Targeted enrichment of sequences of interest in spatial transcriptome cDNA libraries

By using a hybridization capture probe set for targeted enrichment in a spatial transcriptome cDNA library, the problem of the inability to perform targeted sequencing in existing technologies has been solved, achieving efficient target sequence enrichment and sequencing, reducing costs and improving detection sensitivity.

CN122303382APending Publication Date: 2026-06-30BGI RESEARCH HANGZHOU +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BGI RESEARCH HANGZHOU
Filing Date
2024-12-31
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing spatial transcriptomics technologies cannot perform targeted gene sequencing, resulting in low capture efficiency for specific cell types or specific genes, leading to waste of sequencing resources and high costs.

Method used

The target sequence in the spatial transcriptome cDNA library was enriched by using a hybridization capture probe set. The enriched library was obtained by hybridization and extension. The hybridization capture probe set included two or more probes with no overlap on the target sequence. The hybridization region was designed to run from the target nucleic acid sequence to the spatial sequence. The amplification and purification were carried out by magnetic bead purification technology.

Benefits of technology

It achieves efficient enrichment and targeted sequencing of target sequences, improves capture efficiency, reduces sequencing volume, lowers costs, and improves detection sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303382A_ABST
    Figure CN122303382A_ABST
Patent Text Reader

Abstract

This invention provides a method for targeted enrichment of target sequences in a spatial transcriptome cDNA library. The method includes: using a hybridization capture probe set to hybridize and extend a target nucleic acid sequence or its complementary sequence on the target sequence in the spatial transcriptome cDNA library to obtain an extension product; wherein the hybridization capture probe set includes two or more probes, and any two probes in the hybridization capture probe set do not overlap in the hybridization region of the target sequence; the extension direction of any probe in the hybridization capture probe set is from the target nucleic acid sequence or its complementary sequence to the spatial sequence or its complementary sequence; the extension product includes: the spatial sequence or its complementary sequence, and part or all of the target nucleic acid sequence or its complementary sequence; the extension product is isolated to obtain an enriched library. This method solves the problem in existing technologies that only unbiased sequencing can be performed on spatial transcriptome libraries, and targeted sequencing cannot be achieved, making it applicable to the field of spatial transcriptome library enrichment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of spatial transcriptome library enrichment, and more specifically, to a method for targeted enrichment of target sequences in a spatial transcriptome cDNA library. Background Technology

[0002] In recent years, spatial transcriptomics technology has rapidly developed into an important research tool in the life sciences worldwide. It was named "Technology of the Year" by Nature Methods in 2020 and has demonstrated strong research prospects in fields such as brain science, disease research, cell mapping, and plant science. By further revealing spatial dimensional information, it has brought breakthroughs and significant changes to many major life science problems. Spatial transcriptomics is divided into two categories: sequencing-based and image-based. Sequencing-based technologies have gradually become widely used worldwide due to their advantages such as short experimental time, simple procedures, low cost, unbiased RNA capture, large field of view, and ease of implementation. These technologies include Spatialtranscriptomics, Visium, HDST, Slide-seq, Stereo-seq, seqScope, Pixel-seq, and DBiT-seq. Among these, Stereo-seq and seqScope are technologies that can achieve spatial single-cell resolution.

[0003] The general principle of this technology is to seed capture probes onto a planar carrier or chip to form a probe capture region. The capture probes carry a polyT tail and a spatial tag sequence for spatial location identification. Tissue sections are sliced ​​and laid flat on the surface of the capture chip. The slices and chip are stabilized by baking and fixation. A permeation reagent is then added, which permeates the cell membrane, allowing the capture probes on the chip surface to easily bind to intracellular RNA. The target binding site is the complementary interaction of the polyA tail of RNA and the polyT tail of the capture probe. After binding, cDNA is formed in situ through reverse transcription, followed by large-scale amplification via PCR. After screening to remove small fragments, the cDNA is ready for sequencing. Sequencing is standard spatial transcriptome sequencing and can be performed at companies such as MGI or Illumina. Visual analysis of the sequencing results yields a spatial transcriptome map, supporting subsequent personalized biological analyses.

[0004] However, existing spatial transcriptomics technologies, after library construction, can only perform unbiased sequencing and cannot perform targeted gene sequencing. Furthermore, while these spatial transcriptomics technologies employ polyT unbiased capture, resulting in high overall capture efficiency, they also lead to low capture efficiency for specific cell types or genes, hindering effective subsequent analysis. Moreover, when analyzing specific biological problems based on spatial transcriptomics libraries, it is unnecessary to analyze the entire tissue's global data, resulting in a significant waste of the already sequenced spatial transcriptomics data. Summary of the Invention

[0005] The main objective of this invention is to provide a method for targeted enrichment of target sequences in a spatial transcriptome cDNA library, in order to solve the problem that existing technologies can only perform unbiased sequencing on spatial transcriptome libraries and cannot achieve targeted sequencing.

[0006] To achieve the above objectives, according to a first aspect of the present invention, a method for targeted enrichment of a target sequence in a spatial transcriptome cDNA library is provided, wherein the target sequence includes: a spatial sequence or its complementary sequence, and a target nucleic acid sequence or its complementary sequence; the targeted enrichment method includes: hybridizing and extending the target nucleic acid sequence or its complementary sequence on the target sequence in the spatial transcriptome cDNA library using a hybridization capture probe set to obtain an extension product; wherein the hybridization capture probe set includes two or more probes, and the hybridization regions of any two probes in the hybridization capture probe set do not overlap on the target sequence; the extension direction of any probe in the hybridization capture probe set is from the target nucleic acid sequence or its complementary sequence to the spatial sequence or its complementary sequence; the extension product includes: the spatial sequence or its complementary sequence, and part or all of the target nucleic acid sequence or its complementary sequence; the extension product is isolated to obtain an enriched library.

[0007] Furthermore, the hybridization capture probe set includes a DNA probe set and / or an RNA probe set; preferably, the length of any DNA probe in the DNA probe set is 90-120 nt; preferably, the length of any RNA probe in the RNA probe set is 90-120 nt.

[0008] Furthermore, the hybridization start point is the end of the target nucleic acid sequence or its complementary sequence closest to the spatial sequence or its complementary sequence, and the hybridization region of the probe is located within 2700 nt of the end of the target nucleic acid sequence or its complementary sequence closest to the hybridization start point.

[0009] Furthermore, the hybridization capture probe set fully covers the nucleic acid bases of the target nucleic acid sequence, and there is no overlap or gap between the hybridization regions of any two adjacent probes on the target nucleic acid sequence.

[0010] Furthermore, the hybridization capture probes contain a sieve at the 5' end of each probe, and the separation includes: separating the extended product with the element that specifically captures the sieve; preferably, the sieve is biotin, and the element that specifically captures the sieve is streptavidin-modified magnetic beads.

[0011] Further, the targeted enrichment method using an RNA probe set includes: mixing a spatial transcriptome cDNA library with a first prehybridization reagent to perform a first prehybridization to obtain a first prehybridization library; mixing the first prehybridization library with an RNA probe set for hybridization capture to obtain a first extension product; the 5' end of each probe in the RNA probe set is modified with biotin; separation includes: adsorbing the first extension product onto streptavidin-modified magnetic beads and washing; optionally, after separation, the method further includes: performing a first PCR amplification on the first extension product on the magnetic beads, washing and purifying the magnetic beads after the first PCR amplification, recovering the nucleic acid on the magnetic beads, and obtaining a first enriched library.

[0012] Furthermore, the targeted enrichment method using a DNA probe set includes: mixing a spatial transcriptome cDNA library with a second prehybridization reagent to perform a second prehybridization to obtain a second prehybridization library; mixing the second prehybridization library with a DNA probe set for hybridization capture to obtain a second extension product; adsorbing the second extension product using streptavidin-modified magnetic beads and washing the product; optionally, after separation, the method further includes: performing a second PCR amplification on the second extension product on the magnetic beads to obtain a second enriched library.

[0013] Furthermore, in the targeted enrichment method using RNA probe sets, when the length of each probe in the RNA probe set is 90 nt, the mass ratio of cDNA to RNA probe set in the cDNA library is 1:1, and the temperature for hybridization of the first prehybridized library and RNA probe set is 65-75℃, preferably 70℃.

[0014] Furthermore, in the targeted enrichment method using a DNA probe set, the hybridization temperature for mixing the second prehybridized library and the DNA probe set is 65-75℃, preferably 65℃; preferably, when the length of each probe in the DNA probe set is 120nt, the mass ratio of cDNA in the cDNA library to the DNA probe set is 1:2; preferably, the length of each probe in the DNA probe set is 90nt; preferably, when the length of each probe in the DNA probe set is 90nt, the mass ratio of cDNA in the cDNA library to the DNA probe set is 1:0.5; preferably, the DNA probe set is purified by HPLC.

[0015] To achieve the above objectives, according to a second aspect of the present invention, a sequencing method for a spatial transcriptome enriched library is provided, the sequencing method comprising: obtaining an enriched library using a targeted enrichment method for target sequences in the spatial transcriptome cDNA library, and performing high-throughput sequencing on the enriched library.

[0016] By applying the technical solution of this invention, a hybridization capture probe set is used in the targeted enrichment method to hybridize and capture the target sequence in the library, followed by amplification and purification to enrich the target sequence and obtain an enriched library. This enriched library contains a large proportion of the genetic information of the target sequence, while removing non-target sequences from the original spatial transcriptome cDNA library. Further sequencing of this enriched library constitutes targeted sequencing of the target sequence, which can reduce sequencing costs and amplify the signal of the target sequence. Attached Figure Description

[0017] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0018] Figure 1 A schematic diagram of a hybridization capture probe set according to an embodiment of the present invention is shown.

[0019] Figure 2 The experimental results of different RNA probe hybridization temperatures according to Example 3 of the present invention are shown in the figure.

[0020] Figure 3 The experimental results of different RNA probe hybridization temperatures according to Example 3 of the present invention are shown in the figure.

[0021] Figure 4 The figure shows the experimental results comparing different DNA probe lengths according to Example 3 of the present invention.

[0022] Figure 5 The figure shows the experimental results comparing different amounts of DNA probes used in Example 3 of the present invention.

[0023] Figure 6 The figure shows the experimental results comparing different amounts of DNA probes used in Example 3 of the present invention.

[0024] Figure 7 The figure shows the experimental results comparing the hybridization temperatures of different DNA probes in Example 3 of the present invention.

[0025] Figure 8 The figure shows the experimental results comparing the hybridization temperatures of different DNA probes in Example 3 of the present invention. Detailed Implementation

[0026] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0027] As mentioned in the background section, existing spatial transcriptomics technologies, after library construction, can only perform unbiased sequencing and cannot perform targeted gene sequencing. This leads to problems such as low capture efficiency for specific cell types or specific genes and wasted sequencing resources. To achieve in-depth analysis of high expression levels of specific cell types or specific genes, it is often necessary to perform large-scale unbiased sequencing on the entire chip based on existing sequencing results to obtain sufficient targeted gene data for subsequent analysis. This further results in significant data waste and high costs, and the detection sensitivity is insufficient, making it difficult to play a role in practical applications such as clinical trials.

[0028] Therefore, in this application, the inventors attempted to develop a method for targeted enrichment of target sequences in a spatial transcriptome cDNA library, and based on this, proposed a series of protection schemes for this application.

[0029] In a first typical embodiment of this application, a method for targeted enrichment of a target sequence in a spatial transcriptome cDNA library is provided. The target sequence comprises: a spatial sequence or its complementary sequence, and a target nucleic acid sequence or its complementary sequence; the targeted enrichment method comprises: hybridizing and extending the target nucleic acid sequence or its complementary sequence on the target sequence in the spatial transcriptome cDNA library using a hybridization capture probe set to obtain an extension product; wherein the hybridization capture probe set comprises two or more probes, and the hybridization regions of any two probes in the hybridization capture probe set do not overlap on the target sequence; the extension direction of any probe in the hybridization capture probe set is from the target nucleic acid sequence or its complementary sequence to the spatial sequence or its complementary sequence; the extension product comprises: the spatial sequence or its complementary sequence, and part or all of the target nucleic acid sequence or its complementary sequence; the extension product is isolated to obtain an enriched library.

