A circRNA marker for gastric cancer diagnosis and application thereof

Abstract

This invention belongs to the field of biotechnology and molecular diagnostics. Addressing the limitations of existing technologies in gastric cancer diagnosis, such as complex procedures, low patient compliance, and high costs, this invention proposes a circRNA biomarker for gastric cancer diagnosis and its application. The circRNA biomarker of this invention is hsa_circ_0001185. Quantitative analysis of hsa_circ_0001185 confirms its significant high expression in the serum of gastric cancer patients and its close correlation with clinical parameters such as tumor differentiation degree, lymph node metastasis, and TNM stage. It can significantly distinguish between gastric cancer patients, gastritis patients, and healthy individuals, exhibiting high sensitivity and specificity, thus providing a new solution for gastric cancer screening and auxiliary diagnosis.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and molecular diagnostics, and in particular to a circRNA biomarker for the diagnosis of gastric cancer and its application. Background Technology

[0002] Gastric cancer is one of the most common malignant tumors worldwide, ranking among the top in both incidence and mortality rates. According to the GLOBOCAN 2022 report, gastric cancer ranks fifth in global cancer incidence and has a persistently high mortality rate. Because early-stage gastric cancer lacks typical clinical symptoms, most patients are diagnosed at an advanced stage, leading to poor prognosis. Although treatment methods for gastric cancer have improved in recent years, low early diagnosis rates and high risks of recurrence and metastasis remain major challenges in clinical practice. Currently, the diagnosis of gastric cancer mainly relies on gastroscopy and histopathological biopsy, methods that are invasive, complex, equipment-dependent, and poorly tolerated by patients. Furthermore, commonly used serum biomarkers such as carcinoembryonic antigen (CEA), carbohydrate antigen CA199, and CA724, while useful for auxiliary diagnosis, have low sensitivity and specificity, making them insufficient for early gastric cancer screening. Therefore, developing highly sensitive and specific non-invasive biomarkers is of great significance for achieving early diagnosis and monitoring of treatment efficacy in gastric cancer.

[0003] In recent years, circular RNAs (circRNAs), as a novel type of non-coding RNA, have shown great potential in tumor liquid biopsy due to their closed structure, high stability, and widespread presence in body fluids. circRNAs can be formed through backsplicing, possess resistance to RNase degradation, and maintain high stability in body fluids such as blood and saliva, making them suitable as non-invasive diagnostic biomarkers. Existing studies have shown that circRNAs are abnormally expressed in various solid tumors and participate in the regulation of tumorigenesis and development, suggesting they may become novel molecular biomarkers for gastric cancer diagnosis. Currently, research on circRNAs in gastric cancer is still in its early stages, especially regarding specific circRNA biomarkers with clinical application potential. Although some studies have reported upregulation of certain circRNAs in gastric cancer, their stability in serum, diagnostic efficacy, and correlation with clinicopathological features remain unclear, and multi-center, large-sample clinical validation is lacking.

[0004] Therefore, finding and validating circRNA biomarkers with high diagnostic performance is a pressing technical problem that needs to be solved in the field of non-invasive diagnosis of gastric cancer. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention aims to provide a circRNA biomarker for gastric cancer diagnosis and its application. Targeting a novel circRNA molecule, hsa_circ_0001185, through systematic screening and experimental verification, it was first demonstrated that hsa_circ_0001185 is significantly highly expressed in the serum of gastric cancer patients. Furthermore, the hsa_circ_0001185 molecular biomarker possesses higher sensitivity and specificity, effectively distinguishing between gastric cancer and healthy individuals, and significantly differentiating between gastric cancer and benign gastric inflammation. This provides a new technical means and solution for the screening and auxiliary diagnosis of gastric cancer.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention discloses a circRNA biomarker for the diagnosis of gastric cancer, wherein the circRNA biomarker is hsa_circ_0001185, and the nucleotide sequence of hsa_circ_0001185 is shown in SEQ ID NO. 1.

[0008] Secondly, the present invention discloses a specific primer pair for detecting the above-mentioned circRNA markers, the specific primer pair comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer being shown in SEQ ID NO. 3.

