Method for immobilizing transaminase by cross-linking-adsorption, immobilized enzyme and application

Abstract

The application discloses a method for immobilizing transaminase by cross-linking-adsorption, and immobilized enzyme and application thereof. The application adopts the adsorption-cross-linking method, and through screening of an immobilization method and optimization of key process parameters of immobilization, the prepared immobilized cell enzyme activity reaches 25.31 U / mg, and the enzyme activity recovery rate reaches 95.88%, which is obviously superior to traditional embedding methods or single adsorption methods, and effectively reduces enzyme activity loss in the immobilization process. The method directly uses whole cells, and does not need an enzyme purification step. Diatomite is widely available and low in price, and the modification and immobilization conditions are mild, the operation is simple, and the method is easy to scale up, so the method has a good industrial application prospect.

Description

(I) Technical Field

[0002] This invention belongs to the field of bioengineering technology, specifically relating to a method for immobilizing transaminase using a cross-linking-adsorption method, the immobilized enzyme, and its applications. (II) Background Technology

[0004] Glufosinate (PPT) is a broad-spectrum, highly effective, non-selective herbicide widely used in agricultural production. Commercially available glufosinate is typically a racemic mixture of its D- and L-isomers; however, only L-glufosinate (L-PPT) exhibits herbicidal activity, while D-glufosinate (D-PPT) is not only ineffective but also difficult to degrade in the environment, leading to resource waste and potential environmental risks. Therefore, developing efficient, economical, and environmentally friendly processes for the synthesis or resolution of racemic PPT is of significant industrial value. Currently, the synthesis of L-PPT mainly relies on chemical and biocatalytic methods, with biocatalysis attracting widespread attention due to its high enantioselectivity, mild reaction conditions, and environmental friendliness. In recent years, a kinetic resolution strategy based on transaminases has enabled the efficient synthesis of optically pure L-PPT by converting D-PPT into the key precursor 2-oxo-4-[(hydroxy)(methyl)phosphono]butyric acid (PPO), demonstrating promising application prospects.

[0005] Transaminases (TAs) are a class of pyridoxal phosphate (PLP)-dependent enzymes that efficiently catalyze the amino transfer reaction between an amino donor and a keto acid, and are widely used in the synthesis of chiral amines and non-natural amino acids. Especially in the kinetic resolution of D,L-PPT, transaminases can selectively catalyze the deamination of D-PPT, converting it to PPO while retaining the active structure of L-PPT, thus achieving highly efficient resolution. Existing research has constructed multi-enzyme cascade systems, such as a recombinant E. coli system co-expressing D-amino acid aminotransferase (YmD-AAT), D-aspartate oxidase (TdDDO), and catalase (GbCAT), which significantly improves the conversion efficiency of D-PPT. However, free transaminases still suffer from poor stability, easy inactivation, and difficulty in recovery and reuse in practical applications, limiting their widespread adoption in continuous industrial production.

[0006] Enzyme immobilization technology is an important means to improve enzyme stability, enable enzyme reuse, and facilitate continuous production. By immobilizing enzymes or enzyme-containing cells on a carrier material, their tolerance to temperature, pH, and operating conditions can be significantly enhanced, and product separation and catalyst recovery can be facilitated. In 2015, Neto used hydrophobic resin Relizyme OD403 to immobilize (R)-selective ω-TA, and after optimizing the immobilization conditions, it still maintained 80% of its activity at a high temperature of 50°C (Neto et al., 2015, Journal of Molecular Catalysis B: Enzymatic). In 2020, Jia used polyvinyl alcohol-coated magnetic Fe3O4 nanoparticles as a carrier, cross-linked with glutaraldehyde, and after immobilization, the thermal stability of transaminase was significantly improved, the immobilized enzyme could be rapidly recovered, and it still maintained 50% of its initial activity after 19 consecutive cycles (Jia et al., 2020, Bioprocess and Biosystems Engineering). In 2024, Koszelewski immobilized ω-TA-117 with trimethoxypropylsilane (TMOPs) and achieved conversions of 44%-64% for a variety of substrates with the addition of Celite 545 (filter aid) and Tween 80 (surfactant), with enantiomeric excess exceeding 99% (Koszelewski et al., 2024, Carbohydrate Research).