[0030] In the targeted enrichment method of this application, the target nucleic acid sequence represents cDNA, and its complementary sequence represents the complementary sequence of the cDNA. Both sequences contain RNA-related genetic information. The spatial sequence and its complementary sequence also contain spatially related information. In the spatial transcriptome cDNA library prepared using existing methods, there exists a single strand containing RNA-related genetic information and spatially related information, with the RNA-related genetic information located in the 3' direction of the spatially related information (either directly connected or separated by other sequences). This single strand is the target sequence, or the double strand formed by this single strand and its complementary strand is the target sequence.

[0031] When the target sequence is single-stranded, it includes, from the 5' end to the 3' end, a spatial sequence or its complementary sequence, and, the target nucleic acid sequence or its complementary sequence, in sequence. When the target sequence is double-stranded, each probe in the hybridization capture probe set hybridizes with one of the strands, which includes, from the 5' end to the 3' end, a spatial sequence or its complementary sequence, and, the target nucleic acid sequence or its complementary sequence, in sequence.

[0032] The spatial transcriptome cDNA library is a library obtained through existing spatial transcriptome library construction and sequencing methods. Methods for preparing the cDNA library include, but are not limited to: (i) attaching a biological sample to a spatial array, on which spatial probes are immobilized. The spatial probes include: spatial sequences (different sequences correspond to different positions in the spatial array) and capture domains; (ii) attaching the spatial probes to cDNA to obtain a cDNA library carrying spatial information, wherein the cDNA is obtained by reverse transcription of RNA from the biological sample. In the library, the single-stranded DNA containing both spatial and transcriptome information is the strand containing effective information, and the sequence carrying transcriptome information is the target nucleic acid sequence in this application. Commonly used attachment methods in the art include: ligation, and / or extension. For example, using a splint sequence to ligate the spatial probe to cDNA (PCT / CN2022 / 144104), for example, extending the cDNA using the spatial probe as a template, and / or extending the spatial probe using the cDNA as a template. In one embodiment, the biological sample is a tissue slice or a single-cell sample. In one embodiment, reverse transcription is performed before patching; in another embodiment, reverse transcription is performed after patching. Optionally, fixation is included before step (i). Optionally, between step (i) and step (ii), the method further includes any or a combination of the following operations: fixation, decrosslinking, and permeabilization. Optionally, the method further includes: releasing a cDNA library carrying spatial information, which may be done by enzyme digestion, alkaline solution release, or release of the complementary strand by high-temperature annealing after amplification.

[0033] In the above-described targeted enrichment method, a hybridization capture probe set containing two or more probes is used to hybridize and capture and extend the target nucleotide sequence (or its complementary sequence) to obtain an extended product. The extension direction is from the target nucleic acid sequence or its complementary sequence to the spatial sequence or its complementary sequence, thereby obtaining an extended product containing both the target nucleic acid sequence and spatial sequence information. The probes in the hybridization capture probe set do not overlap in their hybridization regions (i.e., binding sites) on the target sequence. The hybridization capture probe set includes, but is not limited to, 2-30 probes, 3-29 probes, 5-25 probes, 10-22 probes, or 14-18 probes.

[0034] In the aforementioned targeted enrichment method, a set of hybridization capture probes capable of binding to target sequences in the library is designed. These probes bind to the target nucleic acid sequences to achieve hybridization capture, obtaining hybridization products. These hybridization products are then amplified and purified to enrich the target sequences, resulting in an enriched library. This targeted enrichment method allows for the enrichment of target sequences after obtaining a spatial transcriptome cDNA library using existing spatial transcriptome construction methods. Subsequent sequencing of the enriched library enables targeted sequencing, improving target sequence capture efficiency and reducing the required sequencing volume. It eliminates the need for sequencing all spatial transcriptome cDNA libraries and then screening the data to obtain target sequence information. Since spatial transcriptome cDNA libraries typically capture far fewer sequences and at much lower efficiency than traditional genomic and single-cell libraries, relying on traditional probe design and quantity for capture fails to achieve the desired "capture everything" effect and significantly improve library enrichment. The aforementioned targeted enrichment method addresses this issue.

[0035] The aforementioned targeted enrichment method can be applied to any sample suitable for spatial transcriptomics experiments, including but not limited to: mammalian / non-mammal whole-body organs, body tissues, plant organs, structures, and mixed states of multiple species, such as mammalian-microbe mixed tissues, mammalian-virus mixed tissues, etc. This targeted enrichment method can be applied to samples that have already undergone spatial transcriptomics experiments, as well as samples that are planned but not yet conducted. Only the presence of cDNA is required for the experiment.

[0036] In a preferred embodiment, after separating the extended product, it is further amplified and purified to obtain an enriched library, thereby increasing the amount of genetic information in the enriched library, which facilitates subsequent sequencing library construction and high-throughput sequencing operations.

[0037] In a preferred embodiment, the hybridization capture probe set includes a DNA probe set and / or an RNA probe set; preferably, the length of any DNA probe in the DNA probe set is 90-120 nt; preferably, the length of any DNA probe in the RNA probe set is 90-120 nt.

[0038] Hybridization capture probe sets include either DNA or RNA probe sets, both of which can achieve binding and capture of target sequences as cDNA. The length of any DNA probe in the DNA probe set is 90-120 nt, preferably 90 nt. The length of any RNA probe in the RNA probe set is preferably 90-120 nt.

[0039] Since spatial transcriptome cDNA libraries contain identical and complementary sequence strands of transcripts, probe design can be based on either the transcript itself or its complementary strand. In this embodiment, the transcript was used as the template.

[0040] In a preferred embodiment, the hybridization start point is the end of the target nucleic acid sequence or its complementary sequence closest to the spatial sequence or its complementary sequence, and the hybridization region of the probe is located within 2700 nt of the target nucleic acid sequence or its complementary sequence closest to the hybridization start point.

[0041] In the above process of selecting target nucleic acid sequences, if the length of the target sequence is >2700nt, the target nucleic acid sequence is a 2700nt fragment located in the target sequence starting from the spatial sequence or its complementary sequence; if the length of the target sequence is ≤2700nt, the target nucleic acid sequence is the entire target sequence.

[0042] In a preferred embodiment, the hybridization capture probe set fully covers the target nucleic acid sequence, and there is no overlap or gap between the hybridization regions of any two adjacent probes in the hybridization capture probe set on the target nucleic acid sequence.

[0043] The design principle of the hybridization capture probe set is to design multiple hybridization capture probes to achieve full base coverage of the target nucleic acid sequence. Preferably, the design of the hybridization capture probes begins with probes that bind to the 3' end of the target nucleic acid sequence. There should be no overlap or gap between the binding sites of each hybridization capture probe on the target nucleic acid sequence. If the 5' end of the target nucleic acid sequence is less than the length required for one hybridization capture probe, the design is stopped. For example, if the target nucleic acid sequence is 1220 bp long and the probe length is designed to be 120 bp, then the number of probe types is 10, and probes are not designed for the remaining 20 bp. The coverage of the hybridization capture probes for the target nucleic acid sequence is 1.

[0044] In principle, once all hybridization capture probes have bound to the target nucleic acid sequence on a single strand of DNA, there are no free, non-complementary nucleic acids among the probes, meaning no overlap occurs. There are also no notches between the probes; multiple probes are spatially connected end-to-end (the probes are not linked by phosphodiester bonds, but are spatially close), meaning no gaps occur. A schematic diagram of a hybridization capture probe is shown below. Figure 1 As shown, Figure 1 The probe was designed using mRNA as a template. The mRNA fragment is SEQ ID NO: 35: ATTACTCTAGGCG (where T represents U).

[0045] The design principle of the hybridization capture probe set, which targets specific regions in traditional experiments, ensures that the bases of the target binding sequence can be covered by the probe sequence one by one, significantly improving the enrichment efficiency of the spatial library and achieving a correspondence of dozens of probes for one RNA sequence.

[0046] Preferably, after the sequential connection design of the hybridization capture probes described above, the annealing temperature is calculated using the following formula:

[0047]

[0048] In the above formulas, ΔH represents the sum of the standard enthalpy changes of all NN neighboring base pairs, ΔS represents the sum of the standard entropy changes of all NN neighboring base pairs, R is the Mohr's constant, and c represents the primer concentration. The minimum folding energy was calculated using the RNAfold program in ViennaRNAPackage 2.0 to determine the DNA and RNA folding free energies. Off-target penalties were calculated by aligning the entire genome with probe Blast (v2.2.26) and calculating the cumulative annealing temperature in the alignment results.

[0049] After calculating the annealing temperature for each probe, probes with annealing temperatures that are too high or too low, making them difficult to achieve in the capture experiment, are screened out to ensure that the capture experiment can proceed normally, thus obtaining a set of hybridization capture probes for practical applications.

[0050] In a preferred embodiment, each probe in the hybridization capture probe set contains a sieve at its 5' end, and the separation comprises separating the extended product using elements that specifically capture the sieve. Optionally, the sieve is biotin, and the elements that specifically capture the sieve are streptavidin-modified magnetic beads.

[0051] To facilitate the subsequent capture and purification of the target sequence, the probes in the hybridization capture probe set are all biotin-modified to bind to streptavidin-modified magnetic beads for separation, thus facilitating subsequent targeted enrichment methods. Those skilled in the art can also flexibly select other magnetic beads from the prior art and modify the probes with corresponding groups capable of binding to these magnetic beads.

[0052] The RNA or DNA probes used in this application can be prepared by any method in the prior art (e.g., solid-phase synthesis) by those skilled in the art.

[0053] In a preferred embodiment, the targeted enrichment method using an RNA probe set includes: mixing a spatial transcriptome cDNA library with a first prehybridization reagent to perform a first prehybridization to obtain a first prehybridized library; mixing the first prehybridized library with an RNA probe set for hybridization capture to obtain a first extension product; the 5' end of each probe in the RNA probe set is modified with biotin; adsorbing the first extension product using streptavidin-modified magnetic beads and washing the beads; optionally, after separation, the method further includes: performing a first PCR amplification on the first extension product on the magnetic beads; washing and purifying the magnetic beads after the first PCR amplification; recovering the nucleic acid on the magnetic beads to obtain a first enriched library.

[0054] If an RNA probe set is used for capture in the above targeted enrichment method, firstly, the spatial transcriptome cDNA library is mixed with a first prehybridization reagent (including but not limited to blocking reagents) for first prehybridization to block non-target sequences in the library, obtaining a first prehybridized library and reducing interference from non-target sequences in subsequent hybridization capture. Secondly, the first prehybridized library is mixed with the RNA probe set for hybridization capture. Then, utilizing the specific binding property of magnetic beads to the probes, the first extension product is specifically adsorbed, obtaining magnetic beads adsorbed with the first extension product. These magnetic beads are then added to a PCR system for first PCR amplification, achieving amplification and enrichment of the target sequence. Further, the magnetic beads after first PCR amplification are washed, and the adsorbed nucleic acids (products of the first PCR amplification) are recovered to obtain the hybridized PCR product. The hybridized PCR product is then fragmented using enzymatic or mechanical methods to obtain fragmented products. Finally, magnetic beads were used to perform dual-selection purification of the fragmented products to remove DNA fragments that were too long or too short, resulting in a first enriched library. At this point, the first enriched library contained target sequences of suitable length, which would facilitate subsequent high-throughput sequencing.