[0009] Thirdly, the present invention discloses a kit for detecting the above-mentioned circRNA biomarkers, the kit comprising the above-mentioned specific primer pairs.

[0010] Furthermore, the kit also includes a reverse transcription reagent, a quantitative real-time PCR reagent, and a primer pair for amplifying the internal reference gene 18S rRNA. The reverse transcription reagent is HiScript III RT SuperMix, the quantitative real-time PCR reagent is Taq Pro Universal SYBR qPCR Master Mix, and the primer pair for amplifying the internal reference gene 18S rRNA includes the forward primer shown in SEQ ID NO. 4 and the reverse primer shown in SEQ ID NO. 5.

[0011] Fourthly, this invention discloses the application of specific primer pairs in the preparation of kits for detecting gastric cancer and precancerous lesions of the stomach.

[0012] Fifthly, this invention discloses the use of specific primer pairs in the preparation of products for distinguishing between patients with early-stage gastric cancer and healthy individuals.

[0013] Sixthly, this invention discloses a diagnostic system or model for circular RNA hsa_circ_0001185, including a sample hsa_circ_0001185 detection module, a data collection and storage module, a data processing module, and a result output and display module. The functions of each module are as follows:

[0014] Sample hsa_circ_0001185 detection module: This module uses RT-qPCR to detect the expression level of hsa_circ_0001185 in samples (such as serum) and obtain the specific expression level value;

[0015] Data collection and storage module: This module is used to collect and store clinical information and test data of samples, and to securely transmit the hsa_circ_0001185 expression value measured in module S1 to the S3 data processing module.

[0016] Data Analysis and Processing Module: This module is the core analysis unit, used to analyze and process the received data. Based on the expression level of hsa_circ_0001185, a diagnostic model is constructed through logistic regression analysis. The model calculation formula is as follows:

[0017] The logit(P) value was calculated as -4.962 + 2.989 × Exp (hsa_circ_0001185) [hsa_circ_0001185 expression level]. An ROC curve was plotted, a cutoff value was determined, and the final result data was transmitted to the output panel based on the established criteria. The criteria were: when used to diagnose gastric cancer (GC), the optimal cutoff value was 2.59. If the calculated logit(P) value was higher than the cutoff value, the diagnosis was gastric cancer; if the logit(P) value was lower than the cutoff value, the diagnosis was healthy.

[0018] When used to differentiate between gastric cancer and gastritis (precancerous lesions or high-risk conditions), the optimal cutoff value is 4.23. If the calculated logit(P) value is higher than the cutoff value, the diagnosis is gastric cancer; if the logit(P) value is lower than the cutoff value, the diagnosis is gastritis (precancerous lesions or high-risk conditions).

[0019] Result output display module: Used to output and display the diagnostic results given by the S3 module.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] 1. The core of this invention lies in the first-time proposal and verification of hsa_circ_0001185 as a novel molecular marker for the diagnosis of gastric cancer. The area under the curve for its use in diagnosing gastric cancer is as high as 0.909, which is significantly better than the serum protein markers for gastric cancer commonly used in clinical practice (such as CEA, CA199, CA724). This solves the key problem of insufficient sensitivity and specificity in existing serological diagnoses for gastric cancer, meets the needs of early screening and accurate diagnosis, and provides a new approach for early screening and non-invasive dynamic monitoring of gastric cancer.

[0022] 2. The hsa_circ_0001185 molecular marker of this invention, at its optimal cutoff value, achieves a sensitivity of 0.74 and a specificity of 0.89 in diagnosing gastric cancer, demonstrating strong sensitivity and specificity. Simultaneously, the hsa_circ_0001185 molecular marker also exhibits good performance in distinguishing between gastric cancer and benign gastritis (AUC=0.784). This balanced and excellent diagnostic efficacy allows for more effective identification of gastric cancer patients.

[0023] 3. The hsa_circ_0001185 molecular marker of the present invention belongs to circular RNA. Its covalently closed circular structure makes it more stable in serum than linear RNA, making it more suitable for liquid biopsy and convenient for clinical translation and application.

