An isolated nucleic acid molecule encoding a Sapindus mume SmHD-ZIP34 protein and application thereof

Abstract

This invention belongs to the field of plant genetic engineering, specifically relating to an isolated nucleic acid molecule encoding the Sapindus mukorossi SmHD-ZIP34 protein and its application. The isolated nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO.1, or encodes an amino acid sequence as shown in SEQ ID NO.2. This invention reveals for the first time the dual function of this isolated nucleic acid molecule in simultaneously regulating flowering time and sex differentiation in plants. Experiments have shown that overexpression of this nucleic acid molecule in Arabidopsis thaliana significantly promotes flowering and pistil elongation, and inhibits stamen development by downregulating the core pathway of stamen development, leading to a reduction in the number of stamens and pollen abortion. The nucleic acid molecule resource provided by this invention offers an effective solution to the problems of long breeding cycles and low fruit set rates due to male flower dominance in economic forest trees such as Sapindus mukorossi, and can be used to cultivate high-yielding new germplasm with early flowering, fewer males, and more females.

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and molecular biology, specifically relating to a nucleic acid molecule (SmHD-ZIP34) encoding HD-ZIP34 protein isolated from Sapindus mukorossi Gaertn., the protein encoded by this nucleic acid molecule, primer pairs for cloning and detecting this nucleic acid molecule, a recombinant expression vector containing this nucleic acid molecule, a host cell, and the use of this nucleic acid molecule in regulating plant flowering time and sex differentiation. Background Technology

[0002] Soapberry (Sapindus mukorossi Gaertn.), also known as soap tree or soapberry, is a deciduous tree belonging to the Sapindaceae family and the Sapindus genus. It is a multi-functional economic forest species integrating daily chemical production, biomass energy, and landscaping. However, the following technical challenges have long existed in the breeding and production of soapberry: (1) The juvenile period is relatively long. It usually takes 5-8 years from sowing to the first flowering and fruiting, which seriously restricts the rapid realization of breeding efficiency and economic benefits; (2) There is a typical male flower dominance phenomenon, that is, the plant produces a large number of male flowers but the number of female flowers is relatively small, resulting in a low overall fruit setting rate; (3) The pollen viability is low, the natural pollination efficiency is not high, which affects the fruit setting rate and fruit quality.

[0003] In existing technologies, several genes regulating flowering time or floral organ development in plants have been reported. For example, the FT gene is recognized as a flowering integrinum, and its overexpression can lead to early flowering; genes such as AMS and MYB21 have been shown to be crucial for stamen and pollen development. However, these studies mostly focus on improving single traits, namely regulating flowering time or sex differentiation separately. Currently, there are no reports on using a single isolated nucleic acid molecule to simultaneously solve the two core breeding challenges of Sapindus mukorossi: "late flowering / long juvenile period" and "male flower dominance / low fruit set rate." Therefore, developing new nucleic acid molecule resources with multiple positive regulatory functions is of great significance for accelerating the breeding of high-yielding and high-quality Sapindus mukorossi varieties. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a nucleic acid molecule encoding the HD-ZIP34 protein isolated from Sapindus mukorossi and its applications. This gene can significantly regulate the flowering time of plants, advancing the flowering time; at the same time, it can inhibit stamen development and promote pistil development, playing a key role in regulating floral sex differentiation. This invention provides important genetic resources and molecular tools for cultivating new Sapindus mukorossi varieties with early flowering and high fruit set rates using genetic engineering technology.

[0005] Through long-term exploration and experimentation, as well as numerous trials and efforts, the inventors have continuously reformed and innovated to solve the above-mentioned technical problems. The technical solution provided by this invention is as follows: To achieve the above-mentioned inventive objectives, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (a) The nucleotide sequence shown in SEQ ID NO.1; (b) A nucleotide sequence that has at least 95% identity with the nucleotide sequence defined in (a) and encodes a protein that regulates flowering time and / or sex differentiation in plants; (c) A nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2.

[0006] The nucleotide sequence shown in SEQ ID NO.1 is an open reading frame (ORF) encoding the SmHD-ZIP34 protein, which was cloned from the cDNA of female flower buds of Sapindus mukorossi by RT-PCR. It is 831 bp in length and encodes 276 amino acid residues.

[0007] Preferably, the nucleotide sequence (b) has at least 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity with SEQ ID NO.1. More preferably, the nucleotide sequence (b) has at least 98% sequence identity with SEQ ID NO.1.

[0008] The term "at least X% identity" refers to the percentage of identical nucleotide residues in two nucleotide sequences after alignment and the introduction of gaps (if necessary) to obtain the maximum percentage of sequence identity. Sequence alignment can be performed using bioinformatics software well-known in the art, such as BLAST, ClustalW, etc.

[0009] Secondly, the present invention provides a protein encoded by the above-mentioned nucleic acid molecule, the amino acid sequence of which is shown in SEQ ID NO.2.

[0010] The SmHD-ZIP34 protein exhibits typical HD-ZIP transcription factor structural features, with its N-terminus containing a homeodomain responsible for DNA binding; and its C-terminal region containing a leucine zipper domain mediating protein dimerization. Tertiary structure prediction shows that the protein uses α-helices as the main secondary structural element, exhibiting an overall extended helical bundle conformation.