[0055] It should be noted that the terms "first" and "second" in this application are used only to distinguish the operations performed using DNA probe sets and RNA probe sets, and the products obtained. Taking "enriched library" as an example, both "first enriched library" and "second enriched library" are subordinate concepts of "enriched library".

[0056] In this patent application, the terms "first," "second," etc., are used to distinguish and identify different components, parts, steps, or features, and do not imply any importance, priority, or functional order of these components, parts, steps, or features in practical application. These terms are only used to describe and define the various parts involved in the patent in order to clearly convey the structure and method of the invention. In different embodiments, the specific components, parts, steps, or features referred to by these terms may differ, but their function and role in their respective embodiments are consistent. Therefore, unless specifically indicated, these terms do not imply any particular order, importance, or functional priority.

[0057] In a preferred embodiment, the targeted enrichment method using a DNA probe set includes: mixing a spatial transcriptome cDNA library with a second prehybridization reagent to perform a second prehybridization to obtain a second prehybridized library; mixing the second prehybridized library with a DNA probe set for hybridization capture to obtain a second extension product; adsorbing the second extension product using magnetic beads and washing it; optionally, the above method further includes, after separation, performing a second PCR amplification on the second extension product on the magnetic beads to obtain a second enriched library.

[0058] If a DNA probe set is used for capture in the above targeted enrichment method, firstly, the spatial transcriptome cDNA library is mixed with a second prehybridization reagent (including but not limited to blocking reagents) for second prehybridization to block non-target sequences in the library, thus obtaining a second prehybridized library and reducing interference from non-target sequences in subsequent hybridization capture. Secondly, the second prehybridized library is mixed with the DNA probe set for hybridization capture. Then, utilizing the specific binding property of magnetic beads to the probes, the second hybridization product is specifically adsorbed to obtain magnetic beads adsorbed with the second extension product. Further, the magnetic beads adsorbed with the second extension product are washed, and the second extension product is recovered and subjected to a second PCR amplification to obtain a second enriched library.

[0059] In the above-mentioned targeted enrichment method using RNA probe sets or DNA probe sets for capture, those skilled in the art can flexibly select existing RNA probe set or DNA probe set capture methods and reagents to achieve the above operations.

[0060] In a preferred embodiment, in the targeted enrichment method using an RNA probe set, when the length of each RNA probe in the RNA probe set is 90 nt, the mass ratio of cDNA to RNA probe set in the cDNA library is 1:1, and the temperature for hybridization of the first prehybridized library and RNA probe set is 65-75℃, preferably 70℃.

[0061] In the above-mentioned targeted enrichment method, the inventors, through extensive exploration, discovered that the parameters mentioned above can affect the efficiency of hybridization capture using RNA probe sets and the effect of subsequent amplification (increase factor, also known as amplification factor).

[0062] In a preferred embodiment, in the targeted enrichment method using a DNA probe set, the temperature for hybridization of the second prehybridized library and the DNA probe set is 65-75°C, preferably 65°C; preferably, when the length of each probe in the DNA probe set is 120 nt, the mass ratio of cDNA in the cDNA library to the DNA probe set is 1:2; preferably, the length of each probe in the DNA probe set is 90 nt; preferably, when the length of each probe in the DNA probe set is 90 nt, the mass ratio of cDNA in the cDNA library to the DNA probe set is 1:0.5; preferably, the purification method of the DNA probe set includes HPLC purification or PCGE purification, more preferably HPLC purification.

[0063] Similarly, the inventors discovered that the above parameters can affect the efficiency of hybridization capture using DNA probe sets and the effect of subsequent amplification.

[0064] In a second typical embodiment of this application, a sequencing method for a spatial transcriptome-enriched library is provided. This sequencing method includes: obtaining an enriched library using a targeted enrichment method for target sequences in the spatial transcriptome cDNA library, and performing high-throughput sequencing on the enriched library. High-throughput sequencing methods include, but are not limited to: next-generation sequencing, such as bridge sequencing and DNB sequencing; and single-molecule sequencing, such as nanopore sequencing.

[0065] In the above sequencing method, an enriched library is first obtained using the targeted enrichment method, and then high-throughput sequencing is performed on the enriched library to achieve targeted sequencing of target sequences in the spatial transcriptome cDNA library. In this sequencing method, those skilled in the art can flexibly select existing sequencing methods and corresponding sequencing library construction methods to further process the enriched library, such as fragmentation, adapter ligation, and amplification, ultimately achieving high-throughput sequencing.

[0066] DNA probes are compatible with the EzyNGS Hybridization Capture & Elution Buffer Kit, product number: N608370; RNA probes are compatible with the MGIEAsy Kit, catalog number: 940-000186-00(16RXN), kit version: V1.0.

[0067] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0068] Example 1: RNA probe targeted enrichment experimental procedure

[0069] 1. Preparation before hybridization, pre-hybridization

[0070] 1.1 Calculate the volume required for a 500 ng cDNA library.

[0071] 1.2 Transfer 500 ng of cDNA library to a 0.2 mL centrifuge tube.

[0072] 1.3 Prepare a mixture of library and block in the centrifuge tube from the previous step. The system is shown in Table 1.

[0073] Table 1

[0074] Components Volume (μL) cDNA 500ng (XμL) Block1 2.5 Block2 2.5 total 5+X

[0075] 1.4 The library and block mixture was concentrated and dried using a vacuum concentrator at 60°C, and 9 μL of NF-H2O (nuclease-free water) was added.

[0076] 1.5 Place the sample into a PCR instrument and perform pre-hybridization according to the reaction conditions shown in Table 2 below.

[0077] Table 2

[0078] step Temperature (°C) time 1 95 5min 2 70 Keep

[0079] 2. Hybrid capture

[0080] 2.1 Prepare the hybridization buffer reaction system in a new 0.2 mL PCR tube according to Table 3 below:

[0081] Table 3

[0082] Components Volume (μL) Hyb#1 10 Hyb#2 0.4 Hyb#3 4 Hyb#4 5.6 total 20

[0083] 2.2 Place the hybridization solution in a PCR instrument and incubate at 70°C for at least 5 minutes. Observe through a light source to confirm that there is no crystal precipitation in the system before use. Keep it at 70°C until ready for use.

[0084] 2.3 Prepare the probe mixture in a 96-well PCR plate according to Table 4 below (Note: This operation should be performed on ice; the probes should be thawed on ice and added last), and cap with an 8-tube cap:

[0085] Table 4

[0086] reagents Volume (μL) Nuclease-free water 1.5 RNase Block (block 5) 0.5 probe 5 Total volume 7

[0087] 2.4 Place the probe mixture in a PCR instrument and incubate at 70°C for 2 min and maintain.

[0088] 2.5 Keep all reaction systems at 70°C, uncap the sample library tube and hybridization buffer tube, and quickly transfer 13 μL of hybridization buffer into the sample library tube.

[0089] 2.6 Keep all reaction systems at 70°C, transfer all liquid from the sample library tube to the probe mixture in the PCR plate, and mix thoroughly by pipetting.

[0090] 2.7 Quickly seal the PCR plate with a high-transmittance adhesive capping film, press the film tightly to ensure all wells are completely sealed, and repeat this step once (i.e., seal the film twice).

[0091] 2.8 Keep the 96-well PCR plate at 70℃ (heat cycler with the heat cover set to 105℃) for hybridization for more than 24 hours.

[0092] 3. Preparation before washing off

[0093] Note: Before use, ensure that all buffers are free of obvious sediment. If sedimentation occurs, heat in a 70°C water bath for 5 minutes until the sedimentation completely disappears. After thorough shaking and mixing, ensure the liquid is clear and transparent before use.

[0094] 3.1 Preheat the Thermomixer to 70°C at least 30 minutes in advance. Take 1.8 mL of Wash Buffer II into a 2.0 mL centrifuge tube 2 and place it in the Thermomixer to preheat to 70°C.

[0095] 3.2 Resuspend Dynabeads M-280 Streptavidin Beads by vigorous vortex mixing until well mixed, and transfer 50 μL of Dynabeads M-280 Streptavidin Beads to a new 2.0 mL centrifuge tube.

[0096] 3.3 Add 200 μL of binding buffer to the magnetic bead, and vortex mix vigorously for 5 seconds to resuspend the magnetic bead.

[0097] 3.4 Place the centrifuge tube on a magnetic rack for 2 minutes until the liquid is completely clear; carefully aspirate and discard the supernatant.

[0098] 3.5 Repeat the first two steps twice.

[0099] 3.6 Add 200 μL of binding buffer to resuspend the magnetic beads.

[0100] 4. Washing

[0101] 4.1 After 24 hours of incubation, continue to keep the hybridization mixture on the PCR instrument at 60°C. Use a blade to cut open the sealing film. Quickly measure the estimated volume of the remaining hybridization solution using a pipette (Note: If the evaporation volume exceeds 8 μL, the hybridization experiment is considered a failure).

[0102] 4.2 Transfer the entire hybridization mixture directly from the PCR instrument to the prepared magnetic beads, and invert the centrifuge tube 3 to 5 times until well mixed.

[0103] 4.3 Fix the centrifuge tube containing the hybridization mixture and magnetic beads symmetrically on a Nutator or similar device, rotate 360 ​​degrees to mix, and incubate at room temperature for 30 min.

[0104] 4.4 Remove the centrifuge tube from the mixing device and centrifuge briefly to ensure that there is no liquid residue on the tube cap.

[0105] 4.5 Transfer the centrifuge tubes to a magnetic rack and let them stand for 3-5 minutes until the liquid is completely clear. Carefully aspirate and discard the supernatant.

[0106] 4.6 Resuspend the magnetic beads in 500 μL Wash Buffer I, invert the container until the magnetic beads are completely mixed, and incubate the sample at room temperature for 15 min.

[0107] 4.7 Centrifuge the centrifuge tube briefly, then place it on a magnetic rack and let it stand for 3-5 minutes until the liquid is completely clear. Carefully aspirate and discard the supernatant.

[0108] 4.8 Resuspend the magnetic beads in 500 μL of preheated Wash Buffer II and vortex for 5 seconds to mix the sample. Incubate the sample in a Thermomixer at 70 °C for 10 min.

[0109] 4.9 Invert the centrifuge tube to mix the sample, centrifuge briefly for 3 seconds, then place it on a magnetic rack and let it stand for 5 minutes until the liquid is completely clear. Carefully aspirate and discard the supernatant.

[0110] 4.10 Repeat the first two steps twice.

[0111] 4.11 Resuspend the magnetic beads with 42 μL of NF-H2O, and use a pipette to transfer all the resuspended sample (including the magnetic beads) into a new PCR tube.

[0112] 5. Post-hybridization PCR

[0113] 5.1 Prepare PCR Mix in the PCR tube from the previous step. The system is shown in Table 5. Vortex 3 times for 3 seconds each time, and then collect the reaction solution to the bottom of the tube by instant centrifugation.

[0114] Table 5

[0115] reagents Volume (μL) 1X <![CDATA[Previous step: Resuspend magnetic beads with NF-H2O]]> 42 cDNA HIFI Master Mix 50 cDNA Primers 8 total 100

[0116] 5.2 Perform PCR according to the procedure shown in Table 6 below.

[0117] Table 6

[0118] Hot cap temperature reaction volume runtime 105℃ 100μL step temperature time 1 95℃ 5min 2 98℃ 20s 3 58℃ 20s 4 72℃ 3min 5 Return to step 2, 14 loops 6 72℃ 5min 7 12℃ Keep

[0119] 5.3 After the reaction is complete, the reaction solution is collected to the bottom of the tube by instantaneous centrifugation.

[0120] 5.4. Fix the PCR tube on a magnetic rack and let it stand for 2-5 minutes until the liquid is clear. Use a pipette to transfer 100 μL of the supernatant to a new 1.5 mL centrifuge tube.

[0121] 6. Purification of PCR products after hybridization: 0.6x beads

[0122] 6.1 Remove the DNA Clean Beads 30 minutes in advance and place them at room temperature. Shake well before use.