[0007] Currently, research on transaminase immobilization largely focuses on the immobilization of single enzymes, which suffers from high costs, complex operations, and limited stability improvements. In particular, research on whole-cell immobilization of multi-enzyme cascade systems remains relatively weak, lacking systematic screening of immobilization methods and process optimization. Therefore, developing an efficient, stable, and reusable immobilization method suitable for multi-enzyme co-expression recombinant bacteria is of great significance for promoting the industrial application of transaminases in the kinetic resolution of D,L-PPT. (III) Summary of the Invention

[0009] The purpose of this invention is to provide a method for immobilizing transaminases using a cross-linking-adsorption method. This method utilizes polyethyleneimine (PEI) flocculation and glutaraldehyde (GA) cross-linking, with modified diatomaceous earth as a carrier. Recombinant *E. coli* cells expressing a transaminase cascade system are firmly loaded onto the surface and pores of the diatomaceous earth to obtain immobilized cells. This method is simple to operate, operates under mild conditions, and produces immobilized cells with high enzyme activity recovery, significantly improved thermal and operational stability, and can be reused multiple times, effectively reducing the cost of biocatalysis. It solves the problems of poor whole-cell stability of free transaminases, difficulty in reusing them, and the large enzyme activity loss or complex operation of traditional immobilization methods.

[0010] The technical solution adopted in this invention is:

[0011] This invention provides a method for immobilizing transaminase using a cross-linking-adsorption method. The method involves adding a cell suspension of recombinant *E. coli* expressing a transaminase cascade system as the active ingredient to polyethyleneimine and flocculating at 20-40°C for 0.5-4 hours; then adding glutaraldehyde as a cross-linking agent and cross-linking at 20-40°C for 0.5-4 hours; finally adding modified diatomaceous earth as a carrier and adsorbing at 20-40°C for 0.5-4 hours, followed by filtration and washing the filter cake to obtain the immobilized enzyme. The modified diatomaceous earth is modified using magnesium chloride aqueous solution and sodium hydroxide aqueous solution. The transaminase cascade system consists of D-amino acid aminotransferase (YmD-AAT), D-aspartate oxidase (TdDDO), and catalase (GbCAT).

[0012] This invention employs an immobilization method involving flocculation, cross-linking, and adsorption. This method enables polyethyleneimine to fully flocculate cells, glutaraldehyde to covalently cross-link and reinforce the cells, and finally, modified diatomaceous earth provides a porous adsorption carrier, forming a stable cell-polyethyleneimine-glutaraldehyde-diatomaceous earth composite structure. This effectively prevents cell leakage while preserving substrate mass transfer channels.

[0013] Preferably, the modified diatomaceous earth is prepared by the following steps: diatomaceous earth is mixed with a 1 M magnesium chloride aqueous solution, mechanically stirred for 10 min, then a 1 M sodium hydroxide aqueous solution is added dropwise, and stirring is continued for 12 h; the mixture is washed with pure water, filtered, the solid is collected, dried in an oven at 70 ℃, and then sealed and stored to obtain modified diatomaceous earth; the volume of the magnesium chloride aqueous solution used is 20 mL / g based on the mass of the diatomaceous earth; the volume of the sodium hydroxide aqueous solution used is 4 mL / g based on the mass of the diatomaceous earth.

[0014] Preferably, in the transaminase cascade system, the amino acid sequence of D-aspartate oxidase (TdDDO) is shown in SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2; the amino acid sequence of catalase (GbCAT) is shown in SEQ ID NO.3, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.4; the amino acid sequence of D-amino acid aminotransferase (YmD-AAT) is shown in SEQ ID NO.5, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.6. The recombinant *E. coli* is *E. coli* BL21(DE3) / pET-28a-TdDDO-GbCAT-YmD-AAT.

[0015] Preferably, the cell suspension is prepared by resuspending wet cells of recombinant Escherichia coli expressing a transaminase cascade system in a buffer solution with a pH of 6.0 to 9.0, and more preferably by PB buffer solution with a pH of 8.0 and a strength of 50 mM.

[0016] Preferably, the wet bacterial cell concentration of the cell suspension is 10-50 g / L.

[0017] Preferably, the concentration of polyethyleneimine added to the cell suspension is 5–15 g / L, more preferably 10 g / L; the concentration of glutaraldehyde added to the cell suspension is 1–10 g / L, more preferably 5 g / L. The concentration of modified diatomaceous earth added to the cell suspension is 25–100 g / L, more preferably 75 g / L.

[0018] Preferably, the temperature is 30℃, the flocculation time is 1 h, the cross-linking time is 2 h, and the adsorption time is 2 h.

[0019] This invention provides an immobilized transaminase prepared by the method described above.

[0020] This invention also provides the application of the above-mentioned immobilized transaminase in the resolution of D,L-glufosinate to prepare L-glufosinate. The method of application is as follows: using the immobilized transaminase as a catalyst, D,L-glufosinate as a substrate, α-ketoglutaric acid and pyridoxal phosphate (PLP) are added, and a buffer solution with pH 6-9 (preferably pH 8.5) is used as the reaction medium to form a reaction system. The reaction is carried out at 25-70℃ (preferably 60℃), selectively converting D-glufosinate to the intermediate PPO while retaining L-glufosinate, achieving efficient kinetic resolution of D,L-glufosinate to obtain L-glufosinate.