[0011] Thirdly, the present invention provides primer pairs for cloning the above-mentioned nucleic acid molecules, the nucleotide sequences of which are as follows: First upstream primer F (SEQ ID NO.3): 5'-ATGACAACACCTATCATCAGTCAAAA-3', First downstream primer R (SEQ ID NO.4): 5'-TTACACAGGAAAGAAGTACTCGTCG-3'.

[0012] Furthermore, the present invention also provides cloning primer pairs containing restriction enzyme sites for expression vector construction, wherein the nucleotide sequences of the primer pairs are as follows: Second upstream primer F (SEQ ID NO.5): 5'-AGAACACGGGGGACTCTTGACATGACAACACCTATCATCAGTCAAAA-3', Second downstream primer R (SEQ ID NO.6): 5'-GGGGAAATTCGAGCTGGTCACTTACACAGGAAAGAAGTACTCGTCG-3'.

[0013] Fourthly, the present invention provides primer pairs for performing quantitative fluorescence analysis of the above-mentioned nucleic acid molecules, the nucleotide sequences of which are as follows: Third upstream primer F (SEQ ID NO.7): 5'-ACCAAAACGGAGGAGACGAA-3', Third downstream primer R (SEQ ID NO.8): 5'-TGGATGGTTGTGGCATGTACT-3'.

[0014] Fifthly, the present invention provides a recombinant expression vector containing the nucleic acid molecule described in the first aspect of the present invention.

[0015] Preferably, the recombinant expression vector is pCAMBIA1301-SmHD-ZIP34, which is obtained by cloning the nucleotide sequence shown in SEQ ID NO.1 into the pCAMBIA1301 vector backbone.

[0016] More specifically, the pCAMBIA1301 vector plasmid was double-digested with restriction endonucleases BstEII-HF and NcoI-HF, and the SmHD-ZIP34 gene fragment was homologously ligated with the digested vector using the ClonExpress II One Step Cloning Kit to obtain the 35S::SmHD-ZIP34 overexpression vector.

[0017] In a sixth aspect, the present invention provides a host cell comprising the nucleic acid molecule described in the first aspect of the present invention or the recombinant expression vector described in the fifth aspect of the present invention.

[0018] Preferably, the host cell is Agrobacterium tumefaciens GV3101 competent cell, Escherichia coli DH5α competent cell, or plant cell.

[0019] In a seventh aspect, the present invention provides the use of the nucleic acid molecule described in the first aspect of the present invention, or the protein described in the second aspect, or the primer pair described in the third or fourth aspect, or the recombinant expression vector described in the fifth or sixth aspect, or the host cell described in the seventh aspect, in regulating the flowering time and / or sex differentiation of plants.

[0020] Preferably, the plant is a plant belonging to the order Sapindales, family Sapindaceae, genus Sapindus, or Arabidopsis thaliana.

[0021] Preferably, the regulation of plant flowering time includes advancing the flowering time of plants; the regulation of plant sex differentiation includes inhibiting stamen development and promoting pistil development.

[0022] Eighthly, the present invention provides a method for cultivating or screening plants with advanced flowering time and / or sex differentiation, the method comprising introducing and expressing the nucleic acid molecule described in the first aspect of the present invention in the plant, or detecting the expression level of the nucleic acid molecule.

[0023] Preferably, the method for introducing and expressing the nucleic acid molecule of the present invention in plants includes: constructing a recombinant expression vector containing the nucleic acid molecule of the present invention, transforming the recombinant expression vector into Agrobacterium, introducing the nucleic acid molecule into plant cells or tissues using Agrobacterium-mediated genetic transformation, and then obtaining transgenic plants through screening and identification.

[0024] Compared with the prior art, the present invention has the following significant advantages: 1. A novel gene resource regulating flowering time and sexual differentiation in plants has been discovered. This invention is the first to isolate and identify the SmHD-ZIP34 gene from Sapindus mukorossi, and systematically elucidates its function in regulating flowering time and sexual differentiation. The discovery of this gene fills a gap in the functional study of the HD-ZIP family in Sapindus mukorossi, providing a valuable gene resource for molecular breeding of Sapindus mukorossi and other woody economic forest tree species.

[0025] 2. It can significantly advance the flowering time of plants. Transgenic experiments showed that overexpression of the SmHD-ZIP34 gene in Arabidopsis thaliana advanced the flowering time by approximately 9.09 days, and reduced the average number of rosette leaves at flowering by 3.84. This early flowering effect indicates that the SmHD-ZIP34 gene can significantly shorten the vegetative growth period of plants, which has important application value for accelerating the breeding process of woody plants with long juvenile periods, such as Sapindus mukorossi.

[0026] 3. It can effectively regulate the sex differentiation of floral organs. Overexpression of the SmHD-ZIP34 gene can significantly inhibit stamen development and promote pistil development, specifically manifested as: a reduction in the number of stamens (approximately 53.3% of flowers have fewer than the standard 6 stamens), an average pistil elongation of 0.63 mm, abnormal anther development, and a significant decrease in pollen viability. This unique sex-regulating effect provides a direct functional basis for the targeted improvement of the male-to-female flower ratio in Sapindus mukorossi through molecular means.