[0123] 6.2 Add 60 μL of DNA Clean Beads to 100 μL of the hybridized PCR product and vortex to mix.

[0124] 6.3 Incubate at room temperature for 10 min.

[0125] 6.4 Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 2-5 minutes until the liquid is clear. Carefully aspirate the supernatant with a pipette and discard it.

[0126] 6.5 Keep the centrifuge tubes on the magnetic rack, add 1 mL of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, let stand for 30 seconds, then carefully aspirate and discard the supernatant.

[0127] 6.6 Repeat the previous step, trying to remove as much liquid as possible from the tube. If a small amount remains on the tube wall, the centrifuge tube can be centrifuged briefly. After separation on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0128] 6.7 Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective and cracked.

[0129] 6.8 Remove the centrifuge tube from the magnetic rack, add 42 μL of NF-H2O to reconstitute, shake to mix, let stand at room temperature for 5 min, centrifuge briefly, let stand on the magnetic rack for 3-5 min, and collect the supernatant after the liquid becomes clear.

[0130] 6.9 Take 1 μL of the sample sieve product and use the Qubit dsDNA HS Assay Kit to detect the concentration. Alternatively, the fragment distribution can be detected using the Agilent 2100 High Sensitivity Chip.

[0131] 6.10QC Standard: The main peak is distributed at around 1500bp.

[0132] 7. Disruption of PCR products after hybridization and subsequent PCR

[0133] Note: Each sample should be broken into 3 parts and combined together; Fragmentation Enzyme must be placed on ice and not shaken, as it is easily deactivated. When diluting, gently pipette to mix.

[0134] 7.1 Prepare to interrupt Mix, the system is shown in Table 7.

[0135] Table 7

[0136] reagents Volume (μL) 5xTAG 4 <![CDATA[10-fold NF-H2O diluted Fragmentation Enzyme]]> 0.5 cDNA products X <![CDATA[NF-H2O]]> 15.5-X total 20

[0137] Note: cDNA product input amount X (μL) = 20 ng / cDNA concentration (ng / μL).

[0138] Prepare to break the mixture according to the above system, centrifuge briefly, and then gently blow to mix. Be careful not to shake violently.

[0139] 7.2 Prepare PCR instruments as shown in Table 8.

[0140] Table 8

[0141]

[0142]

[0143] Start the above reaction program. When the reaction begins at 55°C, place the broken Mix PCR tube into the PCR instrument, close the PCR instrument lid, and start timing for 10 minutes.

[0144] 7.3 Add 5 μL of 5x NT Buffer to each tube, mix well by pipetting, and let stand at room temperature for 5 min to terminate the reaction;

[0145] 7.4 Disruption of product amplification: Prepare PCR amplification Mix, the system is shown in Table 9.

[0146] Table 9

[0147] reagents Volume (μL) The previous step interrupted Mix 25 Library HIFI Master Mix 50 Library PCR primer mix 25 total 100

[0148] 7.5 Shake well, centrifuge briefly, and then place in a PCR instrument to react. Start the reaction program shown in Table 10 below.

[0149] Table 10

[0150] Hot cap temperature reaction volume runtime 105℃ 100μL step temperature time 1 95℃ 5min 2 98℃ 20s 3 58℃ 20s 4 72℃ 30s 5 Return to step 2, 13 loops 6 72℃ 5min 7 12℃ Keep

[0151] 7.6 Take 1 μL of the product and use the Qubit dsDNA HS Assay Kit to detect the concentration, which is usually between 5-30 ng / μL, and record it.

[0152] 8. Interrupt product selection (0.6X + 0.2X)

[0153] 8.1. Mix 100 μL of the above PCR product with VAHTS™ DNA Clean Beads (VAZYME) that has been equilibrated at room temperature at a ratio of 1:0.6, vortex to mix, and incubate at room temperature for 5 min.

[0154] 8.2. After briefly centrifuging the above reaction PCR tubes, place them on a magnetic rack and let them stand for 3 minutes. After the liquid becomes clear, transfer the supernatant to a new PCR tube.

[0155] 8.3. Add 20 μL of Vazyme Beads to the supernatant, mix well by shaking, and incubate at room temperature for 5 min.

[0156] 8.4. Place the centrifuge tube on a magnetic rack for instantaneous centrifugation, let it stand for 3-5 minutes until the liquid is clear, then carefully aspirate and discard the supernatant using a pipette.

[0157] 8.5. Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand for 30 seconds, carefully aspirate and discard the supernatant.

[0158] 8.6. Repeat the previous step to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, centrifuge the tube briefly. After separating the tubes on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0159] 8.7. Allow the magnetic beads to stand at room temperature for 5-8 minutes to dry until the surface of the magnetic beads is no longer reflective and no cracks appear;

[0160] 8.8. Add 20 μL of NF-H2O to dissolve the PCR liquid, vortex to mix, let stand at room temperature for 5 min, centrifuge briefly, and then place on a magnetic rack to stand for 3 min. After the liquid becomes clear, transfer the supernatant to a new PCR tube.

[0161] 8.9. Take 1 μL of the sample sieve product and use the Qubit dsDNA HS Assay Kit to detect the concentration. Alternatively, the fragment distribution can be detected using an Agilent 2100 High Sensitivity Chip.

[0162] QC standard: The yield is greater than 300ng, and the main peak is distributed between 400-600.

[0163] Example 2: DNA probe targeted enrichment experimental procedure:

[0164] Use the EzyNGS Hybridization Capture & Elution Buffer Kit, product number: N608370, package size: 16RXN / 96RXN.

[0165] 1. The kit composition is shown in Table 11.

[0166] Table 11

[0167] Components 16RXN 96RXN Streptavidin Magnetic Beads 0.8mL 4.8mL Beads Wash Buffer 5.5mL 34mL 2X Hybrid Buffer 0.3mL 1.8mL Hybrid Enhancer 0.1mL 0.6mL Wash Buffer 1 4.0mL 24mL Wash Buffer 2 4.8mL 28.8mL Wash Buffer 3 2.8mL 17mL Wash Buffer 4 2.8mL 17mL Human Cot IDNA 85μL 490μL Blocker (optional, must be purchased separately) 32μL 192μL User Manual 1 copy 1 copy

[0168] Note: The volume of each component in the kit should not be less than the volume shown in Table 11 above.

[0169] 2. Storage method and stability

[0170] Streptavidin magnetic beads should be stored at 2–8°C, while the remaining components should be stored at -20°C.

[0171] 3. Self-provided equipment or materials

[0172] Information on equipment and materials is shown in Table 12.

[0173] Table 12

[0174]

[0175]

[0176] illustrate

[0177] a. Other products with similar conditions can be selected from the self-provided materials.

[0178] b. Select the appropriate Blocker based on the actual library type and structure.

[0179] c. Regularly calibrate or ensure that the PCR instrument and metal bath temperature control are normal.

[0180] d. Taking the Illumina library as an example, the universal amplification primers are P5 / P7 primers, and their sequences are as follows:

[0181] P5: TAATGATACGGCGACCACCG (SEQ ID NO: 1),

[0182] P7: CAAGCAGAAGACGGCATACGA (SEQ ID NO: 2).

[0183] 4. Preparations before the experiment

[0184] 1. Streptavidin Beads and DNA Selection Beads should be equilibrated at room temperature for 30 minutes before use.

[0185] 2. Prepare fresh 80% ethanol.

[0186] 3. For the libraries to be hybridized, Sangon Biotech recommends using the dsDNA rapid quantification kit, suitable for Qubit (N608301), for accurate quantification, and using 1% agarose gel or Agilent 2100 for quality control. The total amount of library required for the experiment should be greater than 0.5 μg, and the main peak of the library should be 300-400 bp. Too long or too short a peak will greatly affect the capture efficiency.

[0187] 4. For cf DNA, FFPE, and other sample libraries, it is not recommended to hybridize and capture them together with other types of samples.

[0188] 5. Wear protective clothing and take personal protective measures during the experiment.

[0189] In the 6.96-well plate mode, confirm the sealing effect of the sealing film at each step; otherwise, evaporation will lead to experimental failure.

[0190] 7. To avoid evaporation, use the center hole as much as possible. Sangon Biotech recommends no more than 32 hybridization reactions per experiment.

[0191] 5. Library hybridization

[0192] a) Preheat the vacuum concentrator in advance.

[0193] b) Mix the components shown in Table 13 below into a low-adsorption centrifuge tube, vortex to mix, and then freeze-dry using a concentrator.

[0194] Table 13

[0195] Components Input volume Number of documents General Library 500ng / Document Library 1-8 Human Cot IDNA 5μL Blocker 2μL

[0196] Note: i. To maintain the complexity of the hybridization system and libraries, it is recommended that each library be added at least 500 ng. ii. Because magnetic bead concentration may produce a slight GC bias, it is recommended to use a vacuum concentrator for concentration.

[0197] iii. Note: Assuming 8 libraries are hybridized in a single run, the total amount of libraries input is 4 μg.

[0198] c) Vortex the 2X Hybrid Buffer and Hybrid Enhancer beforehand, centrifuge, and then thaw at 4°C.

[0199] d) Prepare the hybridization reaction solution according to Table 14 below, and add it to the 96-well plate containing the lyophilized library after vortex centrifugation.

[0200] Table 14

[0201] Components Input volume (μL) 2X Hybrid buffer 8.5 Hybrid Enhancer 2.7 probe x Nuclease-free water 5.8-x total 17

[0202] Note: i. The amount of probe needed should be obtained from the manufacturer, or you can figure out the conditions yourself.

[0203] e) After gently vortexing the product from the previous step, incubate it at room temperature for 10 minutes, and then perform hybridization according to the procedure in Table 15 below.

[0204] Table 15

[0205]

[0206]

[0207] Note: The hybridization time should be arranged reasonably according to the experimental requirements.

[0208] 6. Library hybridization and elution

[0209] 1. Pre-package the required reagents as shown in Table 16 below.

[0210] Table 16

[0211] Components Input volume (μL) 1X Wash Buffer 1 250 1X Wash Buffer 2 300 1X Wash Buffer 3 150 1X Wash Buffer 4 150 Beads Wash Buffer 300

[0212] Note: i. Each reaction well should be dispensed with one 110 μL Wash Buffer 1 and two 160 μL Wash Buffer 2.

[0213] ii. The dispensed hot wash buffers (i.e., Wash Buffer 1 100 μL, Wash Buffer 2 320 μL) should be preheated at at least 65°C for 40 min before use, and the remainder should be stored at room temperature for later use.

[0214] iii. In Plate mode, prepare an additional 10% margin.

[0215] 2. Prepare the magnetic bead suspension according to Table 17 below.

[0216] Table 17

[0217] Components Input volume (μL) 2X Hybrid buffer 8.5 Hybrid Enhancer 2.7 Nuclease-free water 5.8 total 17

[0218] 3. Streptokinin cleaning

[0219] 1. Vortex the Streptavidin Beads thoroughly after equilibration at room temperature, and transfer 50 μL to a new 96-well plate.

[0220] 2. Add 100 μL of Bead Wash Buffer to each well, pipette and mix 10 times, centrifuge, and then place on a magnetic rack to discard the supernatant.

[0221] 3. Repeat the above steps twice, for a total of 3 cleanings.

[0222] 4. Add 17 μL of magnetic bead suspension to a 96-well plate containing magnetic beads and incubate at 65°C for 5 min.

[0223] 4. Streptavidin washing and capture

[0224] 1. Add the streptavidin resuspended in the previous step to the hybridization system.

[0225] 2. Place the sample into the PCR instrument according to the procedure in Table 18 below, capture at a volume of 35 μL for 45 min, and vortex once every 8 min.

[0226] Table 18

[0227]

[0228] Note: Set the PCR instrument temperature in advance to prevent the reagent base of the PCR instrument from cooling down to below 65℃.