[0021] Preferably, in the reaction system, the final concentration of the substrate is 100 mM, the final concentration of α-ketoglutaric acid is 5-20 mM, the final concentration of pyridoxal phosphate is 0.1-5 mM, and the concentration of the catalyst is 10-50 g / L.

[0022] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0023] (1) The present invention adopts the adsorption-crosslinking method. By screening the immobilization method and optimizing the key process parameters of immobilization, the enzyme activity of the immobilized cells reached 25.31 U / mg and the enzyme activity recovery rate was as high as 95.88%, which is significantly better than the traditional embedding method or single adsorption method, and effectively reduces the enzyme activity loss during the immobilization process.

[0024] (2) The thermal stability, pH stability, storage stability and operational stability of the immobilized cells prepared by this invention are significantly improved. The optimal reaction temperature is increased to 60 °C, which is 25 °C higher than that of free cells (35 °C); the optimal reaction pH is 8.5, which is 0.5 units more alkaline than that of free cells (8.0); after incubation at 50 °C and pH 8.5 for 36 h, the residual enzyme activity is still more than 50%, and the half-life is about 42.5 h; after storage at 4 °C for 30 days, it still retains 63% activity; it can be reused more than 15 times, and after 3 cycles, the residual enzyme activity is still 90.91%, and after the 15th cycle, it still retains 61.7% activity, which greatly reduces the cost of catalyst use.

[0025] (3) The method of the present invention directly uses whole cells without the need for enzyme purification steps; diatomaceous earth is widely available and inexpensive, and the modification and immobilization conditions are mild, the operation is simple, and it is easy to scale up, with good prospects for industrial application. (iv) Description of the attached drawings

[0027] Figure 1 A schematic diagram illustrating the kinetic separation of D,L-PPT in a transaminase cascade system.

[0028] Figure 2 These are scanning electron microscope (SEM) images of immobilized cells. a represents modified diatomaceous earth, and b represents immobilized cells.

[0029] Figure 3 This is the Fourier transform infrared (FTIR) spectrum of the immobilized cells.

[0030] Figure 4 The figures show the relative enzyme activity curves of free cells and immobilized cells at different temperatures.

[0031] Figure 5 The relative enzyme activity curves of immobilized cells placed at different temperatures for different times are shown.

[0032] Figure 6 The curves show the relative enzyme activity of free cells and immobilized cells at different pH values.

[0033] Figure 7 The relative enzyme activity curves of immobilized cells at different pH values ​​for different durations are shown.

[0034] Figure 8 Enzyme activity after immobilized cells were stored for different times.

[0035] Figure 9 The relative enzyme activity for multiple cycles of immobilized cell recycling. (V) Detailed Implementation Methods

[0037] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0038] Unless otherwise specified, the methods used in the embodiments of this invention are conventional methods, and the reagents used are all commercially available.

[0039] Example 1: Modification of diatomaceous earth

[0040] 10 g of diatomaceous earth was mixed with 1 M MgCl2 aqueous solution at a solid-liquid ratio of 50 g / L. After mechanical stirring for 10 min, 40 mL of 1 M NaOH aqueous solution was added dropwise, and stirring was continued for 12 h. The mixture was washed with pure water, filtered, and the solid was collected, dried in an oven at 70 ℃, and then sealed and stored to obtain 10.7 g of modified diatomaceous earth.

[0041] Example 2: Construction of recombinant Escherichia coli expressing a transaminase cascade system and preparation of cell suspension

[0042] 1. Construction of recombinant Escherichia coli

[0043] The amino acid sequence of the TdDDO gene (as shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene as shown in SEQ ID NO.2) was provided by Professor Shouji Takahashi of Nagaoka University of Science and Technology. The nucleotide sequence obtained after E. coli codon was synthesized by Qingke Biotechnology Co., Ltd. (Hangzhou). The linearization of the pET-28a (+) plasmid was performed by polymerase chain reaction (PCR), and the pET-28a-rbs0TdDDO plasmid was constructed by one-step cloning. An RBS fragment (tcggctgctgcagccgcaacattgtaagcgcatttaaggaggttttttt) was inserted before the TdDDO gene to construct the plasmid pET-28a(+)-rbs1TdDDO.

[0044] The amplification template for the GbCAT gene (amino acid sequence as shown in SEQ ID NO.3, nucleotide sequence of the encoding gene as shown in SEQ ID NO.4) was the plasmid pET28b-GbCAT, which was constructed and preserved in the laboratory. The plasmid pET-28a-rbs1TdDDO-rbs8GbCAT was constructed by inserting an RBS fragment (gctagaagtagcaaaggaggcgtattatt) before the GbCAT gene using a PCR program.