[0024] 4. Using the hsa_circ_0001185 molecular marker of the present invention for the diagnosis of gastric cancer, since the detection is entirely based on blood samples, it achieves true non-invasiveness, has high patient compliance, is suitable for large-scale population screening and regular monitoring of high-risk individuals, helps in the early diagnosis and treatment of gastric cancer, and is expected to improve patient prognosis.

[0025] 5. The expression level of the hsa_circ_0001185 molecular marker of the present invention is significantly correlated with the malignancy of gastric cancer, such as differentiation degree, lymph node metastasis, TNM stage, etc., and has the potential to serve as an indicator for disease progression and prognosis assessment. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0027] Figure 1 This invention compares the expression levels of hsa_circ_0001185 in the serum of gastric cancer (GC), gastritis, and healthy controls (HC) in embodiments of the present invention.

[0028] Figure 2 This is a comparison of the ROC curves of hsa_circ_0001185 with CEA, CA199, and CA724 in diagnosing gastric cancer in this embodiment of the invention.

[0029] Figure 3 This describes the expression characteristics of hsa_circ_0001185 in patients with gastric cancer and lymph node metastasis in this embodiment of the invention.

[0030] Figure 4 This describes the expression characteristics of hsa_circ_0001185 in different metastatic stages of gastric cancer in this embodiment of the invention. Detailed Implementation

[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are commercially available.

[0032] This invention provides a circRNA biomarker for the diagnosis of gastric cancer, wherein the circRNA biomarker is hsa_circ_0001185, and the nucleotide sequence of hsa_circ_0001185 is shown in SEQ ID NO. 1: GTCAAAGGCCCTTTCAGAAGCAACTCCATTTCATTGGATAACTTAAAACCCTCCAGAGTGTACTGTTTACAAGTCCAGGCACAACTGCTTTGGAACAAAAGTAACATCTTTAGAGTCGGGCATTTAAGCAACATATCTTGCTACGAAACAATGGCAGATGCCTCCACTGAGCTTCAGCAAGTCATCCTGATCTCCGTGGGAACATTTTCGTTGCTGTCGGTGCTGGCAGGAGCCTGTTTCTTCCTGGTCCTGAAATATAGAGGCCTGATTAAATACTGGTTTCACACTCCACCAAGCATCCCATTACAGATAGAAGAG.

[0033] The circular RNA hsa_circ_0001185 of this invention is located on chromosome 21. Its circular transcript is 318 bp in length and is formed by back-splicing circularization after transcription of exons 5 and 6 of the IFNGR2 gene. hsa_circ_0001185 has the potential to encode a protein, as its circular structure contains a complete open reading frame (ORF) that can encode a functional small polypeptide or protein. Furthermore, considering the core finding that hsa_circ_0001185 is specifically highly expressed in gastric cancer and associated with a malignant phenotype, inhibiting the expression of hsa_circ_0001185 or the function of its encoded product can inhibit the proliferation, migration, or invasion of gastric cancer cells.

[0034] The present invention also provides a specific primer pair for detecting circRNA markers, the specific primer pair comprising a forward primer and a reverse primer, wherein: the nucleotide sequence of the forward primer is shown in SEQ ID NO. 2: AGAAGAGGTCAAAGGCCCTT, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 3: TGTTGCTTAAATGCCCGACT.

[0035] This invention also provides a kit for detecting circRNA biomarkers, the kit comprising the specific primer pair described above, and further comprising a reverse transcription reagent (HiScript III RT SuperMix), a real-time PCR reagent, and a primer pair for amplifying the internal reference gene 18S rRNA, wherein the primer pair for amplifying the internal reference gene 18S rRNA comprises a forward primer as shown in SEQ ID NO. 4 and a reverse primer as shown in SEQ ID NO. 5, wherein:

[0036] SEQ ID NO.4: CGGCTACCACATCCAAGGAA;

[0037] SEQ ID NO.5: GCTGGAATTACCGCGGCT.

[0038] The kit described in this invention is designed to achieve stable and specific detection of hsa_circ_0001185 in serum. The DNA polymerase and buffer are preferably provided in the form of 2× SYBR Green qPCR premix (such as Taq Pro UniversalSYBR qPCR Master Mix). This premix contains all the enzymes and buffer components required for the detection, which helps standardize the detection process and ensures the reproducibility of results. The water must be RNase-free double-distilled water used for sample dilution, reagent preparation, and other steps to ensure the integrity of the RNA template and products throughout the detection process.