[0229] 7. Hot washing and desiccation

[0230] 1. Add 100 μL of 65℃ Wash Buffer 1 to the product from the previous step, and quickly and gently blow it for 5 minutes. After a brief separation, quickly place it on a magnetic rack and discard the supernatant after the liquid has clarified.

[0231] 2. Add 150 μL of 65℃ Wash Buffer 2, mix gently, incubate at 65℃ for 5 min, briefly detach and quickly place on a magnetic rack, discard the supernatant after the liquid becomes clear.

[0232] 3. Repeat the above steps once (i.e., wash Wash Buffer 2 twice).

[0233] Note: i. Hot washing is recommended to be performed in a constant temperature metal bath at 65℃. The operation should be gentle and quick to avoid the formation of air bubbles.

[0234] ii. Use the dispensed eluent after preheating at 65°C for at least 40 minutes, and leave the remainder at room temperature for later use.

[0235] 8. Elution at room temperature

[0236] 1. After the product from the above steps is momentarily separated, place it on a magnetic rack. Once the liquid becomes clear, discard the supernatant, add room temperature WashBuffer 1, mix well, and incubate for 2 minutes.

[0237] Mix every 30 seconds during incubation.

[0238] 2. After detaching, place on a magnetic rack. Once the liquid has clarified, discard the supernatant, add room temperature Wash Buffer 3, mix well, and incubate for 2 minutes. During incubation, mix every 30 seconds.

[0239] 3. After detaching, place on a magnetic rack and wait for the liquid to clarify. Discard the supernatant, add room temperature Wash Buffer 4, mix well and incubate for 2 minutes. During incubation, mix once every 30 seconds.

[0240] 4. After detachment, place on a magnetic rack and wait for the liquid to clarify. Discard the supernatant, remove any residue, dry, add 21 μL of nuclease-free water, mix gently, and transfer to a new 96-well plate.

[0241] Note: When eluting at room temperature, use a metal bath to conduct the elution experiment at 25°C.

[0242] 9. PCR amplification

[0243] 1. Take out 2X KAPA HiFi HotStart Ready Mix (recommended) and Primer Mix and let them thaw naturally on ice. After removing them from the ice, place them at 4°C to thaw.

[0244] 2. Prepare the system on ice according to the system shown in Table 19 below.

[0245] Table 19

[0246] Components Input volume (μL) 2X KAPA HiFi HotStart Ready Mix 25 Capture products with magnetic beads 20 Primer Mix 5 total 50

[0247] 3. Heat the lid to 105℃, as shown in Table 20 below.

[0248] Table 20

[0249] temperature time cycle 98℃ 45s 1 98℃ 15s 60℃ 30s See Table 21 below 72℃ 30s 72℃ 5min 1 4℃ Keep

[0250] Note: Select the appropriate number of cycles based on the probe size. If the experiment involves multiple mixed samples, reduce the number of cycles by 1-2 based on the number of cycles in Table 21 below.

[0251] Table 21

[0252] Total probe <0.5Mb 0.5Mb-3 Mb 3Mb-5Mb >5Mb Cycle number 13-15 11-13 10-12 8-11

[0253] 10. Library purification and quantification

[0254] 1. After PCR is completed, transfer the supernatant to a new 96-well plate.

[0255] 2. Add 60 μL of DNA Selection Beads, vortex to mix, and incubate at room temperature for 5-10 min.

[0256] 3. After detaching, place the liquid on a magnetic rack and discard the supernatant after the liquid has clarified.

[0257] 4. Add 150 μL of 80% ethanol along the tube wall (do not disturb the magnetic beads), let stand for 1 min, and discard the supernatant.

[0258] 5. Repeat the above steps once.

[0259] 6. Use a 10μL pipette tip to draw up the residual alcohol and allow it to evaporate at room temperature for 2-5 minutes, ensuring that the ethanol evaporates completely.

[0260] 7. Add 20-22 μL of TE (ddH2O can also be used), mix well, and let stand at room temperature for 5 minutes.

[0261] 8. Transfer the product to a new EP tube for subsequent testing.

[0262] 9. Use Qubit to accurately quantify the library, and use 2100 to detect the main peak of the library for subsequent sequencing.

[0263] Example 3

[0264] I. Determining the Experimental Tissue Samples

[0265] This experiment uses human lymphoma samples as an example. These samples were collected and processed using a spatial transcriptome Stereo-seq experiment at the First Affiliated Hospital of Zhejiang University School of Medicine, and the samples are shown in Table 22. This invention only obtains the cDNA product of this experiment and the preliminary sequencing results. The spatial transcriptome cDNA molecule is double-stranded and, according to the direction of the transcript sequence, includes the following sequences from the 3' end to the 5' end: adapter sequence 1, spatial sequence, capture sequence, target nucleic acid sequence, and adapter sequence 2.

[0266] II. Selecting the gene names and base sequences for targeted enrichment.

[0267] Various immune cells, such as T cells, B cells, and macrophages, are closely related to the pathological process of diseases, especially cancer, and have received widespread attention and research. This invention selects genes primarily associated with immune cells as targeted enrichment objects and detects the expression levels of these genes in Stereo-seq spatial transcriptome data.

[0268] Table 22

[0269] Gene name Pre-enrichment expression levels Gene name Pre-enrichment expression levels CD19 7681 ACTA2 5292 CD79A 15222 TAGLN 12017 CD4 5245 COL1A2 5694 CD3D 19541 COL3A1 6709 IL7R 159 COL1A1 7895 KLRD1 5486 VEGFA 1082 KLRB1 193 TP53 2830 DCN 3234 CD40 4995 KRT10 7887 AKT2 5023 KRAS 5003

[0270] III. Determining the enrichment sequence

[0271] In accordance with the principle, Variant 1 was selected as the template for each gene transcript. The nucleic acid length of each enriched gene was determined by accessing NCBI or other methods. The template information is shown in Table 23. For genes longer than 2700 bp, genes up to 2700 bp were selected starting from the 3' end; for genes shorter than 2700 bp, all genes were selected.

[0272] Table 23

[0273]

[0274]

[0275] The ACTA2 gene is used as an example for demonstration; the selection principles for other genes are the same.

[0276] A. The RNA probe is 90 nt in length. The ACTA2 Variant1 transcript is divided into segments of 90 nt each, starting from the 3' end. The information of the RNA probe corresponding segments is shown in Table 24.

[0277] Table 24

[0278]

[0279]

[0280] The detailed sequence of the RNA probe is shown below:

[0281] The first probe, 0-89 (first base position - last base position, the following description follows the same format):

[0282] SEQ ID NO: 3: CCUUUGGCUUGGCUUGUCAGGGCUUGUCCAGGAGUUCCGCUCCUCUCUCCAACCGGGGUCCCCCUCCAGCGACCCUAAAGCUUCCCAGAC.

[0283] Second probe, 90-179:

[0284] SEQ ID NO: 4: UUCCGCUUCAAUUCCUGUCCGCACCCCACGCCCACCUCAACGUG GAGCGCAGUGGUCUCCGAGGAGCGCCGGAGCUGCCCCGCCUGCCCA.

[0285] Third probe, 180-269:

[0286] SEQ ID NO: 5: GCGGGGUCAGCACUUCGCAUCAAGGCCCAAGAAAGCAAGUCCUCCAGCGUUCUGAGCACCCGGGCCUGAGGGAAGGUCCUAACAGCCCC.

[0287] 4th probe, 270-359:

[0288] SEQ ID NO: 6: CGGGAGCCAGUCUCCAACGCCUCCCGCAGCAGCCCGCCGCUCCC AGGUGCCCGCGUGCGCCGCUGCCGCCGCAAUCCCGCACGCGUCCCG.

[0289] Fifth probe, 360-449:

[0290] SEQ ID NO: 7: CGCCCGCCCCACUUUGCCUAUCCCCGGGACUAAGACGGGAAUCC UGUGAAGCAGCUCCAGCUAUGUGUGAAGAAGAGGACAGCACUGCCU。

[0291] Probe No. 6, 450 - 539:

[0292] SEQ ID NO: 8: UGGUGUGUGACAAUGGCUCUGGGCUCUGUAAGGCCGGCUUUGC UGGGGACGAUGCUCCCAGGGCUGUUUUCCCAUCCAUUGUGGGACGUC。

[0293] Probe No. 7, 540 - 629:

[0294] SEQ ID NO: 9: CCAGACAUCAGGGGGUGAUGGUGGGAAUGGGACAAAAAGACAG CUACGUGGGUGACGAAGCACAGAGCAAAAGAGGAAUCCUGACCCUGA。<00009​​​​​​​​​​​​​​​​​​​​

[0302] SEQ ID NO: 13: GUGUCACCCACAAUGUCCCCAUCUAUGAGGGCUAUGCCUUGCC CCAUGCCAUCAUGCGUCUGGAUCUGGCUGGCCGAGAUCUCACUGACU。

[0303] Probe 12, 990 - 1079:

[0304] SEQ ID NO: 14: ACCUCAUGAAGAUCCUGACUGAGCGUGGCUAUUCCUUCGUUAC UACUGCUGAGCGUGAGAUUGUCCGGGACAUCAAGGAGAAACUGUGUU。

[0305] Probe 13, 1080 - 1169:

[0306] SEQ ID NO: 15: AUGUAGCUCUGGACUUUGAAAAUGAGAUGGCCACUGCCGCAU CCUCAUCCUCCCUUGAGAAGAGUUACGAGUUGCCUGAUGGGCAAGUGA。

[0307] Probe 14, 1170 - 1259:

[0308] SEQ ID NO: 16: UCACCAUCGGAAAUGAACGUUUCCGCUGCCCAGAGACCCUGUU CCAGCCAUCCUUCAUCGGGAUGGAGUCUGCUGGCAUCCAUGAAACCA。

[0309] Probe 15, 1260 - 1349:

[0310] SEQ ID NO: 17: CCUACAACAGCAUCAUGAAGUGUGAUAUUGACAUCAGGAAGG ACCUCUAUGCUAACAAUGUCCUAUCAGGGGGCACCACUAUGUACCCUG。

[0311] Probe 16, 1350 - 1439:

[0312] SEQ ID NO: 18: GCAUUGCCGACCGAAUGCAGAAGGAGAUCACGGCCCUAGCACC CAGCACCAUGAAGAUCAAGAUCAUUGCCCCUCCGGAGCGCAAAUACU。

[0313] 17th probe, 1440-1529:

[0314] SEQ ID NO: 19: CUGUCUGGAUCGGUGGCUCCAUCCUGGCCUCUGUCCACCU CCAGCAGAUGUGGAUCAGCAAACAGGAAUACGAUGAAGCCGGGCCUU.

[0315] 18th probe, 1530-1619:

[0316] SEQ ID NO: 20: CCAUUGUCCACCGCAAAUGCUUCUAAAACACUUUCCUGCUCCU CUCUGUCUAGCACACAACUGUGAAUGUCCUGUGGAAUUAUGCCUU.

[0317] B. The DNA probe is 90 nt in length. The segmentation of the ACTA2 Variant1 transcript is the same as in Table 24 above. The information of the DNA probe fragment is similar to that of SEQ ID NOs:3-20 above. The only difference is that SEQ ID NOs:3-20 is RNA composed of ribonucleotides, while the DNA probe is DNA composed of deoxyribonucleotides (U in SEQ ID NOs:3-20 is replaced with T).

[0318] C. The DNA probe is 120 nt in length. The ACTA2 Variant1 transcript is divided into segments of 120 nt each, starting from the 3' end. The information of the DNA probe corresponding segments is shown in Table 25.