[0045] The amino acid sequence of Ym D-AAT was obtained from the NCBI database (amino acid sequence as shown in SEQ ID NO.5). After codon optimization using E. coli as the host, the nucleotide sequence was obtained (as shown in SEQ ID NO.6) and the gene was synthesized in vitro. An RBS fragment (accaaccggtttaaggaggtattat) was inserted before the Ym D-AAT gene to construct pET-28a-rbs1TdDDO-rbs8GbCAT-rbs. D The Ym D-AAT plasmid was transformed into the host bacterium E. coli BL21(DE3) to obtain the recombinant bacterium E. coli BL21(DE3) / pET-28a-rbs1TdDDO-rbs8GbCAT-rbs D Ym D-AAT.

[0046] SEQ ID NO.2: Nucleotide sequence of D-aspartate oxidase (TdDDO) 1113bp

[0047]

[0048] SEQ ID NO.4: Nucleotide sequence of catalase (GbCAT) 1467bp

[0049]

[0050] SEQ ID NO.6: Nucleotide sequence of D - amino acid aminotransferase (Ym D - AAT), 852 bp

[0051] atgggctacaccctgtggaacgatcagattgttaaagacgaagaagttaaaatcgacaaagaagaccgtggttatcagtttggcgatggcgtttatgaagttgtgaaagtgtataatggcgaaatgttcaccgttaatgaacatattgatcgtctgtatgcaagtgcagaaaaaattcgtattaccattccgtataccaaagataaatttcatcagctgctgcatgaactggttgaaaaaaatgaactgaataccggtcatatttattttcaggttacccgtggtaccagcccgcgtgcacatcagtttccggaaaataccgttaaaccggttattattggttataccaaagaaaatccgcgtccgctggaaaatctggaaaaaggtgttaaagcaacctttgttgaagatattcgttggctgcgttgtgatattaaaagcctgaatctgctgggtgcagttctggcaaaacaggaagcacatgaaaaaggttgttatgaagcaattctgcatcgtaataataccgttaccgaaggtagcagcagcaatgtttttggtattaaagatggtattctgtatacccatccggcaaataatatgattctgaaaggtattacccgtgatgttgttattgcatgtgcaaatgaaattaatatgccggttaaagaaattccgtttaccacccatgaagcactgaaaatggatgaactgtttgttaccagcaccaccagcgaaattaccccggttattgaaattgatggtaaactgattcgtgatggtaaagttggtgaatggacccgtaaactgcagaaacagtttgaaaccaaaattccgaaaccgctgcatatttaa。

[0052] 2. Preparation of cell suspension

[0053] Step 1 recombinant E. coli BL21(DE3) / pET-28a-rbs1TdDDO-rbs8GbCAT-rbs D Ym D-AAT was inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37 ℃ and 180 rpm for 8–10 h to obtain the seed culture. It was then transferred at a 1% (v / v) inoculation rate to LB liquid medium containing 50 μg / mL kanamycin and cultured at 37 ℃ and 180 rpm until OD (dose expiratory volume). 600 The concentration of the culture medium was 0.6–0.8. IPTG was added to a final concentration of 0.05 mM, and the culture was induced at 28 ℃ and 180 rpm for 12 h. After the culture was completed, the cells were collected by centrifugation at 4 ℃ and 8000 rpm for 10 min. The cells were washed with physiological saline and resuspended in PB buffer (50 mM, pH 8.0) to adjust the wet cell concentration to 50 g / L for later use as a cell suspension.

[0054] Example 3: Enzyme activity detection

[0055] 1. Definition and detection methods of enzyme activity

[0056] Enzyme activity unit (U) is defined as: the amount of enzyme required to convert 1 μmol D-PPT per minute under detection conditions; specific enzyme activity refers to the number of activity units (U / mg) contained in each milligram of protein.

[0057] Enzyme activity assay conditions: The total reaction volume was 10 mL, containing 100 mM D,L-PPT, 20 mM α-ketoglutarate (α-KG), 5 mM pyridoxal phosphate (PLP), 50 mM PB buffer (pH 8.0), and 1 mL of 50 g / L cell suspension (or an equivalent amount of immobilized cells). The system was incubated at 35 °C for 5 min, then reacted at 35 °C for 10 min. The reaction was terminated by adding 5 μL of 6 M HCl.

[0058] Enzyme activity recovery rate is defined as the percentage of enzyme activity in immobilized cells (equivalent to bacterial cells) to that in free cells, with free cell enzyme activity as 100%. The calculation formula is as follows:

[0059] Enzyme activity recovery rate (%) = (Immobilized cell enzyme activity (U / mg) / Free cell enzyme activity of the same bacterial volume (U / mg)) × 100%

[0060] Definition of immobilized cell reaction batch: In a 10 mL reaction system (containing 100 mM D,L-PPT, 20 mM α-KG, 5 mM PLP, 50 mM PB buffer (pH 8.0) and an appropriate amount of immobilized cells), a reaction batch is defined as one with a transformation rate exceeding 80%. After each batch reaction, immobilized cells are collected, washed 3–5 times with deionized water, and then added to the next batch reaction. The final transformation rate is then measured.