[0039] This invention also provides the application of specific primer pairs in the preparation of a gastric cancer prognostic detection kit.

[0040] The following detailed description, in conjunction with embodiments, illustrates the circRNA biomarkers for gastric cancer diagnosis provided by this invention and their applications, but these should not be construed as limiting the scope of protection of this invention.

[0041] All samples used in the following examples were approved by the Medical Ethics Committee of Zhongda Hospital Affiliated to Southeast University, and informed consent was obtained from patients and their families. The samples were serum from gastric cancer patients and gastritis patients who visited Zhongda Hospital Affiliated to Southeast University from January 2022 to December 2024, as well as serum from healthy individuals collected from the Health Examination Center of Zhongda Hospital Affiliated to Southeast University during the same period as healthy control serum. According to statistics, a total of 152 gastric cancer patients and 160 gastritis patients visited the hospital from January 2022 to December 2024, and 148 healthy controls were matched during the same period. All samples were collected by collecting 5 mL of venous blood upon admission. The collected venous blood was placed in a pyrogen-free and enzyme-free vacuum blood collection tube and left to stand at room temperature for 30 minutes. Then, it was centrifuged at 3000 r / min for 15 minutes at 4°C. The supernatant serum was carefully separated, aliquoted, and immediately stored in an ultra-low temperature freezer at -80°C for later use.

[0042] Example 1: Screening of molecular circRNA markers for gastric cancer

[0043] 1. Preliminary screening: Mining based on public databases and tissue sequencing data

[0044] To systematically discover potential circRNA biomarkers associated with gastric cancer, a high-throughput sequencing dataset numbered GSE152309 was first obtained from the Gene Expression Omnibus (GEO) database. This dataset contains circRNA expression profiles of tumor tissues from five gastric cancer patients and their matched adjacent normal tissues.

[0045] 1) Data Acquisition and Processing:

[0046] Raw sequencing data were downloaded from the GEO database, accessible at https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE152309. The raw sequencing data were compared and annotated, identifying a total of 10,532 circRNA molecules.

[0047] 2) Differential expression analysis:

[0048] The "limma" R software package was used to perform differential expression analysis of circRNAs between gastric cancer tissues and adjacent normal tissues. The screening threshold was set as follows: log2|fold change (FC)| ≥ 2 and adjusted P value ≤ 0.05. Under this criterion, a total of 167 significantly differentially expressed circRNAs were identified, of which 59 were significantly upregulated in gastric cancer tissues and 108 were significantly downregulated.

[0049] 3) Initial screening of targets:

[0050] The study focused on circRNAs that were significantly upregulated in gastric cancer tissues, as they have greater potential as detectable diagnostic biomarkers in plasma. From 59 significantly upregulated circRNAs, the five candidate circRNAs with the most significant upregulation were selected based on the significance level and expression level of the expression difference for further validation. hsa_circ_0001185 of this invention was among them.

[0051] 2. Serum sample verification: Transformation from tissue to fluid

[0052] To validate the diagnostic potential of candidate circRNAs in non-invasive liquid biopsy, preliminary testing was performed on independently collected serum samples.

[0053] 1) Sample preparation:

[0054] Serum samples were randomly selected from the above sample from 20 patients with gastric cancer (GC) and 20 age- and sex-matched healthy controls (HC). All patients with gastric cancer were pathologically diagnosed and had not received neoadjuvant therapy before surgery.

[0055] 2) RNA extraction and reverse transcription:

[0056] 200 μL of serum was collected, and total RNA was extracted using TRIzol LS Reagent (Invitrogen, Germany). RNA concentration and purity were determined using NanoDrop (A260 / A280 ratio between 1.8 and 2.0 was considered acceptable). 10 μL of total RNA was used for reverse transcription under the following conditions: 42℃ for 60 min, 70℃ for 5 min, and 4℃ ∞. The reaction system is shown in the table below.