[0319] Table 25

[0320]

[0321]

[0322] The detailed sequence of the DNA probe is shown below: Probe 1, 0-119 (first base position - last base position, the following description follows the same format):

[0323] SEQ ID NO: 21: CCTTTGGCTTGGCTTGTCAGGGCTTGTCCAGGAGTTCCGCTCCTC TCTCCAACCGGGGTCCCCCTCCAGCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCC TTGTCCGCACCCCACG.

[0324] Probe 2, 120 - 239:

[0325] SEQ ID NO: 22: CCCACCTCAACGTGGAGCGCAGTGGTCTCCGAGGAGCGCCGGAG CTGCCCCGCCTGCCCAGCGGGGTCAGCACTTCGCATCAAGGCCCAAGAAAAGCAAGTCC TCCAGCGTTCTGAGCAC。

[0326] Probe 3, 240 - 359:

[0327] SEQ ID NO: 23: CCGGGCCTGAGGGAAGGTCCTAACAGCCCCCGGGAGCCAGTCTC CAACGCCTCCCGCAGCAGCCCGCCGCTCCCAGGTGCCCGCGTGCGCCGCTGCCGCCGCA ATCCCGCACGCGTCCCG。

[0328] Probe 4, 360 - 479:

[0329] SEQ ID NO: 24: CGCCCGCCCCACTTTGCCTATCCCCGGGACTAAGACGGGAATCCT GTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAAT GGCTCTGGGCTCTGTA。

[0330] Probe 5, 480 - 599:

[0331] SEQ ID NO: 25: AGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCAT CCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAG CTACGTGGGTGACGAAG。

[0332] Probe 6, 600 - 719:

[0333] SEQ ID NO: 26: CACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAA CATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAAT GAGCTTCGTGTTGCCC。

[0334] Probe 7, 720 - 839:

[0335] SEQ ID NO: 27: CTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCC AAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATG TATGTGGCTATCCAGG。

[0336] Probe 8, 840 - 959:

[0337] SEQ ID NO: 28: CGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGC TGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCC ATGCCATCATGCGTC。

[0338] Probe 9, 960 - 1079:

[0339] SEQ ID NO: 29: TGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCC TGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCA AGGAGAAACTGTGTT。

[0340] Probe 10, 1080 - 1199:

[0341] SEQ ID NO: 30: ATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCT CATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATG AACGTTTCCGCTGCC。

[0342] Probe 11, 1200 - 1319:

[0343] SEQ ID NO: 31: CAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTG GCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACC TCTATGCTAACAATG.

[0344] 12th probe, 1320-1439:

[0345] SEQ ID NO: 32: TCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAA TGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAGATCATTGCCCCT CCGGAGCGCAAATACT.

[0346] 13th probe, 1440-1559:

[0347] SEQ ID NO: 33: CTGTCTGGATCGGTGGCTCCATCCTGGCCTCTGTCCACCTTCC AGCAGATGTGGATCAGCAAACAGGAATACGATGAAGCCGGGCCTTCCATTGTCCACCGC AAATGCTTCTAAAACA.

[0348] 14th probe, 1560-1679:

[0349] SEQ ID NO: 34: CTTTCCTGCTCCTCTCTGTCTCTAGCACACAACTGTGAATGTCCTG TGGAATTATGCCTTCAGTTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGTTACCT ATGTGTTTTTTAA.

[0350] IV. Probe Design

[0351] Probe quality control conditions include: GC content, annealing temperature, minimum folding energy, and off-target penalty. The annealing temperature is calculated using the Nearest-Neighbor (NN) model, employing entropy (S), enthalpy (H), and free energy parameters. Specifically, the two nearest bases in the oligonucleotide are considered as a unit, and the sum of the standard enthalpy change and entropy change for all units in the oligonucleotide chain is calculated using the following formula:

[0352]

[0353] In the above formulas, ΔH represents the sum of the standard enthalpy changes of all NN neighboring base pairs, ΔS represents the sum of the standard entropy changes of all NN neighboring base pairs, R is the Mohr's constant, and c represents the primer concentration. The minimum folding energy was calculated using the RNAfold program in ViennaRNAPackage 2.0 to determine the DNA and RNA folding free energies. Off-target penalties were calculated by aligning the entire genome with probe Blast (v2.2.26) and calculating the cumulative annealing temperature in the alignment results.

[0354] Using a 90nt RNA probe sequence designed from the ACTA gene as an example, the screening principles are illustrated:

[0355] 1. Remove probes that are not 90nt;

[0356] 2. Remove probes with significantly outlier calculated values ​​from Table 26 below. For example, the accumulative_offtarget_panelty of probe 17 (SEQ ID NO: 19) is significantly higher than the average level of other probes, so probe 17 needs to be removed. Probes 1-16 and 18 are selected as the RNA probe set (SEQ ID Nos: 3-18, 20).

[0357] Remove probes whose parameters are outside the range, including: 1. Tm value range, 60-90; 2. Min_en, -30-0; 3. Fold_tm, 0-60; 4. Dimer-Tm, 0-80; 5. GC_content, 0.2-0.7; 6. Off target number, 0-40; 7. Aver_off target_panelty, 0-15; 8. Accumulative_offtarget_panelty, 0-60; 9. cross_dimer_num, 0-5; 10. aver_dimer_panelty, 0-5; 11. Accumulative_dimer_panelty, 0-10.

[0358] Table 26

[0359]

[0360]

[0361] V. Probe Synthesis

[0362] The probe synthesis protocol includes the synthesis of DNA and RNA probes. DNA probe synthesis utilizes the high-throughput DNA synthesis platform established at the Changdanghu Institute of BGI Genomics, Shenzhen. Probe sequences are synthesized using either the MPS-M200 high-throughput in-house synthesizer or the Dr. Oligo 768XLc (Biolytic, USA). Biotin is added to the 5' end of the oligonucleotides, and the probes are purified and quality controlled using HPLC. RNA probe synthesis utilizes the high-throughput RNA synthesis platform established at the Changdanghu Institute of BGI Genomics, Shenzhen. Probe sequences are synthesized using either the YB-192S (Yibo, China) or DX Oligo (Berlikon, China). Biotin is added to the 5' end of the oligonucleotides, and the probes are purified using HPLC and detected using mass spectrometry.

[0363] VI. Targeted Enrichment Experiment

[0364] 1. RNA probe targeting enrichment experiments were performed using the method described in Example 1.

[0365] a. Preparation before hybridization, pre-hybridization

[0366] a) Calculate the volume required for a 1000ng / 500ng / 250ng cDNA library.

[0367] b) Transfer 1000 ng / 500 ng / 250 ng of cDNA library to a 0.2 mL centrifuge tube.

[0368] c) Prepare a mixture of library and block in the centrifuge tube from the previous step, as shown in Table 27 below.

[0369] Table 27

[0370] Components Volume (μL) cDNA 100 ng (X μL) Block1 2.5 Block2 2.5 total 5+X

[0371] d) Use a vacuum concentrator to concentrate and evaporate the mixture of library and block at 60°C, and add 9 μL of NF-H2O.

[0372] e) Place it in a PCR instrument and perform pre-hybridization according to the reaction conditions shown in Table 28 below.

[0373] Table 28

[0374] step Temperature (°C) time 1 95 5min 2 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃ Keep

[0375] b. Hybrid capture

[0376] a) Prepare the hybridization buffer reaction system in a new 0.2 mL PCR tube according to Table 29 below.

[0377] Table 29

[0378]

[0379]

[0380] b) Place the hybridization solution in a PCR instrument and incubate at 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃ for at least 5 minutes. Observe through a light source to confirm that there is no crystal precipitation in the system before use. Keep it at 70℃ until ready for use.

[0381] Note that the incubation and subsequent reaction temperatures should be consistent with the test temperature.

[0382] c) Prepare the probe mixture in a 96-well PCR plate according to Table 30 below (Note: This operation should be performed on ice, the probe should be thawed on ice and added last), and cover with an 8-tube cap.

[0383] Table 30

[0384] reagents Volume (μL) Nuclease-free water 1.5 RNase Block (block 5) 0.5 Probe 5 Total volume 7

[0385] d) Place the probe mixture in a PCR instrument and incubate at 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃ for 2 min and maintain.

[0386] e) Keep each reaction system at 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃, uncap the sample library tube and hybridization buffer tube, and quickly transfer 13μL of hybridization buffer into the sample library tube.

[0387] f) Keep each reaction system at 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃, transfer all liquid from the sample library tube to the probe mixture in the PCR plate, and mix thoroughly by pipetting.

[0388] g) Quickly seal the PCR plate with a high-transmittance adhesive capping film, press the film tightly to ensure that all wells are completely sealed, and repeat this step once (i.e., seal the film twice).

[0389] h) Maintain the 96-well PCR plate at 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃ (heat cycler cover set to 105℃) for hybridization for more than 24 hours.

[0390] c. Preparation before washing

[0391] Note: Before use, ensure that all buffers are free of obvious sediment. If sedimentation occurs, heat in a 70°C water bath for 5 minutes until the sedimentation completely disappears. After thorough shaking and mixing, ensure the liquid is clear and transparent before use.

[0392] a) Preheat the Thermomixer to 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃ for at least 30 minutes in advance. Take 1.8 mL of Wash Buffer II into a 2.0 mL centrifuge tube 2 and place it in the Thermomixer to preheat to 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃.

[0393] b) Resuspend Dynabeads M-280 Streptavidin Beads by vigorous vortex mixing until well mixed, and transfer 50 μL of Dynabeads M-280 Streptavidin Beads to a new 2.0 mL centrifuge tube.

[0394] c) Add 200 μL of binding buffer to the magnetic bead, and vortex mix the beads vigorously for 5 seconds to resuspend them.

[0395] d) Place the centrifuge tube on a magnetic rack for 2 minutes until the liquid is completely clear; carefully aspirate and discard the supernatant.

[0396] e) Repeat the first two steps twice.

[0397] f) Add 200 μL of binding buffer to resuspend the magnetic beads.

[0398] d. Washing

[0399] a) After 24 hours of incubation, keep the hybridization mixture on the PCR instrument at 60°C. Use a blade to cut open the sealing film. Quickly measure the estimated volume of the remaining hybridization solution using a pipette (Note: If the evaporation volume exceeds 8 μL, the hybridization experiment is considered a failure).

[0400] b) Transfer the entire hybridization mixture directly from the PCR instrument to the prepared magnetic beads, and invert the centrifuge tube 3 to 5 times until well mixed.

[0401] c) Fix centrifuge tubes containing hybridization mixture and magnetic beads symmetrically on a Nutator or similar device, rotate 360 ​​degrees to mix, and incubate at room temperature for 30 min.

[0402] d) Remove the centrifuge tube from the mixing device and centrifuge briefly to ensure that there is no liquid residue on the tube cap.

[0403] e) Transfer the centrifuge tubes to a magnetic rack and let them stand for 3-5 minutes until the liquid is completely clear. Carefully aspirate and discard the supernatant.

[0404] f) Resuspend the magnetic beads in 500 μL Wash Buffer I, invert the container until the magnetic beads are completely mixed, and incubate the sample at room temperature for 15 min.

[0405] g) Centrifuge the centrifuge tube briefly, then place it on a magnetic rack and let it stand for 3-5 minutes until the liquid is completely clear. Carefully aspirate and discard the supernatant.

[0406] h) Resuspend the magnetic beads in 500 μL of preheated Wash Buffer II and vortex for 5 seconds to mix the sample. Incubate the sample in a Thermomixer at 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃ for 10 min.

[0407] i) Invert the centrifuge tube to mix the sample, centrifuge briefly for 3 seconds, then place it on a magnetic rack and let it stand for 5 minutes until the liquid is completely clear. Carefully aspirate and discard the supernatant.

[0408] j) Repeat the first two steps twice.

[0409] k) Resuspend the magnetic beads in 42 μL of NF-H2O, and use a pipette to transfer all the resuspended sample (including the magnetic beads) into a new PCR tube.