[0027] 4. The molecular mechanism by which SmHD-ZIP34 regulates flower development was elucidated. Analysis of the expression changes of endogenous genes related to flower development in transgenic plants revealed that SmHD-ZIP34 drives the early flowering phenotype by upregulating the expression of the flowering-promoting factor AtFT, while simultaneously activating the key carpel development gene AtSHP2 and its downstream target gene AtCRC to promote pistil elongation; and inhibits stamen development by downregulating the expression of the ethylene signaling gene AtEIN3, the jasmonic acid signaling receptor AtCOL1, and their downstream key anther development transcription factors AtAMS and AtMYB21. The elucidation of these molecular mechanisms provides a solid theoretical basis for the application of the SmHD-ZIP34 gene.

[0028] 5. A complete system for genetic engineering applications is provided. This invention not only provides the nucleic acid and amino acid sequences of the SmHD-ZIP34 gene, but also complete cloning primers, quantitative fluorescence detection primers, overexpression vector construction schemes, and genetic transformation methods, forming a complete technical system from gene cloning to functional verification and breeding applications, which can be directly applied to the molecular breeding practices of Sapindus mukorossi and other economic forest tree species. Attached Figure Description

[0029] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0030] Figure 1This is an electrophoresis image of the SmHD-ZIP34 gene clone. In the image, the marker is the DL2000 DNA molecular weight standard, and the target fragment size is approximately 831 bp.

[0031] Figure 2 This is a predicted diagram of the tertiary structure of the SmHD-ZIP34 protein.

[0032] Figure 3 The results show the expression pattern analysis of SmHD-ZIP34 during the development of male and female flower buds.

[0033] Figure 4 The results show the identification of the 35S::SmHD-ZIP34 transgenic plants. Among them, (A) PCR molecular detection electrophoresis image shows that the target band of 831 bp can be amplified using the DNA of the transgenic plants obtained by hygromycin resistance screening as a template; (B) RT-qPCR verifies the expression level of SmHD-ZIP34 in wild type (WT) and overexpression lines (OE-SmHD-ZIP34-1, OE-SmHD-ZIP34-6, OE-SmHD-ZIP34-10).

[0034] Figure 5 Phenotypic analysis of Arabidopsis plants overexpressing SmHD-ZIP34. The results include: (A) comparison of overall phenotype between wild-type and overexpressing plants at flowering time; (B) vegetative growth morphology of 20-day-old seedlings; (C) comparison of rosette leaf morphology; (D) statistical analysis of rosette leaf number and flowering time; (E) comparison of pod morphology (overall and anatomical); and (F) curling phenotype of stem leaves. *P<0.05, **P<0.01, ***P<0.001. Scale bar: 1 cm.

[0035] Figure 6 SmHD-ZIP34 overexpression induced stamen development inhibition and floral organ morphological changes. (A) Comparison of overall flower phenotype and pistil / stamen phenotypes between wild-type and overexpressing plants, showing five abnormal flower types (types 1-5); (B) Comparison of stigma pollen attachment; (C) Statistical analysis of pistil length and stamen number. *P<0.05, **P<0.01, ***P<0.001. Scale bar: (A) 250 μm, (B) 50 μm.

[0036] Figure 7Microscopic structure and fertility analysis of anthers and pollen from SmHD-ZIP34-overexpressing plants. (A) Comparison of paraffin sections of anther cross-sections (Safranin-Fix-Green staining); (B) Scanning electron microscopy images of the overall anther and pollen grain surface morphology; (C) Alexander staining to distinguish fertile (red) and aborted (green) pollen, and pollen germination status in vitro. Scale bars: (A) 50 μm; (B) Anther 300 μm, pollen grain 10 μm; (C) Anther 50 μm, pollen germination 100 μm.

[0037] Figure 8 The expression changes of endogenous genes related to flower development in wild-type and overexpression lines. Detailed Implementation

[0038] The following description is based on specific embodiments.

[0039] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to represent selected embodiments of the present invention.

[0040] In this invention, unless otherwise specified, all equipment and raw materials are available from the market or commonly used in the industry. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0041] Example 1

[0042] This example describes the cloning and sequence analysis process of the SmHD-ZIP34 gene.

[0043] 1.1 Experimental Materials This study selected nine clonal Sapindus mukorossi trees (average height 6.8 m, average diameter at breast height 16.5 cm) planted at the Sapindus mukorossi National Forest Germplasm Resource Bank in Jianning County, Fujian Province (26°49'N, 116°52'E, average altitude 300 m) as experimental materials. Three trees were pooled into one biological replicate, for a total of three biological replicates. Samples of roots, stems, leaves, female flowers, and male flowers were collected. Samples were rapidly frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction.

[0044] After the formation of Sapindus mukorossi florets, flower samples during the development of floral organs cover seven growth stages: FF1 / MF1 (primordium formation stage), flower diameter 0.8-1.0 mm; FF2 / MF2 (microsporocyte meiosis stage), flower diameter 1.30-1.48 mm; FF3 / MF3 (megasporocyte meiosis stage), flower diameter 1.67-1.75 mm; FF4 / MF4 (flower differentiation stage), flower diameter approximately 2.0 mm; FF5 / MF5 (rapid elongation of filaments and styles), flower diameter 3.3-3.5 mm; FF6 / MF6 (full bloom stage), flower diameter 4.0-4.4 mm; FF7 / MF7 (flower senescence stage), petals wither and nearly fall off.