[0057]

[0058] 3) Real-time quantitative PCR (qRT-PCR):

[0059] Primers spanning the specific backsplicing sites of the five candidate circRNAs identified in the initial screening were designed. Detection was performed using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China) on an Applied Biosystems 7500 real-time quantitative PCR instrument. After preparation, the mixture was homogenized, centrifuged, and the reaction conditions were 95℃ for 10 min; 95℃ for 15 s, 60℃ for 30 s, 72℃ for 30 s, for 40 cycles. The qRT-PCR reaction system is shown in the table below:

[0060]

[0061] Standardization was performed using 18S rRNA as an internal reference gene. (The last part, "utilizing 2," appears to be incomplete and lacks context. It's unclear what "2" refers to.) -△△Ct The algorithm calculates the relative expression level of hsa_circ_0001185, ΔΔCt = experimental group (Ct) hsa_circ_0001185 -Ct 18S Mean - Control Group (Ct) hsa_circ_0001185 -Ct 18S (mean)

[0062] qPCR results showed that the expression level of hsa_circ_0001185 in the serum of gastric cancer patients was significantly higher than that in the healthy control group (P < 0.0001), which was consistent with the trend of tissue sequencing data. It can be used as a biomarker for the diagnosis of gastric cancer. Its sequence listing is shown in SEQ ID NO. 1. Detailed information of hsa_circ_0001185 is shown in Table 1. Specific primer pairs for detecting hsa_circ_0001185 and corresponding internal reference gene primer pairs are shown in Table 2.

[0063] SEQ ID NO. 1:

[0064] GTCAAAGGCCCTTTCAGAAGCAACTCCATTTCATTGGATAACTTAAAACCCTCCAGAGTGTACTGTTTACAAGTCCAGGCACAACTGCTTTGGAACAAAAGTAACATCTTTAGAGTCGGGCATTTAAGCAACATATCTTGCTACGAAACAATGGCAGAT GCCTCCACTGAGCTTCAGCAAGTCATCCTGATCTCCGTGGGAACATTTTCGTTGCTGTCGGTGCTGGCAGGAGCCTGTTTCTTCCTGGTCCTGAAATATAGAGGCCTGATTAAATACTGGTTTCACACTCCACCAAGCATCCCATTACAGATAGAAGAG.

[0065] Table 1. Information on the circRNA molecule hsa_circ_0001185

[0066]

[0067] Table 2. Specific primer pairs for detecting hsa_circ_0001185 and corresponding internal reference gene primer pairs.

[0068]

[0069] In summary, this embodiment screened and identified a molecular marker hsa_circ_0001185 composed of a circular RNA, which was significantly highly expressed in the serum of gastric cancer patients.

[0070] Example 2: Correlation analysis of hsa_circ_0001185 expression with clinicopathological parameters of gastric cancer

[0071] Based on the detection data of 152 gastric cancer patients, including those in Example 1, the patients were divided into high expression group and low expression group according to the median expression of hsa_circ_0001185. The chi-square test was used to analyze the correlation between the expression level of hsa_circ_0001185 and various clinicopathological parameters.

[0072] The analysis results are shown in Table 3. High expression of hsa_circ_0001185 was significantly correlated with clinicopathological parameters of gastric cancer, including differentiation degree, lymph node metastasis, TNM stage, and neurovascular invasion (P < 0.05). Figure 3 As shown, regarding TNM staging, hsa_circ_0001185 expression was significantly higher in stage III–IV patients than in stage I–II patients; Figure 4As shown, further analysis revealed that, regarding lymph node metastasis, hsa_circ_0001185 was expressed significantly higher in gastric cancer patients with lymph node metastasis than in those without. This result indicates that the expression level of hsa_circ_0001185 is closely related to the malignant progression of gastric cancer.

[0073] Table 3. Correlation between hsa_circ_0001185 expression and clinicopathological parameters analyzed using the chi-square test.

[0074]

[0075] Example 3: Performance evaluation of hsa_circ_0001185 in gastric cancer diagnosis

[0076] Receiver operating characteristic (ROC) curves were plotted based on the test data of 152 gastric cancer patients (including those in Example 1) and 148 healthy controls to evaluate the diagnostic efficacy of hsa_circ_0001185 for gastric cancer.