[0410] e. Post-hybridization PCR

[0411] a) Prepare the PCR Mix in the PCR tube from the previous step, as shown in Table 31. Vortex 3 times for 3 seconds each time, and then collect the reaction solution to the bottom of the tube by instant centrifugation.

[0412] Table 31

[0413]

[0414]

[0415] b) Perform PCR according to the procedure shown in Table 32 below.

[0416] Table 32

[0417] Hot cap temperature reaction volume runtime 105℃ 100μL step temperature time 1 95℃ 5min 2 98℃ 20s 3 58℃ 20s 4 72℃ 3min 5 Return to step 2, 14 loops 6 72℃ 5min 7 12℃ Keep

[0418] c) After the reaction is complete, the reaction solution is collected to the bottom of the tube by instantaneous centrifugation.

[0419] d) Fix the PCR tube on a magnetic rack and let it stand for 2-5 minutes until the liquid is clear. Use a pipette to transfer 100 μL of the supernatant to a new 1.5 mL centrifuge tube.

[0420] f. Purification of PCR products after hybridization: 0.6x beads

[0421] a) Remove the DNA Clean Beads 30 minutes in advance and place them at room temperature. Shake well before use.

[0422] b) Add 60 μL of DNAClean Beads to 100 μL of the hybridized PCR product and vortex to mix.

[0423] c) Incubate at room temperature for 10 minutes.

[0424] d) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 2-5 minutes until the liquid is clear. Carefully aspirate the supernatant with a pipette and discard it.

[0425] e) Keep the centrifuge tubes on the magnetic rack, add 1 mL of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, let stand for 30 seconds, then carefully aspirate and discard the supernatant.

[0426] f) Repeat the previous step to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, centrifuge the tube briefly. After separating the tubes on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0427] g) Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective and cracked.

[0428] h) Remove the centrifuge tube from the magnetic rack, add 42 μL of NF-H2O to reconstitute, shake to mix, let stand at room temperature for 5 min, centrifuge briefly, let stand on the magnetic rack for 3-5 min, and collect the supernatant after the liquid becomes clear.

[0429] i) Take 1 μL of the sample sieve product and use the Qubit dsDNAHS Assay Kit to detect the concentration. Alternatively, the Agilent 2100 High Sensitivity Chip can be used to detect the fragment distribution.

[0430] j) QC standard: The main peak is distributed at around 1500bp.

[0431] g. Disruption of PCR products after hybridization and re-PCR

[0432] Note: Each sample should be broken into 3 parts and combined together; Fragmentation Enzyme must be placed on ice and not shaken, as it is easily deactivated. When diluting, gently pipette to mix.

[0433] a) Prepare to interrupt Mix, as shown in Table 33.

[0434] Table 33

[0435] reagents Volume (μL) 5xTAG 4 <![CDATA[10-fold NF-H2O diluted Fragmentation Enzyme]]> 0.5 cDNA products X <![CDATA[NF-H2O]]> 15.5-X total 20

[0436] Note: cDNA product input amount X (μL) = 20 ng / cDNA concentration (ng / μL).

[0437] Prepare to break the mixture according to the above system, centrifuge briefly, and then gently blow to mix. Be careful not to shake violently.

[0438] b) Prepare PCR instruments

[0439] Start the reaction program shown in Table 34. When the reaction begins at 55°C, place the broken Mix PCR tube into the PCR instrument, close the PCR instrument lid, and start timing for 10 minutes.

[0440] Table 34

[0441] Hot cap temperature reaction volume runtime 75℃ 20μL 10min step temperature time 1 55℃ 10min 2 12℃ Keep

[0442] c) Add 5 μL of 5x NT Buffer to each tube, mix well by pipetting, and let stand at room temperature for 5 min to terminate the reaction;

[0443] d) Disrupt product amplification: Prepare PCR amplification Mix, the system is shown in Table 35.

[0444] Table 35

[0445] reagents Volume (μL) The previous step interrupted Mix 25 Library HIFI Master Mix 50 Library PCR primer mix 25 total 100

[0446] e) Shake to mix, centrifuge briefly, and then place in a PCR instrument to react. Start the reaction program shown in Table 36 below.

[0447] Table 36

[0448]

[0449]

[0450] f) Take 1 μL of the product and use the Qubit dsDNA HS Assay Kit to detect the concentration, which is usually between 5-30 ng / μL, and record it.

[0451] h. Interrupt product selection (0.6X + 0.2X)

[0452] a) Mix 100 μL of the above PCR product with VAHTS™ DNA Clean Beads (VAZYME) that has been equilibrated at room temperature at a ratio of 1:0.6, vortex to mix, and incubate at room temperature for 5 min.

[0453] b) After briefly centrifuging the above reaction PCR tubes, place them on a magnetic rack and let them stand for 3 minutes. After the liquid becomes clear, transfer the supernatant to a new PCR tube.

[0454] c) Add 20 μL of Vazyme Beads to the supernatant, mix well by shaking, and incubate at room temperature for 5 min.

[0455] d) Centrifuge the centrifuge tube briefly on a magnetic rack and let it stand for 3-5 minutes until the liquid is clear. Then, carefully aspirate and discard the supernatant using a pipette.

[0456] e) Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand for 30 seconds, carefully aspirate and discard the supernatant.

[0457] f) Repeat the previous step to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, centrifuge the tube briefly. After separating the tubes on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.

[0458] g) Let the magnetic beads stand at room temperature for 5-8 minutes to dry until the surface of the magnetic beads is no longer reflective and cracked;

[0459] h) Add 20 μL of NF-H2O to reconstitute the solution, vortex to mix, and let stand at room temperature for 5 min. After a brief centrifugation, place the solution on a magnetic rack and let stand for 3 min. Once the liquid is clear, transfer the supernatant to a new PCR tube.

[0460] i) Take 1 μL of the sample sieve product and use the Qubit dsDNA HS Assay Kit to detect the concentration. Alternatively, the fragment distribution can be detected using the Agilent 2100 High Sensitivity Chip.

[0461] QC standard: The yield is greater than 300ng, and the main peak is distributed between 400-600.

[0462] 2. Perform DNA probe targeting enrichment experiments using the method described in Example 2.

[0463] a. Reagent preparation

[0464] (1) DNA / RNA sequencing kit

[0465] For the DNA probe targeting cDNA experiment, a DNA hybridization kit was used, along with the EzyNGS hybridization capture & elution buffer kit (product number: N608370). Detailed experimental procedures are described below.

[0466] (2) DNA probe purification method test: The probes are divided into two categories, namely DNA probes purified by HPLC or PAGE, and the experimental procedures are the same. The following procedures are used for both.

[0467] (3) DNA probe length sequencing: DNA probes were divided into 120nt and 90nt. The experimental protocol was the same. The following protocol was used for all probes.

[0468] b. Library hybridization

[0469] a) Preheat the vacuum concentrator in advance.

[0470] b) Mix the components shown in Table 37 below into a low-adsorption centrifuge tube, vortex to mix, and then freeze-dry using a concentrator.

[0471] Table 37

[0472] Components Input volume Number of documents General Library 250ng / 500ng / 1000ng document library 1-8 Human Cot IDNA 5μL Blocker 2μL

[0473] c) Vortex the 2X Hybrid Buffer and Hybrid Enhancer beforehand, centrifuge, and then thaw at 4°C.

[0474] d) Prepare the hybridization reaction solution according to Table 38 below, and add it to the 96-well plate containing the lyophilized library after vortex centrifugation.

[0475] Table 38

[0476] Components Input volume (μL) 2X Hybrid buffer 8.5 Hybrid Enhancer 2.7 probe x Nuclease-free water 5.8-x total 17

[0477] Note: i. The amount of probe needed should be obtained from the manufacturer, or you can figure out the conditions yourself.

[0478] e) After gently vortexing the product from the previous step, incubate at room temperature for 10 minutes, and then perform hybridization according to the procedure in Table 39 below. Hybridization temperature tests were conducted at 65℃ / 70℃ / 75℃.

[0479] Table 39

[0480]

[0481] c. Library hybridization and elution

[0482] a) Pre-package the required reagents as shown in Table 40 below.

[0483] Table 40

[0484]

[0485]

[0486] b) Prepare the magnetic bead suspension according to Table 41.

[0487] Table 41

[0488] Components Input volume (μL) 2X Hybrid buffer 8.5 Hybrid Enhancer 2.7 Nuclease-free water 5.8 total 17

[0489] c) Streptavidin cleaning

[0490] 1. Vortex the Streptavidin Beads thoroughly after equilibration at room temperature, and transfer 50 μL to a new 96-well plate.

[0491] 2. Add 100 μL of Bead Wash Buffer to each well, pipette and mix 10 times, centrifuge, and then place on a magnetic rack to discard the supernatant.

[0492] 3. Repeat the above steps twice, for a total of 3 cleanings.

[0493] 4. Add 17 μL of magnetic bead suspension to a 96-well plate containing magnetic beads and incubate at 65°C for 5 min.

[0494] d. Streptavidin washing and capture

[0495] 1. Add the streptavidin resuspended in the previous step to the hybridization system.

[0496] 2. Place the sample into the PCR instrument according to the procedure in Table 42 below, capture it at a volume of 35 μL for 45 min, and vortex it once every 8 min.

[0497] Table 42

[0498]

[0499] Note: Set the PCR instrument temperature in advance to prevent the reagent base of the PCR instrument from cooling down to below 65℃.

[0500] e. Hot washing

[0501] 1. Add 100 μL of 65℃ Wash Buffer 1 to the product from the previous step, and quickly and gently blow it for 5 minutes. After a brief separation, quickly place it on a magnetic rack and discard the supernatant after the liquid has clarified.

[0502] 2. Add 150 μL of 65℃ Wash Buffer 2, mix gently, incubate at 65℃ for 5 min, briefly detach and quickly place on a magnetic rack, discard the supernatant after the liquid becomes clear.

[0503] 3. Repeat the above steps once (i.e., wash Wash Buffer 2 twice).

[0504] Note: i. Hot washing is recommended to be performed in a constant temperature metal bath at 65℃. The operation should be gentle and quick to avoid the formation of air bubbles.

[0505] ii. Use the dispensed eluent after preheating at 65°C for at least 40 minutes, and leave the remainder at room temperature for later use.

[0506] f. Elution at room temperature

[0507] 1. After the product from the above steps is momentarily separated, place it on a magnetic rack. Once the liquid becomes clear, discard the supernatant, add room temperature WashBuffer 1, mix well, and incubate for 2 minutes.

[0508] Mix every 30 seconds during incubation.

[0509] 2. After detaching, place on a magnetic rack. Once the liquid has clarified, discard the supernatant, add room temperature Wash Buffer 3, mix well, and incubate for 2 minutes. During incubation, mix every 30 seconds.

[0510] 3. After detaching, place on a magnetic rack and wait for the liquid to clarify. Discard the supernatant, add room temperature Wash Buffer 4, mix well and incubate for 2 minutes. During incubation, mix once every 30 seconds.

[0511] 4. After detachment, place on a magnetic rack and wait for the liquid to clarify. Discard the supernatant, remove any residue, dry, add 21 μL of nuclease-free water, mix gently, and transfer to a new 96-well plate.

[0512] Note: When eluting at room temperature, use a metal bath to conduct the elution experiment at 25°C.

[0513] g.PCR amplification

[0514] 1. Take out 2X KAPA HiFi HotStart Ready Mix (recommended) and Primer Mix and let them thaw naturally on ice. After removing them from the ice, place them at 4°C to thaw.

[0515] 2. Prepare the system on ice according to the system shown in Table 43 below.

[0516] Table 43

[0517] Components Input volume (μL) 2X KAPA HiFi HotStart Ready Mix 25 Capture products with magnetic beads 20 Primer Mix 5 total 50

[0518] 3. Heat the lid to 105℃, as shown in Table 44 below.