[0045] 1.2 Gene Cloning PCR amplification was performed using cDNA from the 7th developmental stage (FF7) of female flower buds as a template. The cloning primers used were a second primer pair containing restriction enzyme sites (SEQ ID NO.5 and SEQ ID NO.6). The PCR amplification reaction system is shown in Table 1.

[0046] Table 1 PCR amplification reaction system Upstream primer (10 μmol / L) 0.5 μl Downstream primer (10 μmol / L) 0.5 μl cDNA template 1 μl <![CDATA[ddH2O]]> 10.5 μl 2×Phanta Max Master Mix 12.5 μl Total volume 25 μl The PCR reaction program was as follows: 98°C pre-denaturation for 3 min; 98°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 40 s, for a total of 34 cycles; final extension at 72°C for 5 min, and storage at 4°C.

[0047] After adding 2 μl of 10× Loading buffer, the PCR products were separated by 1% agarose gel electrophoresis. The results were observed and photographed using a UV gel imaging system (e.g., ...). Figure 1 (As shown). After cutting out the gel block containing the target band, the target fragment was recovered and purified using a DNA gel extraction kit. The recovered target fragment was ligated into a cloning vector and transformed into E. coli DH5α competent cells. After colony PCR verification, the cells were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing.

[0048] Sequencing results showed that the full-length coding sequence (CDS) of the SmHD-ZIP34 gene, with a length of 831 bp, was successfully cloned, as shown in SEQ ID NO.1. This sequence encodes a protein of 276 amino acid residues, as shown in SEQ ID NO.2.

[0049] Example 2 This example describes the bioinformatics analysis process of the SmHD-ZIP34 protein.

[0050] The sequence characteristics and structural features of the SmHD-ZIP34 protein were analyzed using online bioinformatics analysis tools.

[0051] Protein domain analysis was performed using the NCBI Conserved Domain Search Tool (CDD) and SMART software. The results showed that the N-terminus (amino acids 1-61) of the SmHD-ZIP34 protein contains a typical homeodomain, and the C-terminal region (amino acids 100-160) contains a leucine zipper domain, belonging to the IV subfamily (HD-ZIP IV) of the HD-ZIP transcription factor family.

[0052] Homology modeling of the three-dimensional structure of the SmHD-ZIP34 protein was performed using the online protein structure prediction tool SWISS-MODEL. For example... Figure 2 As shown, the SmHD-ZIP34 protein uses α-helices as its main secondary structural element, exhibiting an extended helical bundle conformation. The N-terminal homeomorphic domain forms three α-helices (helices 1-3), which recognize and bind to specific DNA sequences in the promoter regions of target genes via a helix-turn-helix conformation. The C-terminal leucine zipper region forms a fungible α-helix, with one leucine residue every seven amino acid residues, mediating the formation of homodimers or heterodimers between two protein monomers, thereby enhancing the specificity and affinity of DNA binding.

[0053] Example 3 This embodiment describes the process of analyzing the expression pattern of the SmHD-ZIP34 gene in different tissues and flower development stages of Sapindus mukorossi.

[0054] 3.1 RNA extraction and cDNA synthesis Samples from different tissues of Sapindus mukorossi were ground with liquid nitrogen, and total RNA was extracted using the Omega Plant RNA Kit. RNA concentration and purity (A260 / A280 ratio between 1.8 and 2.1) were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and RNA integrity was assessed by 1% agarose gel electrophoresis. cDNA was synthesized using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR reverse transcription kit. The obtained cDNA was appropriately diluted with nuclease-free water and stored at -20°C for later use.

[0055] 3.2 RT-qPCR Expression Analysis qRT-PCR of the SmHD-ZIP34 gene was performed using TB Green Premix Ex Taq (SYBR Green) real-time quantitative PCR reagent. The third primer pair (SEQ ID NO.7 and SEQ ID NO.8) was used for real-time PCR, with the Sapindus mukorossi SmACT gene as an internal reference gene (primer F: AGAAAGTTGGCCTCGCTGAA, primer R: CAGGAACCAGACCACCTGTC). The qRT-PCR amplification reaction system is shown in Table 2.

[0056] Table 2 qRT-PCR amplification reaction system 2×TB Green Premix Ex Taq 10 μl 50×ROX Reference Dye 0.4 μl Upstream primer (10 μmol / L) 0.4 μl Downstream primer (10 μmol / L) 0.4 μl cDNA template 2 μl <![CDATA[RNase-free ddH2O]]> 6.8 μl Total volume 20 μl The qRT-PCR reaction program was as follows: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s; 60°C annealing and extension for 30 s, for a total of 40 cycles. After each cycle, melting curve analysis was performed: fluorescence signals were collected 5 times for every 1°C increase from 60°C to 95°C to verify product specificity. Three biological replicates and two technical replicates were set up. -ΔΔCt The relative expression level of a gene can be calculated.

[0057] 3.3 Results of Expression Pattern Analysis like Figure 3 As shown, the SmHD-ZIP34 gene exhibits differential expression patterns in different tissues and flower development stages of Sapindus mukorossi. Tissue-specific analysis revealed that SmHD-ZIP34 expression was highest in the stem, lower in the roots and leaves, and moderate in the floral organs.