[0077] ROC curves were plotted using GraphPad Prism 9.5 software, and the area under the curve (AUC), cut-off value, sensitivity (SEN), and specificity (SPE) were calculated. In this embodiment, overall accuracy (ACCU), positive predictive value (PPV), and negative predictive value (NPV) were introduced to compare the diagnostic performance of the molecular marker hsa_circ_0001185 of this invention with that of commonly used serum protein markers (CEA, CA199, CA724).

[0078] like Figure 2 As shown, the AUC of hsa_circ_0001185 for diagnosing gastric cancer was 0.909, the sensitivity was 0.74, and the specificity was 0.89. The results are shown in Table 4. This verifies that the diagnostic performance of hsa_circ_0001185 of the present invention is significantly better than that of traditional serum protein markers CEA (AUC=0.733), CA199 (AUC=0.619), and CA724 (AUC=0.637).

[0079] Table 4. Diagnostic performance of hsa_circ_0001185 in distinguishing between gastric cancer patients and healthy controls.

[0080]

[0081] It is evident that the molecular marker hsa_circ_0001185 can be used for the diagnosis of gastric cancer, improving the simplicity and accuracy of gastric cancer diagnosis and having significant implications for further diagnosis and treatment of patients.

[0082] Example 4: Application of hsa_circ_0001185 in the diagnosis of gastric cancer

[0083] 1. Used for the diagnosis of early-stage gastric cancer (stage I / II);

[0084] Serum samples were collected from 152 gastric cancer (GC) patients (including those in Example 1) and 148 healthy controls (HC). Total RNA was extracted from serum using the same TRIzol LS reagent as in Example 1, and reverse transcribed into cDNA using HiScript III RTSuperMix. Subsequently, real-time quantitative PCR was performed using specific primers for hsa_circ_0001185 to detect its expression level in each sample.

[0085] Using the expression level of hsa_circ_0001185 as the sole variable, receiver operating characteristic (ROC) curves were plotted to distinguish between early-stage gastric cancer (stage I / II) and healthy controls. The results showed that the area under the curve (AUC) for diagnosing early-stage gastric cancer was 0.853. The optimal cutoff value was determined using the Youden index; samples with hsa_circ_0001185 expression levels above this cutoff value were considered to have early-stage gastric cancer, while those below were considered healthy. Under these conditions, the diagnostic sensitivity reached 72%, and the specificity reached 85%. Therefore, hsa_circ_0001185 can effectively distinguish early-stage gastric cancer patients from healthy individuals, providing a highly specific molecular tool for the early screening and diagnosis of gastric cancer.

[0086] 2. Differential diagnosis between gastric cancer and gastritis;

[0087] Serum samples were further selected from 152 patients with gastric cancer (GC) and 160 patients with precancerous lesions of the stomach (Gastritis patients, as described in Example 1) (same as the cohort in Example 1). The diagnosis of precancerous lesions of the stomach was based on clinical endoscopic and pathological examination results. The expression level of hsa_circ_0001185 in all samples was detected according to the method described in Example 1.

[0088] To differentiate between gastric cancer and gastritis, ROC curves were re-plotted and the optimal cutoff value was determined. The results showed that the AUC for hsa_circ_0001185 in differentiating between gastric cancer and gastritis was 0.784. When the expression level of hsa_circ_0001185 in a sample was higher than the optimal cutoff value, it was considered gastric cancer; when it was lower than the cutoff value, it was considered gastritis (a precancerous lesion). In this case, the diagnostic sensitivity was 59%, and the specificity was as high as 93%. Although the sensitivity was moderate, hsa_circ_0001185 exhibited extremely high specificity, meaning that when the test result was positive, the patient was highly likely to have gastric cancer rather than simple gastritis. This characteristic has significant clinical value for accurately identifying high-risk individuals or patients requiring urgent intervention for gastric cancer among a large number of gastritis patients, helping to avoid missed diagnoses and optimize the allocation of medical resources.

