Primer pair of indel molecular marker for assisting selection of barley powdery mildew resistance gene and application thereof

Abstract

This invention provides a primer pair for assisting the selection of Indel molecular markers for barley powdery mildew resistance genes and its application. This invention belongs to the field of molecular marker technology. The primer pair for assisting the selection of Indel molecular markers for barley powdery mildew resistance genes provided by this invention has the nucleotide sequence of the upstream primer as shown in SEQ ID No. 1 and the nucleotide sequence of the downstream primer as shown in SEQ ID No. 2. This primer pair produces a specific band of 149 bp in resistant barley. It enables the rapid acquisition of barley materials containing the powdery mildew resistance gene derived from Fengdamai 7, providing a more efficient method for barley powdery mildew resistance breeding and greatly improving breeding efficiency.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to a primer pair for an Indel molecular marker used to assist in the selection of barley powdery mildew resistance genes and its application. Background Technology

[0002] Barley is an important food, feed, and brewing crop. Barley powdery mildew is caused by *Pseudomonas graminearum*, a barley-specific strain. Blumeria graminis f.sp.hordei Caused by powdery mildew (Bgh), it is a major fungal disease in barley-producing regions worldwide, leading to yield reductions of 10% to 40%, severely impacting both yield and quality. The wild-type Mlo gene acts as a negative regulator of disease resistance. The recessive mutant mlo exhibits broad-spectrum and durable resistance to all known Bgh races. However, while the mlo gene provides immunity against powdery mildew, it also reduces yield due to spontaneous necrosis of barley tissue. Therefore, the recessive mutant mlo gene has limited value for barley disease resistance breeding.

[0003] Traditional disease resistance breeding relies on phenotypic identification, which is greatly affected by environmental and inoculation conditions, has a long cycle, and low selection efficiency. Molecular markers can directly achieve precise genotypic identification at the DNA level, breaking through the limitations of phenotypic selection and significantly improving the efficiency of disease resistance breeding. Fengdamai 7 is a superior barley variety developed by the Crop Research Institute of the Dali Prefecture Agricultural Science Extension Research Institute, exhibiting high resistance to barley powdery mildew. Using Fengdamai 7 as a parent, it is possible to create varieties and lines highly resistant to barley powdery mildew.

[0004] Therefore, developing a molecular marker that can rapidly and accurately assist in the selection of powdery mildew resistance genes from Fengdamai 7 has important application value. Summary of the Invention

[0005] The purpose of this invention is to provide a primer pair for assisting in the selection of Indel molecular markers for barley powdery mildew resistance genes. This primer pair can efficiently distinguish whether barley materials carry the dominant powdery mildew resistance gene derived from Fengdamai 7.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a primer pair for assisting in the selection of Indel molecular markers for barley powdery mildew resistance genes. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2.

[0007] Preferably, the Indel molecular marker is located in the interval 605444919~633925328 on chromosome 4H of Fengdamai 7.

[0008] The present invention also provides the application of the primer pair or the Indel molecular marker described herein in barley powdery mildew-resistant assisted breeding.

[0009] Preferably, the amplification product in barley containing the dominant powdery mildew resistance gene derived from Fengdamai 7 is 149 bp.

[0010] This invention also provides a method for identifying the powdery mildew resistant genotype of Fengdamai 7 using the primer pair described above, comprising the following steps: (1) Extract genomic DNA from barley samples; (2) Using the DNA as a template, perform PCR amplification using the primer pair described above; (3) The amplification products were detected by agarose gel electrophoresis; (4) If the amplification product is 149 bp, the sample is determined to contain the powdery mildew resistance gene from Fengdamai No. 7.

[0011] Preferably, the PCR amplification reaction system described in step (2) comprises: 0.5~1.5 μL of DNA template, 8~12 μL of 2×Hieff Canace® AdvanceFast PCR Master Mix, 0.5~1.5 μL of upstream primer, and 0.5~1.5 μL of downstream primer.

[0012] Preferably, the initial concentration of the upstream primer in step (2) is 0.05~0.15 nmol / µL and the initial concentration of the downstream primer is 0.05~0.15 nmol / µL.

[0013] The PCR amplification program described in step (2) is as follows: 95℃ for 2~3 min; 95℃ for 10~20 s, 58℃ for 10~20 s, 72℃ for 20~30 s, 30~34 cycles; 72℃ for 4~6 min.