[0061] Residual enzyme activity is defined as the percentage of enzyme activity in subsequent batches relative to 100% of the enzyme activity in the first batch of immobilized cells (the following experiments assume the third batch). The calculation formula is as follows:

[0062] Residual enzyme activity (%) = (Enzyme activity of the third batch (U / mg) / Enzyme activity of the first batch (U / mg)) × 100%

[0063] 2. Detection method for substrate D,L-PPT

[0064] The concentrations and enantiomeric excess (ee) of substrates D and L-PPT were determined using a pre-column derivatization chiral assay. D-PPT and L-PPT are amino acids containing phosphonoacyl side chains; their amino groups react with chiral derivatization reagents to form isoindole. ex =340 nm, λ em It exhibits a high fluorescence response at 450 nm.

[0065] The derivatization reagent consisted of 0.10 g phthalic acid and 0.12 g N-acetyl-L-cysteine, which were dissolved in 10 mL of ethanol by sonication and then brought to a final volume of 50 mL with 100 mM Na2B4O7-NaOH buffer at pH 9.8.

[0066] Derivatization reaction: In step 1, the reaction solution sample was diluted to the range of the standard curve. 200 μL of the diluted reaction solution was taken, and 400 μL of derivatization reagent was added. The mixture was reacted at 30 ℃ and 600 rpm for 5 min. 400 μL of ddH2O was added to make up to 1 mL. The mixture was then filtered through a 0.22 μm microfiltration membrane and detected by HPLC.

[0067] HPLC analysis was performed on an Ultimate 3000 system equipped with a fluorescence detector (UltiMate FLD-3100) and a C18 column (Welchrom® C18, 4.6 mm × 250 mm, 5 μm). The mobile phase was methanol:50 mM ammonium acetate aqueous solution (pH 5.7), v / v ratio 10:9; flow rate 1 mL / min; column temperature 35 ℃; and detection wavelength λ. ex =340 nm, λ em=450 nm, running time 20 min. The retention times of L-PPT and D-PPT were 10.6 min and 12.6 min, respectively.

[0068] Example 4: Optimization of transaminase immobilization conditions

[0069] 1. Screening of immobilization methods

[0070] (1) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, mix it with 15 mL of 20 g / L sodium alginate aqueous solution, and drip it into 50 mL of 20 g / L CaCl2 aqueous solution using a peristaltic pump. Harden at 4 °C for 10 h.

[0071] (2) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, mix it with 15 mL of 40 g / L agar aqueous solution, pour it into a sterile culture dish to solidify, and cut it into 3 mm × 3 mm × 3 mm small cubes.

[0072] (3) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, mix it with 15 mL of 100 g / L gelatin aqueous solution, pour it into a sterile culture dish, and cut it into 3 mm × 3 mm × 3 mm small cubes after cooling.

[0073] (4) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, mix it with 15 mL of aqueous solution containing 20 g / L sodium alginate and 100 g / L polyvinyl alcohol, and drip it into 50 mL of saturated boric acid aqueous solution containing 20 g / L CaCl2 using a peristaltic pump. Harden at 4°C for 10 h.

[0074] (5) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, mix it with 15 mL of 60 g / L sodium alginate solution, and drip it into 50 mL of 20 g / L CaCl2 aqueous solution using a peristaltic pump. After hardening at 4°C for 15 min, place the resulting particles in 9 g / L chitosan aqueous solution for crosslinking for 20 min.

[0075] (6) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, mix it with 1 g of the modified diatomaceous earth prepared by the method in Example 1 for 30 min, then add polyethyleneimine (PEI) with a final concentration of 2 g / L to flocculate for 30 min, and finally add glutaraldehyde (GA) with a final concentration of 4 g / L to covalently crosslink for 30 min.

[0076] (7) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, add 0.3 mL of 100 g / L PEI aqueous solution, and then add 0.1 mL of 250 g / L GA aqueous solution. Crosslink at 20 °C for 2 h.

[0077] (8) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, add 6.5 g / L PEI aqueous solution, stir evenly and crosslink for 30 min, then add 6.5 g / L GA aqueous solution, stir evenly and crosslink for 30 min, and finally add 0.5 g of the modified diatomaceous earth prepared in Example 1 and adsorb at 30℃ for 1 h.

[0078] The immobilized enzymes prepared in steps (1)-(8) above were subjected to enzyme activity recovery rate and residual enzyme activity after three cycles, respectively, using the method described in Example 3. The results are shown in Table 1. The immobilization method selected was polyethyleneimine-glutaraldehyde-modified diatomaceous earth.