[0058] SmHD-ZIP34 expression exhibits a dynamic pattern across the seven developmental stages of male and female flowers: in the first three stages (FF1-FF3 / MF1-MF3), the expression levels in male and female flowers are similar and remain relatively stable; in the fourth developmental stage (FF4 / MF4, flower differentiation stage), a significant inflection point in expression occurs, and the expression differences between male and female flowers begin to emerge; after stage 4, the expression differences gradually increase, especially in stage FF7 (female flower senescence stage), when the expression level of SmHD-ZIP34 reaches its peak.

[0059] The above expression pattern suggests that the SmHD-ZIP34 gene may play an important regulatory role at the critical turning point (stage 4) of Sapindus mukorossi flower sex differentiation, implying that this gene may affect the development and differentiation process of Sapindus mukorossi male and female flowers.

[0060] Example 4 This embodiment describes the construction process of the SmHD-ZIP34 overexpression vector.

[0061] 4.1 Vector digestion The SmHD-ZIP34 bacterial culture plasmid and pCAMBIA1301 vector plasmid, which had been verified by sequencing, were extracted using a high-purity plasmid miniprep kit. The pCAMBIA1301 vector plasmid was double-digested with restriction endonucleases BstEII-HF and NcoI-HF. The digestion reaction system is shown in Table 3.

[0062] Table 3 Enzyme digestion reaction system CutSmart Buffer 5 μl BstEII-HF 1 μl NcoI-HF 1 μl pCAMBIA1301 vector 10 μl <![CDATA[RNase-free ddH2O]]> 33 μl Total volume 50 μl The enzyme digestion reaction was carried out at 37°C for 30 min. After the enzyme digestion products were detected by 1% agarose gel electrophoresis, the linearized vector fragments were recovered using a DNA gel recovery kit and stored at -20°C for later use.

[0063] 4.2 Homologous recombination linkage The SmHD-ZIP34 gene fragment was ligated into the enzyme-digested pCAMBIA1301 vector using the ClonExpress II One Step Cloning Kit. The ligation reaction system is shown in Table 4.

[0064] Table 4 Connection Reaction System PCR amplification of DNA fragments 2 μl pCAMBIA1301 vector after enzyme digestion 1.5 μl 5×CE II Buffer 1 μl Exnase II 0.5 μl Total volume 5 μl The ligation reaction was performed at 37°C for 30 min. The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar containing 50 mg / L kanamycin, and incubated upside down at 37°C for 12–16 h. Single colonies were picked for colony PCR verification. Positive clones were confirmed by sequencing, and plasmids were extracted for later use.

[0065] 4.3 Agrobacterium-mediated transformation The validated pCAMBIA1301-SmHD-ZIP34 recombinant plasmid was transformed into Agrobacterium GV3101 competent cells using a freeze-thaw method. The transformation product was plated on LB agar containing 50 mg / L kanamycin and 25 mg / L rifampin and incubated upside down at 28°C for 48 h. Single colonies were picked for PCR verification to obtain Agrobacterium positive clones containing the recombinant expression vector, which were used for subsequent Arabidopsis genetic transformation.

[0066] Example 5 This example describes the process of obtaining and identifying transgenic Arabidopsis thaliana.

[0067] 5.1 Cultivation of wild-type Arabidopsis thaliana Take an appropriate amount of wild-type Arabidopsis thaliana (Columbia ecotype) seeds and place them in a 1.5 ml centrifuge tube. Add 1 / 50 volume of sodium hypochlorite solution, mix well, and shake repeatedly up and down for 10-15 minutes to sterilize. After sterilization, wash 4-5 times with sterile distilled water and spread the seeds evenly on sterilized 1 / 2 MS solid medium. After vernalization treatment at 4°C in the dark for 3 days, transfer to a light incubator (16 h light / 8 h dark, 22°C) for one week. Transplant the Arabidopsis thaliana seedlings into sterilized culture soil (nutrient soil: vermiculite = 1:1) and place them in a light incubator for continued cultivation (long-day conditions: 16 h light / 8 h dark, 22°C, 70% relative humidity).

[0068] 5.2 Agrobacterium-mediated genetic transformation in Arabidopsis thaliana Arabidopsis thaliana was transformed using the floral dip method. When the Arabidopsis had bolted and produced 3-4 stem leaves, the terminal inflorescence was removed to break apical dominance, promoting lateral branching and abundant flowering. Agrobacterium GV3101 positive clones containing the recombinant plasmid pCAMBIA1301-SmHD-ZIP34 were inoculated into LB broth containing the appropriate antibiotic and cultured at 28°C with shaking at 200 rpm until the OD600 reached approximately 0.8-1.0. The cells were collected by centrifugation and resuspended in 1 / 2 MS broth containing 5% sucrose until the OD600 reached approximately 0.8. Silwet L-77 (final concentration 0.02%) was added to the resuspended culture.

[0069] Immerse the Arabidopsis inflorescences in the Agrobacterium resuspension solution described above, gently agitating for 15-30 seconds to ensure full contact between the flower buds and the bacterial solution. Remove the plants, absorb excess bacterial solution with absorbent paper, place them flat on a tray, cover with a black plastic bag to block light and maintain humidity, and incubate in the dark for 24 hours before returning to normal light conditions. Repeat the infection four times during the flowering period, with each infection spaced approximately one week apart, to improve transformation efficiency.