[0014] Preferably, the concentration of the agarose gel detected by agarose gel electrophoresis in step (3) is 3% to 5%.

[0015] Beneficial effects

[0016] This invention provides primer pairs for the auxiliary selection of indel molecular markers of barley powdery mildew resistance genes. By crossing the highly powdery mildew-resistant variety Fengdamai 7 with the highly susceptible variety Vlamingh, an F2 segregating population is constructed. Highly resistant and highly susceptible plants from the F2 population are selected for BSA pooled analysis to locate the powdery mildew resistance gene. Furthermore, indel primers related to the powdery mildew resistance gene locus are designed. This allows for rapid identification of barley materials containing the resistance gene, providing a more efficient method for barley powdery mildew resistance breeding and significantly improving breeding efficiency. Attached Figure Description

[0017] Figure 1This is a diagram showing the BSA analysis results of the mixed DNA of F2 generation plants highly resistant to powdery mildew and highly susceptible to powdery mildew, obtained using Indel in Example 1, to locate the disease resistance gene. Figure 2 This is an agarose gel electrophoresis image of the DNA amplification products of Fengda Barley No. 7 and Vlamingh in Example 1; Figure 3 This is an agarose gel electrophoresis image of the DNA amplification products of different resistant and susceptible barley varieties in Example 2, obtained by Indel amplification. Detailed Implementation

[0018] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0019] Example 1: Localization of the powdery mildew resistance gene in Fengdamai No. 7

[0020] (1) Target gene localization based on whole-genome resequencing and BSA analysis of mixed pools of 30 disease-resistant and 30 disease-susceptible progeny of Fengdamai 7 and Vlamingh.

[0021] Fengda Barley No. 7 is a superior barley variety bred by the Crop Research Institute of the Dali Prefecture Agricultural Science Extension Research Institute, while Vlamingh is a major barley variety cultivated in Australia. Seed samples of both varieties are preserved by the Cell Engineering Research Laboratory of the Shanghai Academy of Agricultural Sciences.

[0022] Using Fengdamai 7 as the male parent and Vlamingh as the female parent, a cross was conducted to construct an F2 segregating population.

[0023] The plants were allowed to develop the disease naturally in the field. Thirty highly resistant plants and 30 highly susceptible plants were selected. Leaves from the parent plants were collected and mixed separately from the highly resistant and highly susceptible plants. DNA was extracted and analyzed using BSA.

[0024] The criteria for evaluating barley disease resistance are as follows: Grade 0: Immune, plants show no symptoms related to powdery mildew; Grade 0: Near-immune, showing allergic necrosis and chlorosis. Grade 1: Highly resistant, with a thinner mycelial layer and fewer lesions, and can show a greenish hue; Grade 2: Moderately resistant, with a relatively thick mycelial layer that is not translucent green, and capable of producing a certain amount of spores; Level 3: Moderately susceptible, with a thick mycelial layer and many lesions, producing a large number of spores, but the mycelium will not merge into patches; Level 4: Highly susceptible, with thick and dense mycelial layer and numerous lesions, high sporulation, and mycelium forming patches; Analysis results as follows Figure 1As shown, there is a significant peak on the barley 4H chromosome (using the Hordeum vulgare r1 genome database), indicating that the powdery mildew resistance gene is located on the 4H chromosome of Fengda Barley 7 (chr4H: 605444919-633925328).

[0025] (2) Develop Indel molecular markers based on the gene localization region of powdery mildew resistance in Fengdamai No. 7.

[0026] Based on BSA resequencing results, sequences with indel differences in the chr4H region (605444919-633925328) of Fengdamai 7 and Vlamingh were analyzed, and indel primer pairs were designed. These included an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 1: TCAGTCCTCTCCCATCATCG, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2: TTGCCTTACATGACCTGGAG. DNA from Fengdamai 7 and Vlamingh plants was amplified using the indel primers. The PCR reaction volume was 20 µL, specifically: 10 µL of 2×Hieff Canace® AdvanceFast PCR Master Mix (With Dye), 1 µL of upstream primer (initial concentration 0.1 nmol / µL), 1 µL of downstream primer (initial concentration 0.1 nmol / µL), 1 µL of DNA template, and 7 µL of H2O. The amplification parameters were 94℃ for 3 min, followed by 32 cycles of 94℃ for 15 s, 58℃ for 15 s, and 72℃ for 20 s, followed by an extension at 72℃ for 5 min. After the amplification reaction, the product fragment size was determined using a 3% agarose gel.