[0079] Table 1: Enzyme activity of transaminases immobilized by different immobilization methods

[0080]

[0081] 2. Optimization of polyethyleneimine concentration

[0082] (1) Take 10 mL of the 50 g / L cell suspension prepared according to Example 2, add polyethyleneimine to make the final concentrations 5, 7.5, 10, 12.5 and 15 g / L respectively, stir evenly and flocculate at 30 ℃ for 0.5 h; (2) Add glutaraldehyde to make the final concentration 6.5 g / L, crosslink at 30 ℃ for 0.5 h; (3) Finally add 0.5 g of modified diatomaceous earth prepared by the method of Example 1, and adsorb at 30 ℃ for 1 h. Filter, take the filtrate and determine the enzyme activity recovery rate and residual enzyme activity after three cycles using the method of Example 3. The results are shown in Table 2. The preferred range of polyethyleneimine concentration is 5-15 g / L, and more preferably 10 g / L.

[0083] Table 2: Enzyme activity of transaminases immobilized at different polyethyleneimine concentrations

[0084]

[0085] 3. Optimization of polyvinylimide flocculation time

[0086] The concentration of polyethyleneimine in step 1 was fixed at 10 g / L, and the flocculation time in step (1) was set to 0.5 h, 1 h, 2 h, and 3 h, respectively, with the other conditions remaining the same. The results are shown in Table 3. The preferred range of polyethyleneimine flocculation time is 0.5 to 3 h, and more preferably 1 h.

[0087] Table 3: Enzyme activity of transaminases immobilized at different polyethyleneimine flocculation times

[0088]

[0089] 4. Optimization of glutaraldehyde concentration

[0090] In step 1, the concentration of polyethyleneimine was fixed at 10 g / L, and the final concentrations of glutaraldehyde were set to 1, 2.5, 5, 7.5, and 10 g / L, with all other conditions remaining the same. The results are shown in Table 4. The preferred range for the glutaraldehyde concentration is 1–10 g / L, and more preferably 5 g / L.

[0091] Table 4: Enzyme activity of transaminases immobilized with different glutaraldehyde concentrations

[0092]

[0093] 5. Optimization of glutaraldehyde crosslinking time

[0094] The concentration of polyethyleneimine in step 1 was fixed at 10 g / L, and the glutaraldehyde crosslinking time was set to 0.5 h, 1 h, 2 h, and 3 h, respectively. All other conditions remained the same. The results are shown in Table 5. The preferred range for the glutaraldehyde crosslinking time is 0.5–3 h, more preferably 2 h.

[0095] Table 5: Enzyme activity of transaminases immobilized at different glutaraldehyde cross-linking times

[0096]

[0097] 6. Optimization of the amount of modified diatomaceous earth added

[0098] The concentration of polyethyleneimine in step 1 was fixed at 10 g / L. The amount of modified diatomaceous earth added was set to 0.10 g, 0.25 g, 0.50 g, 0.75 g, and 1.00 g, with all other conditions remaining the same. The results are shown in Table 6. The preferred range for the amount of modified diatomaceous earth added is 0.25–1.00 g / 10 mL of bacterial solution, and more preferably 0.75 g / 10 mL of bacterial solution.

[0099] Table 6: Enzyme activity of immobilized transaminases with different amounts of diatomaceous earth

[0100]

[0101] 7. Optimization of adsorption time of modified diatomaceous earth

[0102] The concentration of polyethyleneimine in step 1 was fixed at 10 g / L, and the adsorption time of modified diatomaceous earth was 0.5 h, 1 h, 2 h, 3 h, and 4 h, with all other conditions remaining the same. The results are shown in Table 7. The preferred range of adsorption time is 0.5–4 h, and more preferably 2 h.

[0103] Table 7: Enzyme activity of transaminases immobilized at different diatomaceous earth adsorption times

[0104]

[0105] 8. Optimization of immobilization temperature

[0106] The concentration of polyethyleneimine in step 1 was fixed at 10 g / L, and the immobilization temperatures were set at 20 ℃, 25 ℃, 30 ℃, 35 ℃, and 40 ℃, with all other conditions remaining the same. The results are shown in Table 8. The preferred range of immobilization temperature is 20–40 ℃, and more preferably 30 ℃.

[0107] Table 8: Enzyme activity of transaminases immobilized at different immobilization temperatures

[0108]

[0109] 9. Optimization of immobilized pH

[0110] The concentration of polyethyleneimine in step 1 was fixed at 10 g / L. The pH values ​​for preparing the cell suspensions were set to 6.0, 6.5, 7.0, 7.5, 8.0 (PB buffer) and 8.0, 8.5, 9.0 (Tris-HCl buffer), with all other conditions remaining the same. The results are shown in Table 9. The preferred range for immobilization pH is 6.0–9.0, and more preferably 8.0 (using 50 mM PB buffer).