[0070] 5.3 Screening and Identification of Transgenic Plants Transformed Arabidopsis plants were cultured normally until seed maturity (T0 generation). T0 generation seeds were harvested, dried, and stored at 4°C. T0 generation seeds were sown on 1 / 2 MS solid medium containing 25 mg / L hygromycin for resistance selection. Seedlings that grew normally and had well-developed root systems were considered positive transgenic plants.

[0071] Genomic DNA was extracted from resistant plants and used as a template for PCR amplification and molecular detection using the Plant Direct PCR Kit. The PCR products were then analyzed by 1% agarose gel electrophoresis to observe the presence of the target band of 831 bp. Figure 4As shown in (A), the overexpression lines were able to amplify the target band of the expected size, while the wild type did not detect the band.

[0072] Total RNA was extracted from the inflorescences of PCR-positive plants and reverse transcribed into cDNA. The expression level of SmHD-ZIP34 was verified by RT-qPCR. Figure 4 As shown in (B), compared with the wild type, the expression level of SmHD-ZIP34 in the overexpression lines OE-SmHD-ZIP34-1, OE-SmHD-ZIP34-6 and OE-SmHD-ZIP34-10 was significantly increased, indicating that the transgenic plants were successfully constructed.

[0073] The homozygous T3 line obtained from the screening was finally used for subsequent phenotypic analysis.

[0074] Example 6 This example describes the flowering time and vegetative growth phenotypic analysis process of transgenic Arabidopsis thaliana.

[0075] Wild-type (WT) and several independent transgenic homozygous lines (OE1, OE6, OE10) were cultured simultaneously under the same culture conditions, and the growth and development of the plants were observed and recorded regularly.

[0076] Flowering time statistics: Observe the flowering of the plants every day from the date of sowing, and record the number of days when the first flower on the main stem opens (flowering time) and the total number of rosette leaves at this time. Each plant should have no fewer than 20 flowers.

[0077] like Figure 5 As shown in the figure, Arabidopsis lines overexpressing SmHD-ZIP34 exhibited the following significant phenotypic changes compared to the wild type: (1) Early flowering phenotype: The flowering time of overexpression lines OE1, OE6 and OE10 was significantly earlier than that of wild type, by an average of about 9.09 days, and the difference was extremely significant (P<0.001).

[0078] (2) Reduced number of rosette leaves: The average number of rosette leaves at flowering time of the overexpression line was reduced by about 3.84 compared with the wild type (P<0.001), indicating that the overexpression of SmHD-ZIP34 shortened the vegetative growth stage.

[0079] (3) Abnormal rosette leaf morphology: The rosette leaves of the overexpressing strains are narrow and elongated and accompanied by curling, and the leaf surface is uneven. Figure 5 (C)

[0080] (4) Abnormal pod morphology: The pods of the overexpression strains are generally short and thin, and the morphology is mostly curved and shriveled. The fruit setting rate is significantly lower than that of the wild type. Figure 5 (E).

[0081] (5) Curling of stem leaves: The stem leaves of transgenic plants also showed a similar narrow and curled phenotype. Figure 5 (Middle F).

[0082] The results indicate that overexpression of SmHD-ZIP34 can broadly affect multiple key developmental processes in Arabidopsis thaliana from vegetative growth to reproductive growth, and this gene plays an important role in regulating flowering time and the transition from vegetative to reproductive growth.

[0083] Example 7

[0084] This example describes the process of analyzing the morphology and sex differentiation of transgenic Arabidopsis thaliana flower organs.

[0085] The floral organs of wild-type and overexpression lines were observed and dissected under a stereomicroscope (Leica, Germany), and the morphological changes of stamens and pistils were compared and analyzed. Parameters such as pistil length and stamen number were measured using ImageJ software. At least 30 flowers were observed for each line.

[0086] like Figure 6 As shown, overexpression of SmHD-ZIP34 resulted in significant sex-biased changes in the development of Arabidopsis flower organs: (1) Reduced number of stamens: Compared with the wild type (normal 6 stamens), the number of stamens was reduced in some flowers of the overexpression lines. Based on key indicators such as the number of stamens, pistil length, and stamen development status, the abnormal floral organs were divided into five main types: type 1 has 4 stamens; type 2 has 4 stamens and elongated pistils; type 3 has 5 stamens; type 4 has 5 stamens and elongated pistils; type 5 has normal 6 stamens but elongated pistils ( Figure 6 (A). Quantitative statistics show that approximately 53.3% of the overexpression lines had fewer than the standard 6 stamens in their flowers.

[0087] (2) Pistil elongation: The average pistil length of the overexpressing lines was about 0.63 mm longer than that of the wild type (P<0.001), indicating that SmHD-ZIP34 has a positive regulatory effect on pistil development. Figure 6 (C)

[0088] (3) Reduced pollen attachment: Stereomicroscopic observation showed that the amount of pollen attached to the stigma surface of the overexpression line was significantly lower than that of the wild type. Figure 6 (B), which directly leads to a decrease in pollination efficiency, consistent with a phenotype of decreased seed set.

[0089] The above results indicate that the SmHD-ZIP34 gene has a dual function of promoting pistil development and inhibiting stamen development in Arabidopsis thaliana, suggesting that this gene may play a key role in the regulation of Sapindus mukorossi flower sex differentiation.