[0027] The results are as follows Figure 2 As shown in the figure (where M: DNA marker; F: Fengdamai 7; V: Vlamingh), the amplified band of Fengdamai 7 is approximately 149 bp, and the amplified band of Vlamingh is approximately 130 bp. It is evident that the Indel primer pair can distinguish between Fengdamai 7 and Vlamingh plants.

[0028] Example 2: Indel primers distinguish between barley materials resistant to and susceptible to powdery mildew.

[0029] PCR amplification was performed using designed indel primers on different powdery mildew-resistant and powdery mildew-susceptible materials. Fengda Barley No. 6 and No. 7 are superior barley varieties bred by the Crop Research Institute of the Dali Prefecture Agricultural Science Extension Research Institute, highly resistant to powdery mildew; Vlamingh is a major Australian barley variety, highly susceptible to powdery mildew; Hua 30 and Hua 22 are superior barley varieties bred by the Cell Engineering Research Laboratory of the Biotechnology Institute of the Shanghai Academy of Agricultural Sciences, highly susceptible to powdery mildew; Supi Barley No. 3 is a superior barley variety bred by the Jiangsu Coastal Agricultural Science Research Institute, highly susceptible to powdery mildew. Seeds of the above varieties were preserved by the Cell Engineering Research Laboratory of the Shanghai Academy of Agricultural Sciences.

[0030] DNA was extracted from the above materials, and the amplification and detection methods were as described in Example 1. The results are as follows: Figure 3 As shown in the figure (where M: DNA marker; F: Fengdamai 7; V: Vlamingh; F6: Fengdamai 6; 1: Hua 30; 2: Hua 22; 3: Supimai 3), the amplified bands of Fengdamai 6 and 7 are approximately 149 bp, while the amplified bands of Vlamingh, Hua 30, Hua 22, and Supimai 3 are approximately 130 bp. This demonstrates that the Indel primer pair can distinguish the disease resistance gene originating from Fengdamai.

[0031] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer pair of an Indel molecular marker for assisting selection of a barley powdery mildew resistance gene, characterized in that, The nucleotide sequence of the upstream primer is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

2.

2. The primer pair as described in claim 1, characterized in that, The Indel molecular marker is located in the range of 605444919 to 633925328 on chromosome 4H of Fengda Barley 7.

3. The application of the primer pair of claim 1 or the Indel molecular marker in barley powdery mildew-resistant assisted breeding.

4. The application as described in claim 4, characterized in that, The amplification product of the primer pair in barley containing the dominant powdery mildew resistance gene from Fengdamai 7 was 149 bp.

5. A method for identifying the powdery mildew resistant genotype of Fengdamai 7 using the primer pair described in claim 1, comprising the following steps: (1) Extract genomic DNA from barley samples; (2) Using the DNA as a template, perform PCR amplification using the primer pair described in claim 1; (3) The amplification products were detected by agarose gel electrophoresis; (4) If the amplification product is 149 bp, the sample is determined to contain the powdery mildew resistance gene from Fengdamai No.

7.

6. The method as described in claim 5, characterized in that, The PCR amplification reaction system described in step (2) includes: 0.5~1.5 μL of DNA template, 8~12 μL of 2×Hieff Canace® AdvanceFast PCR Master Mix, 0.5~1.5 μL of upstream primer, and 0.5~1.5 μL of downstream primer.

7. The method as described in claim 6, characterized in that, The initial concentration of the upstream primer in step (2) is 0.05~0.15 nmol / µL, and the initial concentration of the downstream primer is 0.05~0.15 nmol / µL.

8. The method as described in claim 7, characterized in that, The PCR amplification program described in step (2) is as follows: 95℃ for 2~3 min; 95℃ for 10~20 s, 58℃ for 10~20 s, 72℃ for 20~30 s, 30~34 cycles; 72℃ for 4~6 min.

9. The method as described in claim 8, characterized in that, The concentration of agarose gel detected by agarose gel electrophoresis in step (3) is 3% to 5%.

Images