[0111] Table 9: Enzyme activities of transaminases immobilized at different immobilization pH

[0112]

[0113] Example 5: Preparation of immobilized cells under optimal conditions

[0114] Take 10 mL of the cell suspension (10 g / L) prepared according to the method in Example 2, add polyethyleneimine to make a final concentration of 10 g / L, stir evenly, and flocculate at 30 °C for 1 h; then add glutaraldehyde to make a final concentration of 5 g / L, stir evenly, and crosslink at 30 °C for 2 h; finally add 0.75 g of modified diatomaceous earth prepared according to the method in Example 1, and adsorb at 30 °C for 2 h. After adsorption, filter using a Buchner funnel and wash 3-4 times with PB buffer (50 mM, pH 8.0) to obtain immobilized cells. The enzyme activity of the immobilized cells was determined to be 25.31 U / mg, the enzyme activity recovery rate was 95.88%, and the residual enzyme activity after three cycles was 90.91%.

[0115] Example 6: Characterization of immobilized cells

[0116] 1. Characterization by scanning electron microscopy (SEM)

[0117] Example 5: Immobilized cells were prepared, dried at 70°C, and then sputter-coated with gold. Their microstructure was observed using a scanning electron microscope, with unimmobilized modified diatomaceous earth as a control. Results are shown below. Figure 2In sample a, the modified diatomaceous earth without fixed cells has a smooth surface and regularly distributed pores; in sample b, the immobilized cells are aggregated and firmly loaded on the surface and pores of the diatomaceous earth, with a network structure covering the cell surface. This indicates that through PEI functionalization and GA crosslinking, the cells and the carrier form a tight bond, proving that the cells were successfully immobilized on the modified diatomaceous earth.

[0118] 2. Fourier Transform Infrared Spectroscopy (FTIR) Characterization

[0119] Cell suspensions prepared according to the method in Example 2 were used as free cells, modified diatomaceous earth (DE) prepared according to the method in Example 1, and immobilized cells prepared according to Example 5, respectively. Infrared spectroscopy measurements were performed using the KBr pellet method. Results are shown below. Figure 3 The immobilized cells exhibited infrared absorption characteristics of both free cells (such as amide I and II bands, which are characteristic peaks of proteins) and diatomaceous earth (such as Si-O-Si characteristic peaks), and also showed an enhanced peak of C=N stretching vibration, indicating that PEI and GA underwent a cross-linking reaction. The immobilization process did not damage the main chemical structure of the cells, and the carrier skeleton remained intact.

[0120] Example 7: Screening for optimal reaction conditions for immobilized cells

[0121] 1. Determination of optimal reaction temperature

[0122] The final concentration composition of the reaction system was as follows: 0.1 g of immobilized cells prepared according to the method in Example 5, 100 mM D,L-glufosinate, 5 mM α-ketoglutarate, and 0.1 mM PLP dissolved in 50 mM PB buffer at pH 8.0 to form a 10 mL reaction system. The system was reacted at 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, and 70 ℃ for 10 min, respectively. Enzyme activity was determined using the method in Example 3. Under the same conditions, 1 mL of 10 g / L cell suspension prepared according to the method in Example 2 was used instead of the immobilized cells, and all other operations were the same. The relative enzyme activity at each temperature was calculated with the highest enzyme activity as 100%. The results are shown below. Figure 4 The optimal reaction temperature for immobilized cells is 60 °C, while the optimal reaction temperature for free cells is 35 °C.

[0123] 2. Temperature stability measurement

[0124] The immobilized cells from step 1 were immersed in 50 mM PB buffer (pH 8.0) and incubated at 50 °C, 60 °C, and 70 °C for 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, 24 h, and 36 h, respectively. After incubation, the reaction system from step 1 was used, and the reaction was carried out at 35 °C for 10 min. Residual enzyme activity was measured according to the method in Example 3. The results are shown below. Figure 5After incubation at 50 °C for 36 h, the residual enzyme activity of the immobilized cells still exceeded 50%, with a half-life of approximately 42.7 h; the half-life was approximately 7 h at 60 °C; and the half-life was approximately 6 h at 70 °C.

[0125] 3. Determination of optimal reaction pH

[0126] The buffer solution in the reaction system of step 1 was replaced with buffer solutions of different pH values ​​(PB buffer for pH 6.0–8.0, and Tris-HCl buffer for pH 8.0–9.0), while maintaining other components. The reaction was carried out at the optimal temperature (60 °C) for 10 min, and enzyme activity was determined using the method of Example 3. The relative enzyme activity at each pH was calculated with the highest enzyme activity defined as 100%. Results are shown below. Figure 6 The optimal reaction pH for immobilized cells is 8.5, while the optimal reaction pH for free cells is 8.0.

[0127] 4. pH stability measurement

[0128] The immobilized cells from step 1 were placed in buffer solutions at pH 8.0, 8.5, and 9.0, respectively, and incubated at 50 °C for 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, 24 h, and 36 h. After incubation, the reaction was carried out according to the reaction system of step 1 at 60 °C for 10 min, and the residual enzyme activity was determined using the method of Example 3. The results are shown below. Figure 7 At pH 8.5 and 60 °C, the immobilized cells had a half-life of approximately 42.5 h; at pH 8.0, the half-life was approximately 3.8 h; and at pH 9.0, the half-life was approximately 5.2 h.