[0090] Example 8 This example describes the process of analyzing the fertility of transgenic Arabidopsis anthers and pollen.

[0091] To further investigate the cytological causes of abnormal stamen development, a systematic comparative analysis was conducted on the anthers and pollen of wild-type and transgenic plants.

[0092] 8.1 Observation of anther paraffin sections Inflorescences of wild-type and overexpression lines were fixed in FAA fixative (38% formaldehyde: glacial acetic acid: 70% ethanol = 5:5:90) at room temperature for at least 24 h. After dehydration with a gradient of ethanol (70%, 85%, 95%, and 100% for 1 h each), clearing with xylene, paraffin infiltration, and embedding, sections were prepared using a rotary microtome to a thickness of 5–8 μm. Sections were dewaxed with xylene, rehydrated with a gradient of ethanol, stained with safranin-fast green, mounted with neutral resin, and observed and photographed under an optical microscope (Olympus, Japan).

[0093] like Figure 7 As shown in (A), the four locules of the wild-type anthers are normally developed, and the pollen sacs are filled with mature pollen grains. However, the anthers of the overexpression strain are abnormally shrunken, the number of pollen grains in the pollen sacs is significantly reduced, and some locules are completely empty.

[0094] 8.2 Scanning electron microscopy observation Mature anthers of wild-type and overexpression lines nearing opening were collected and prepared for scanning electron microscopy (SEM) using a freeze-drying method. Pollen grains were directly adhered to a conductive adhesive. All samples were sputter-coated with gold and then observed and photographed using a high-resolution field emission scanning electron microscope (Hitachi, Japan) to examine the overall morphology of the anthers and the surface structure of the pollen grains.

[0095] like Figure 7 As shown in (B), scanning electron microscopy revealed that, compared to the wild type, the anthers of the overexpressing line exhibited slight collapse and insufficient plumpness. The released pollen grains showed a rough and disordered reticulation and spherical collapse, exhibiting obvious morphological abnormalities.

[0096] 8.3 Alexander staining Alexander staining was used to distinguish between fertile and aborted pollen. Flowers about to open were collected, and the anthers were placed on a glass slide. Alexander staining solution (Solarbio, China) was added, and the flowers were stained for 15 minutes before observation under a light microscope. The cytoplasm of fertile pollen was stained red, while that of aborted pollen was green or unstained.

[0097] like Figure 7 As shown on the left side of (C), wild-type pollen is red (fertile), while pollen from overexpression lines is mostly green (sterile), indicating that pollen fertility is severely impaired.

[0098] 8.4 Pollen in vitro germination experiment In vitro pollen germination experiments were conducted on a germination medium containing 20% ​​sucrose, 0.01% boric acid, and 1% agar. Fresh pollen was gently applied to the surface of the medium and incubated at 25°C in the dark for 12 hours. The germination of pollen tubes was then observed and photographed under an optical microscope.

[0099] like Figure 7 As shown on the right side of (C), wild-type plants exhibit high pollen germination rates, vigorous pollen tube growth, and normal length. In contrast, transgenic plants show significantly reduced pollen germination rates, with germinating pollen tubes that are short, deformed, or even ruptured, resulting in severely impaired reproductive viability.

[0100] In summary, the above analysis shows that overexpression of SmHD-ZIP34 leads to abnormal anther locule development, pollen morphology defects, loss of pollen fertility, and inhibited pollen tube growth, confirming at the cellular level the significant inhibitory effect of the SmHD-ZIP34 gene on stamen development and anther fertility.

[0101] Example 9 This example describes the expression analysis of endogenous genes related to flower development.

[0102] To investigate the molecular mechanism by which SmHD-ZIP34 regulates phenotypic changes in flower development, three independent overexpression lines (OE-SmHD-ZIP34-1, OE-SmHD-ZIP34-6, and OE-SmHD-ZIP34-10) were selected. Total RNA was extracted from the inflorescence and reverse transcribed into cDNA. The expression levels of genes in key pathways of flower development were analyzed by RT-qPCR.

[0103] Using AtEF1α as an internal reference gene, 2 -ΔΔCt The relative expression levels of genes were calculated using the method. The primer sequences used for quantitative real-time PCR are shown in Table 5.

[0104] Table 5 Primer sequences for real-time PCR

[0105] like Figure 8 As shown, RT-qPCR results indicate that SmHD-ZIP34 synergistically regulates the expression network of flower development-related genes through multiple pathways: (1) Flowering promotion pathway: The expression of the flowering promotion factor AtFT was significantly upregulated in the overexpression lines (P<0.05), which is the direct cause of the early flowering phenotype in transgenic plants. AtFT is the core gene of the flowering integration pathway, and its upregulation can promote the transformation of shoot apical meristem into flowering meristem, thus accelerating the flowering process.

[0106] (2) Pathway promoting pistil development: The expression of AtSHP2, a key gene for carpel development, and its downstream target gene AtCRC were significantly upregulated (P<0.05). AtSHP2 is a MADS-box transcription factor that regulates ovule and carpel development, and its upregulated expression promoted the elongation and development of the pistil.

