification product. Sequencing the amplification product will show that the corn carries the molecular marker with the nucleotide sequence described in claim 1 as SEQ ID NO.1, and the corn has a large number of kernels per row. If the results show that the corn does not carry the molecular marker with the nucleotide sequence described in claim 1 as SEQ ID NO.1, the corn has a small number of kernels per row. Alternatively, probes or gene chips specifically designed to detect SNP genotypes can be used to detect the genomic DNA of maize samples to obtain the base composition of the SNP sites as described in claim 1. For example, if the SNP genotype shows CC or CT, the maize will have a higher number of kernels per row; if the SNP genotype shows TT, the maize will have a lower number of kernels per row.

6. The method for identifying and / or screening corn with a large number of kernels per row according to claim 5, characterized in that, The corn samples include leaves or seeds from individual corn plants.

7. A method for cultivating maize, characterized in that, Using maize single plant DNA as a template, PCR amplification was performed using the primers described in claim 1 to obtain amplification products; the amplification products were sequenced and identified; if the identification results showed that the maize carried the molecular marker with the nucleotide sequence described in claim 1 as SEQ ID NO.1, then the maize single plant was self-pollinated to obtain a stable inbred line for the target gene. Alternatively, probes or gene chips specifically designed to detect SNP genotypes can be used to detect the DNA in the genome of a single maize plant leaf to obtain the base sequence of the SNP site as described in claim 1. If the SNP genotype shows CC or CT, then the single maize plant can be self-pollinated to obtain a stable inbred line for the target gene.

8. A method for breeding maize, characterized in that, During breeding, the maize with a higher number of kernels per row obtained in claim 7 is used as the germplasm parent.

Images