[0129] 5. Storage stability test

[0130] The immobilized cells from step 1 were immersed in PB buffer (50 mM, pH 8.0) and stored at 4 °C for 0, 5, 10, 15, 20, 25, and 30 days, respectively. After storage, the reaction system from step 1 was followed, and the reaction was carried out at 60 °C for 10 min. The enzyme activity recovery rate was determined using the method described in Example 3. The results are shown below. Figure 8 After 30 days of storage, the enzyme activity recovery rate of immobilized cells still reached 63%, and the storage half-life exceeded 30 days.

[0131] 6. Operational stability test

[0132] The reaction system consisted of 0.1 g of immobilized cells prepared according to the method in Example 5, 10 mL of a 10 mM buffer of 100 mM D,L-glufosinate, 20 mM α-ketoglutarate, 5 mM PLP, and 50 mM Tris-HCl (pH 8.5), and was reacted at 60 °C. A batch was defined as having a conversion rate exceeding 80%. After each batch, the immobilized cells were collected, washed 3–5 times with deionized water, and then added to the next batch. The conversion rate and relative activity of each batch were determined using the method in Example 3. Results are shown below. Figure 9 Immobilized cells can be reused at least 15 batches, and the relative activity is still 61.7% after the 15th batch, with an operating half-life of more than 15 times.

Claims

1. A method for the immobilization of transaminase by cross-linking-adsorption method, characterized in that, The method involves adding a cell suspension of recombinant *E. coli* expressing a transaminase cascade system as the active ingredient to polyethyleneimine, and flocculating at 20-40°C for 0.5-4 hours; then adding glutaraldehyde as a cross-linking agent, and cross-linking at 20-40°C for 0.5-4 hours; finally adding modified diatomaceous earth as a carrier, and adsorbing at 20-40°C for 0.5-4 hours, followed by filtration, and washing the filter cake to obtain the immobilized enzyme; the modified diatomaceous earth is modified using magnesium chloride aqueous solution and sodium hydroxide aqueous solution; the transaminase cascade system consists of D-amino acid aminotransferase, D-aspartate oxidase, and catalase.

2. The method of claim 1, wherein, The modified diatomaceous earth was prepared by the following steps: diatomaceous earth was mixed with a 1M magnesium chloride aqueous solution, mechanically stirred for 10 min, then a 1M sodium hydroxide aqueous solution was added dropwise, and stirring was continued for 12 h; the mixture was washed with pure water, filtered, the solid was collected, dried in an oven at 70 ℃, and then sealed and stored to obtain the modified diatomaceous earth; The volume of the magnesium chloride aqueous solution used is 20 mL / g based on the mass of diatomaceous earth. The volume of sodium hydroxide aqueous solution used is 4 mL / g based on the mass of diatomaceous earth.

3. The method of claim 1, wherein, The nucleotide sequence of the D-aspartate oxidase TdDDO encoding gene in the transaminase cascade system is shown in SEQ ID NO.2; the nucleotide sequence of the catalase GbCAT encoding gene is shown in SEQ ID NO.4; and the nucleotide sequence of the D-amino acid aminotransferase YmD-AAT encoding gene is shown in SEQ ID NO.

6.

4. The method of claim 1, wherein, The cell suspension is prepared by resuspending the wet cells of recombinant Escherichia coli expressing a transaminase cascade system in a buffer solution with a pH of 6.0–9.0, and the wet cell concentration of the cell suspension is 10–50 g / L.

5. The method of claim 1, wherein, The concentration of polyethyleneimine added to the cell suspension is 5–15 g / L; the concentration of glutaraldehyde added to the cell suspension is 1–10 g / L; and the concentration of modified diatomaceous earth added to the cell suspension is 25–100 g / L.

6. The method of claim 1, wherein, The temperature was 30℃, the flocculation time was 1 h, the cross-linking time was 2 h, and the adsorption time was 2 h.

7. An immobilized transaminase prepared by the method of claim 1.

8. The use of the immobilized transaminase of claim 7 in the preparation of L-glufosinate from D,L-glufosinate.

9. Use according to claim 8, wherein the compound is ###0002### The method of application is as follows: using the immobilized transaminase as a catalyst, D,L-glufosinate as a substrate, α-ketoglutarate and pyridoxal phosphate are added, and a reaction system is constructed using a buffer solution of pH 6-9 as a reaction medium. The reaction is carried out at 25-70℃ to obtain L-glufosinate.

10. Use according to claim 9, wherein In the reaction system, the final concentration of the substrate is 100 mM, the final concentration of α-ketoglutaric acid is 5-20 mM, the final concentration of pyridoxal phosphate is 0.1-5 mM, and the concentration of the catalyst is 10-50 g / L.

Images