[0107] (3) Stamen development inhibition pathway one—hormonal signal regulation: The expression of the core transcription factor AtEIN3, which is responsible for ethylene signaling, was significantly downregulated (P<0.001), and the expression of the jasmonic acid signaling receptor AtCOL1 was also significantly downregulated (P<0.001). The downregulation of AtCOL1 further led to a significant decrease in the expression of the core transcription factor AtAMS, which is responsible for anther development, and its downstream target gene AtMYB21 (P<0.001), thereby disrupting the normal differentiation of the anther wall and the pollen formation process.

[0108] (4) Stamen development inhibition pathway two – auxin signal regulation: The expression of auxin export carrier AtPIN1 and its response factor AtARF6 were both significantly downregulated (P<0.05). AtPIN1 is involved in the polar transport of auxin, and its downregulation affected the normal morphogenesis of anthers; AtARF6, as an auxin response factor, further impaired the maintenance of pollen fertility mediated by auxin.

[0109] The above gene expression changes elucidate the mechanism of early flowering, pistil elongation, abnormal stamen development, pollen abortion, and leaf curling in SmHD-ZIP34 transgenic plants at the molecular level, providing an important theoretical basis for the application of the SmHD-ZIP34 gene in the molecular breeding of Sapindus mukorossi.

[0110] This invention is the first to clone the SmHD-ZIP34 gene from Sapindus mukorossi and systematically elucidate its function in regulating flowering time and floral sex differentiation using an Arabidopsis heterologous overexpression system. Experimental results show that SmHD-ZIP34 has a dual function of promoting flowering and female-biased development: on the one hand, it accelerates the flowering process by upregulating AtFT expression; on the other hand, it achieves targeted regulation of sex differentiation by activating pistil development-related genes (AtSHP2, AtCRC) and inhibiting the stamen development-related gene network (AtEIN3-AtCOL1-AtAMS-AtMYB21, AtPIN1-AtARF6).

[0111] From a breeding application perspective, while constitutive overexpression of SmHD-ZIP34 throughout the plant can significantly promote pistil development, it also inhibits stamen development and causes pollen abortion, thereby reducing pollination efficiency and seed set rate. Therefore, in practical breeding applications of Sapindus mukorossi, it is recommended to use flower organ-specific promoters (such as a weakened version of the cauliflower mosaic virus 35S promoter or flower organ-specific expression promoters) to precisely regulate the expression mode and intensity of SmHD-ZIP34, optimizing the ratio of male to female flowers while retaining a certain proportion of fertile pollen, thus balancing sex improvement with normal pollination and seed set.

[0112] The SmHD-ZIP34 gene and its application provided by this invention offer important genetic resources and technical means for the targeted improvement of flowering characteristics and sex ratio of economic forest tree species such as Sapindus mukorossi, and for the cultivation of high-yield new varieties using genetic engineering technology.

[0113] In the description of this invention, it should be understood that "-" and "~" represent a range between two values, and this range includes the endpoints. For example, "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0114] In the description of this invention, the term "and / or" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, A and / or B can represent three cases: A exists alone, A and B exist simultaneously, and B exists alone.

[0115] In the description of the invention, the numerical values ​​of time, temperature, ratio, and mass involved can be based on actual measurements, standard equipment parameters, simplified rounding results, or within an acceptable error range, ensuring the practicality and repeatability of the invention.

[0116] In the description of this invention, the terms “about” or “approximately” are used to express approximate values ​​or ranges, allowing for a certain degree of error to ensure the flexibility and practicality of the description, while remaining within an acceptable range of error, with the maximum error not exceeding 10% of the corresponding value or range.

[0117] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule contains a nucleotide sequence selected from the group consisting of: (a) The nucleotide sequence shown in SEQ ID NO.1; (b) A nucleotide sequence that has at least 95% identity with the nucleotide sequence defined in (a) and encodes a protein that regulates flowering time and / or sex differentiation in plants; (c) A nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.

2.

2. A protein, characterized in that, The protein is encoded by the nucleic acid molecule of claim 1, the amino acid sequence of which is shown in SEQ ID NO.

2.

3. A primer pair for cloning the nucleic acid molecule of claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3 and SEQ ID NO.4, or in SEQ ID NO.5 and SEQ ID NO.

6.

4. A primer pair for quantitative fluorescence analysis of the nucleic acid molecule of claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.7 and SEQ ID NO.

8.

5. A recombinant expression vector, characterized in that, The recombinant expression vector contains the nucleic acid molecule as described in claim 1.

6. The recombinant expression vector according to claim 5, characterized in that, The recombinant expression vector is pCAMBIA1301-SmHD-ZIP34, which is obtained by cloning the nucleic acid molecule described in claim 1 into the pCAMBIA1301 vector backbone.

7. A host cell, characterized in that, The host cell comprises the nucleic acid molecule of claim 1, or the recombinant expression vector of claim 5 or 6.

8. The use of the nucleic acid molecule of claim 1, or the protein of claim 2, or the primer pair of claim 3 or 4, or the recombinant expression vector of claim 5 or 6, or the host cell of claim 7 in regulating flowering time and / or sex differentiation in plants.

9. The use according to claim 8, characterized in that, The plants mentioned are plants belonging to the Sapindales order, Sapindaceae family, Sapindaceae genus, or Arabidopsis thaliana.

10. A method for cultivating or screening plants with advanced flowering time and / or sex differentiation, characterized in that, This includes introducing and expressing the nucleic acid molecule of claim 1 in a plant, or detecting the expression level of the nucleic acid molecule of claim 1.

Images