[0089] Example 5: Kit for detecting hsa_circ_0001185

[0090] The present invention also provides a kit for detecting hsa_circ_0001185, which can be applied to the in vitro diagnosis of gastric cancer (including the early diagnosis of gastric cancer). The kit contains a pair of fluorescent quantitative PCR primers (SEQ ID NO. 2 and SEQ ID NO. 3) for detecting the expression level of circular RNA hsa_circ_0001185 and reagents required for the fluorescent quantitative PCR reaction.

[0091] 1. The kit contains the following core components:

[0092] ① Specific primer pair: used to amplify the sequence spanning the hsa_circ_0001185 circular binding site, wherein:

[0093] Forward primer: AGAAGAGGTCAAAGGCCCT;

[0094] Reverse primer: TGTTGCTTAAATGCCCGACT.

[0095] ② Real-time PCR premix: Contains hot-start DNA polymerase, dNTPs, Mg²⁺, reaction buffer and SYBR Green I fluorescent dye, preferably 2× Taq Pro Universal SYBR qPCR Master Mix.

[0096] ③ Reverse transcription reagent: used to reverse transcribe the extracted RNA into cDNA, preferably HiScript III RTSuperMix for qPCR (containing reverse transcriptase, buffer, dNTPs and random primers).

[0097] ④ RNase-free water: used for diluting and preparing reaction systems.

[0098] Positive and negative controls (optional): A cDNA containing known high expression of hsa_circ_0001185 is used as a positive control, and a water sample without template cDNA is used as a negative control to monitor the experimental process.

[0099] 2. The reaction conditions were 95℃ for 10 min; 95℃ for 15 s, 60℃ for 30 s, 72℃ for 30 s, for 40 cycles; the quantitative PCR reaction system and procedure (20 μL reaction volume) are shown in the table below:

[0100]

[0101] 3. Instructions for using the reagent kit:

[0102] This kit is used to detect the expression level of hsa_circ_0001185 in serum samples and to assist in diagnosis. The specific steps are as follows: Sample processing and cDNA preparation: Take the serum sample to be tested, extract total RNA using an RNA extraction reagent (such as TRIzol LS), and use the HiScript III RT SuperMix in the kit to perform reverse transcription on an appropriate amount of total RNA (e.g., 1 μg) according to the instructions to synthesize cDNA. Real-time quantitative PCR detection: Take 2 μL of the prepared cDNA and perform real-time quantitative PCR amplification using the specific primer pairs and SYBR Green Master Mix provided in the kit, following the above reaction system and procedure. Result analysis and interpretation: Obtain the Ct values ​​of hsa_circ_0001185 and the internal reference gene (e.g., 18S rRNA) using the instrument's software, calculate their relative expression level using the 2⁻ΔΔCt method, substitute the expression level value into the diagnostic model provided in this invention, and make a judgment based on the pre-established diagnostic model or threshold.

[0103] The kit, based on highly specific primers and a validated reaction system, enables stable, sensitive, and quantitative detection of trace amounts of hsa_circ_0001185 in human serum. Its standardized operating procedure, combined with the diagnostic model provided by this invention, can be effectively applied to the auxiliary diagnosis, early screening, and risk stratification of gastric cancer, and has significant clinical translational value.

[0104] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A circRNA biomarker for the diagnosis of gastric cancer, characterized in that, The circRNA marker is hsa_circ_0001185, and the nucleotide sequence of hsa_circ_0001185 is shown in SEQ ID NO.

1.

2. A specific primer pair for detecting the circRNA marker of claim 1, characterized in that, The specific primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

3. A kit for detecting the circRNA biomarker of claim 1, characterized in that, The kit includes the specific primer pair as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes primer pairs for amplifying the internal reference gene 18S rRNA.

5. The reagent kit according to claim 4, characterized in that, The primer pair for amplifying the internal reference gene 18S rRNA includes a forward primer with a nucleotide sequence as shown in SEQ ID NO. 4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

5.

6. The use of the specific primer pair as described in claim 2 in the preparation of a kit for detecting gastric cancer and precancerous lesions of the stomach.

7. The use of the specific primer pair as described in claim 2 in the preparation of a product for distinguishing between patients with early-stage gastric cancer and healthy individuals.

Images