[0519] Table 44

[0520]

[0521] Note: Select the appropriate number of cycles based on the probe size. If the experiment involves multiple mixed samples, reduce the number of cycles by 1-2 based on the number of cycles shown in Table 45 below.

[0522] Table 45

[0523] Total probe <0.5Mb 0.5Mb-3 Mb 3Mb-5Mb >5Mb Cycle number 13-15 11-13 10-12 8-11

[0524] h. Library purification and quantification

[0525] 1. After PCR is completed, transfer the supernatant to a new 96-well plate.

[0526] 2. Add 60 μL of DNA Selection Beads, vortex to mix, and incubate at room temperature for 5-10 min.

[0527] 3. After detaching, place the liquid on a magnetic rack and discard the supernatant after the liquid has clarified.

[0528] 4. Add 150 μL of 80% ethanol along the tube wall (do not disturb the magnetic beads), let stand for 1 min, and discard the supernatant.

[0529] 5. Repeat the above steps once.

[0530] 6. Use a 10μL pipette tip to draw up the residual alcohol and allow it to evaporate at room temperature for 2-5 minutes, ensuring that the ethanol evaporates completely.

[0531] 7. Add 20-22 μL of TE (ddH2O can also be used), mix well, and let stand at room temperature for 5 minutes.

[0532] 8. Transfer the product to a new EP tube for subsequent testing.

[0533] 9. Use Qubit to accurately quantify the library, and use 2100 to detect the main peak of the library for subsequent sequencing.

[0534] VII. Sequencing can be performed according to the spatial transcriptomics standard sequencing library sequencing protocol.

[0535] 8. Data analysis is the same as the standard analysis in spatial transcriptomics.

[0536] IX. Comparison of Results

[0537] Relative fold increase = (Number of target genes after targeting / Number of target genes before targeting) / (Number of non-target genes after targeting / Number of non-target genes before targeting).

[0538] This experiment comprehensively compared the following conditions (testing with combinations of controlled single variables):

[0539] 1. DNA probes / RNA probes

[0540] 2. The amount of RNA probe used is 250 ng / 500 ng.

[0541] 3. Hybridization temperatures for RNA probes: 60℃ / 62℃ / 64℃ / 65℃ / 70℃ / 75℃

[0542] 4. The DNA probe length is 120nt / 90nt.

[0543] 5. Purification methods for DNA probes, HPLC / PAGE.

[0544] 6. DNA probe dosage: 1000ng / 500ng / 250ng

[0545] 7. DNA probe hybridization temperatures: 65℃ / 70℃ / 75℃. Results analysis:

[0546] a. All results are summarized in Table 46.

[0547] Table 46

[0548]

[0549] b. Comparison of single results.

[0550] (1) Comparison of RNA probe hybridization temperatures

[0551] When the probe dosage was 500 ng, the hybridization temperatures were 65℃ / 70℃ / 75℃, with boost factors of 590, 867, and 850 times, respectively. It can be seen that the peak value was reached at 70℃. The experimental results are as follows... Figure 2 As shown.

[0552] When the probe dosage was 250 ng, the hybridization temperatures were 60℃ / 62℃ / 64℃ / 65℃, with hybridization folds of 478, 510, 731, and 612 times, respectively. Under the test conditions, 64℃ achieved the peak hybridization. The experimental results are as follows... Figure 3 As shown.

[0553] (2) Comparison of RNA probe input amounts

[0554] When the hybridization temperature is 65℃, the 612-fold increase in fertilization rate with a 250ng input is slightly higher than the 590-fold increase with a 500ng input. However, in multi-dimensional comparisons, the average fertilization increase with 250ng is 583-fold, which is less than the average fertilization increase with 500ng is 769-fold. Considering the effect of input amount as a single variable is less than that of hybridization temperature.

[0555] (3) Comparison of DNA probe lengths

[0556] In a comparison of DNA probes of 120nt and 90nt,

[0557] A. 500 ng was added, purified by HPLC, and hybridized at 65 °C. The 90 nt enhancement factor was 62 times, which is greater than 16 times that of the 120 nt.

[0558] B. 1000 ng was added, purified by HPLC, and hybridized at 65℃. The 90 nt enhancement factor was 33 times, which is greater than 21 times that of the 120 nt.

[0559] C. 250 ng was added, purified by HPLC, and hybridized at 65℃. The 90 nt enhancement factor was 85 times, which is greater than 78 times that of the 120 nt enhancement factor.

[0560] The test results are as follows Figure 4 As shown in the results, the 90nt DNA probe is more effective than the 120nt probe.

[0561] (4) Comparison of DNA probe input amount

[0562] Keeping other conditions constant, the experimental results were compared with different amounts of probes with lengths of 90nt and 120nt. Figure 5 and Figure 6 As shown.

[0563] For a 90nt DNA probe, a dosage of 250ng is better; for a 120nt DNA probe, a dosage of 1000ng is better. However, since the overall boost factor for the 120nt probe is relatively low, the influence of the dosage as a single variable is not significant enough.

[0564] (5) Comparison of DNA probe hybridization temperatures

[0565] When the DNA probe length is 90 nt, the hybridization temperature at 70℃ increases the fold growth the most, as shown in the experimental results. Figure 7 As shown.

[0566] When the DNA probe length is 120 nt, the hybridization temperature at 70℃ increases the fold growth the most, as shown in the experimental results. Figure 8 As shown.

[0567] (6) Comparison of DNA probe purification methods

[0568] DNA probes purified using HPLC are superior to those purified using PAGE.

[0569] c. Comparison of overall results.

[0570] According to the comparison of results, when using RNA probes for targeted enrichment, a probe length of 90 nt, a probe input of 500 ng (i.e., the input mass of pre-hybridized library and RNA probe is 1:1), and hybridization at 70℃ resulted in the highest fold increase, reaching 867 times.

[0571] When using DNA probes for targeted enrichment, the improvement effect of DNA kits and associated capture methods is generally low. Other preferred conditions include DNA probes prepared by HPLC purification, probe length of 90 nt, probe loading of 500 ng (i.e., the mass ratio of prehybridized library to DNA probe is 1:1), and hybridization at 65°C, which can obtain the highest enhancement factor among DNA probes.

[0572] In summary, compared with the above-mentioned targeted enrichment methods using RNA probes and DNA probes, RNA probes have a higher fold increase and a more stable enrichment effect.

[0573] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects:

[0574] This invention proposes for the first time a targeted enrichment method for target sequences in spatial transcriptome cDNA libraries. This method can cover all sequencing-based spatial transcriptome libraries, regardless of species or experimental time, and can be applied to both completed and uncompleted experiments. By extracting a portion of the cDNA library from spatial transcriptome samples that have already undergone sequencing for targeted gene enrichment, unbiased sequencing and targeted sequencing can be performed simultaneously. This targeted enrichment method can improve the detection sensitivity of target genes in spatial transcriptome technology. For samples with very low initial detection levels, enrichment increases the number of detectable genes, allowing for subsequent analysis. Enrichment of target genes significantly improves their expression levels. Furthermore, it reduces sequencing costs by lowering the overall sequencing volume and consumption while achieving the same number of target genes detected. This further meets the application scenarios of spatial transcriptome technology, including but not limited to clinical examinations, offering advantages such as speed, low consumption, and high sensitivity. It provides technical support for the subsequent application of spatial transcriptome in clinical disease detection, prevention, and precision medicine.

[0575] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for targeted enrichment of target sequences in a spatial transcriptome cDNA library, characterized in that, The target sequence includes: a spatial sequence or its complementary sequence, and a target nucleic acid sequence or its complementary sequence; The targeted enrichment method includes: Hybridization and extension are performed on a target nucleic acid sequence or its complementary sequence in a spatial transcriptome cDNA library using a hybridization capture probe set to obtain an extension product. The hybridization capture probe set includes two or more probes, and the hybridization regions of any two probes in the hybridization capture probe set do not overlap on the target sequence. The extension direction of any probe in the hybridization capture probe set is from the target nucleic acid sequence or its complementary sequence to the spatial sequence or its complementary sequence. The extension product includes: the spatial sequence or its complementary sequence, and part or all of the target nucleic acid sequence or its complementary sequence. The extended product was isolated to obtain an enriched library.

2. The targeted enrichment method according to claim 1, characterized in that, The hybridization capture probe set includes a DNA probe set and / or an RNA probe set; Preferably, the length of any DNA probe in the DNA probe set is 90-120 nt; Preferably, the length of any RNA probe in the RNA probe set is 90-120 nt.

3. The targeted enrichment method according to claim 1, characterized in that, The hybridization start point is the end of the target nucleic acid sequence or its complementary sequence closest to the spatial sequence or its complementary sequence. The hybridization region of the probe is located within 2700 nt of the target nucleic acid sequence or its complementary sequence closest to the hybridization start point.

4. The targeted enrichment method according to claim 1, characterized in that, The hybridization capture probe set fully covers the nucleic acid bases of the target nucleic acid sequence, and there is no overlap or gap between the hybridization regions of any two adjacent probes in the hybridization capture probe set on the target nucleic acid sequence.

5. The targeted enrichment method according to claim 1, characterized in that, The hybridization capture probe set contains a screen at its 5' end, and the separation includes: separating the extended product with an element that specifically captures the screen; Preferably, the sieve is biotin, and the element that specifically captures the sieve is a streptavidin-modified magnetic bead.

6. The targeted enrichment method according to claim 2, characterized in that, The targeted enrichment method using the RNA probe set includes: The spatial transcriptome cDNA library is mixed with a first prehybridization reagent to perform a first prehybridization, thereby obtaining a first prehybridized library; The first prehybridized library is mixed with the RNA probe set for hybridization capture to obtain the first extension product; the 5' end of each probe in the RNA probe set is modified with biotin. The separation includes: adsorbing the first extended product using streptavidin-modified magnetic beads, followed by washing; Optionally, the method further includes, after separation: performing a first PCR amplification on the first extension product on the magnetic beads, washing and purifying the magnetic beads after the first PCR amplification, recovering the nucleic acid on the magnetic beads, and obtaining a first enriched library.

7. The targeted enrichment method according to claim 2, characterized in that, The targeted enrichment method using the DNA probe set includes: The spatial transcriptome cDNA library was mixed with a second prehybridization reagent to perform a second prehybridization, thereby obtaining a second prehybridized library; The second prehybridized library is mixed with the DNA probe set for hybridization capture to obtain the second extension product; The second extended product was adsorbed using streptavidin-modified magnetic beads, followed by washing. Optionally, the method further includes, after the separation, performing a second PCR amplification on the second extension product on the magnetic beads to obtain a second enriched library.

8. The targeted enrichment method according to claim 6, characterized in that, In the targeted enrichment method using the RNA probe set, When the length of each probe in the RNA probe set is 90 nt, the mass ratio of cDNA in the cDNA library to the RNA probe set is 1:1, and the temperature for hybridization of the first prehybridized library and the RNA probe set is 65-75℃, preferably 70℃.

9. The targeted enrichment method according to claim 7, characterized in that, In the targeted enrichment method using the DNA probe set, The temperature for hybridization of the second prehybridized library and the DNA probe set is 65-75°C, preferably 65°C; Preferably, when the length of each probe in the DNA probe set is 120 nt, the mass ratio of cDNA in the cDNA library to the DNA probe set is 1:2; Preferably, the length of each probe in the DNA probe set is 90 nt; Preferably, when the length of each probe in the DNA probe set is 90 nt, the mass ratio of cDNA in the cDNA library to the DNA probe set is 1:0.5; Preferably, the DNA probe set is purified by HPLC.

10. A sequencing method for a spatial transcriptome-enriched library, characterized in that, The sequencing method includes: The enriched library is obtained using the targeted enrichment method for target sequences in the spatial transcriptome cDNA library according to any one of claims 1-9, and the enriched library is subjected to high-throughput sequencing.