CRISPR / su cas12a2-based gene editing system and application thereof

CN122588089APending Publication Date: 2026-08-18UNIV OF SCI & TECH OF CHINA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610728702.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-25
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0004]但是其产生双链DNA断裂具有强烈的致死性,产生的转化子数量较少,且极易发生免疫逃逸,即在细菌体内突变外源的Cas蛋白基因序列使其失活,导致失去编辑功能

Benefits of technology

[0059] Extending the recognition sequence of crRNA, i.e. the spacer sequence, can improve the editing efficiency of this method, and 30 bp is currently the optimal sequence length;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to a CRISPR / SuCas12a2-based gene editing system and application thereof. The present application constructs a high-efficiency counter-selection recombination editing tool by exploring the counter-selection potential of CRISPR-SuCas12a2 and combining it with lambda recombinase. The method can complete high-efficiency recombination editing of genes through a double-plasmid and single-plasmid system carrying SuCas12a2 and lambda recombinase, and the efficiency is greatly improved compared with the current recombination editing method based on lambda recombinase. Compared with the previous dependence on the specific cleavage of target double-stranded DNA by CRISPR-Cas protein to promote the effect of recombination editing, the efficiency is also obviously improved, and the method has the advantages of more transformants and low probability of immune escape. The plasmid construction, recombination editing and plasmid elimination operations can be completed within one week. The above functions supplement a powerful tool for gene recombination editing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a gene editing system based on CRISPR / SuCas12a2 and its applications. Background Technology

[0002] CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR-associated systems) is an acquired immune system against viruses widely found in bacteria and archaea. After its discovery, it was developed into a powerful tool for nucleic acid localization and cleavage. The most representative ones, Cas9 and Cas12a, which have double-strand DNA-specific cleavage capabilities, have received widespread attention and have been developed as tools to promote homologous recombination editing. There are currently two views on the mechanism of this method: one is that double-strand breaks activate the homologous repair system in the cell, and the other is that recombination occurs before cleavage. The lethality of double-strand cleavage of the genome by Cas proteins excludes cells that have not been edited, thereby increasing the proportion of edited cells. To improve the efficiency of this editing method, additional recombination systems such as the λ-Red recombination system and the RecET recombination system are often introduced into bacteria. The core of the currently used λ-Red recombination system consists of two proteins: Redα, which has exonuclease activity, and Redβ, a single-strand-binding annealing protein that stabilizes the single-stranded DNA produced after the exonuclease's action, thus improving recombination efficiency. The RecET recombination system is a similar system derived from *E. coli*, also containing two core proteins: the RecE protein functions as an exonuclease, while the RecT protein functions as a single-strand-binding protein. These two proteins work in tandem, making it a highly efficient recombination editing tool.

[0003] The combination of these two methods can greatly increase the efficiency of microbial editing, and this method does not introduce additional resistance gene markers. By using the lethality of double-strand breaks generated by the Cas protein, the genome can be edited without leaving a trace.

[0004] However, the double-strand DNA breaks they produce are highly lethal, resulting in a low number of transformants and a high risk of immune escape. This means that the exogenous Cas protein gene sequence can be mutated within bacteria, inactivating it and causing it to lose its editing function. This high lethality prevents these tools from being used in many microorganisms, and their development requires a trade-off between the screening effects of high lethality and the resulting low number of transformants. Therefore, there is an urgent need to develop a recombinant editing tool that can be used in multiple species, combining high editing efficiency, low immune escape, and a high number of transformants. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a gene editing system based on CRISPR / SuCas12a2 and its applications.

[0006] This invention provides a CRISPR / SuCas12a2-based gene editing system, comprising:

[0007] The SuCas12a2 protein-coding gene controlled by the arabinose promoter, the crRNA elongation controlled by the T7 promoter, the λ-Red recombinase-coding gene, and the homologous repair fragment;

[0008] The length of the RNA-directing sequence (gRNA) in the crRNA elongation is 29bp~31bp;

[0009] In gene editing systems based on the SuCas12a2 protein, the length of the gRNA is usually 24 bp. This invention shows that the optimal length of the RNA guide sequence (gRNA) is 30 bp, which significantly improves gene editing efficiency compared to the usual length. However, if the length is too long, the gene editing efficiency decreases significantly.

[0010] In a specific embodiment of the present invention, the RNA guide sequence (gRNA) is optimally 30 bp in length;

[0011] The homologous repair fragment includes: upstream fragment of the target gene - downstream fragment of the target gene; or, upstream fragment of the target gene - insertion sequence - downstream fragment of the target gene;

[0012] The inserted fragment is used to replace and / or mutate the target gene.

[0013] Furthermore, the promoter of the λ-Red recombinase is selected from the J23119 promoter, the arabinose promoter, or the T7 promoter.

[0014] The length of the upstream fragment and / or downstream fragment of the target gene is 500bp to 1500bp, with 1000bp being optimal.

[0015] Specifically, the nucleotide sequence of the SuCas12a2 protein encoding gene in the microbial gene editing system of the present invention is shown in SEQ ID NO:5;

[0016] The λ-Red recombinase includes gam protein, Bet protein, and exo protein;

[0017] The nucleotide sequence encoding the gam protein is shown in SEQ ID NO:6;

[0018] The nucleotide sequence encoding the Bet protein is shown in SEQ ID NO:7;

[0019] The nucleotide sequence encoding the exo protein is shown in SEQ ID NO:8.

[0020] This λ-Red recombinase is derived from the λ phage of Escherichia coli and is used to promote homologous recombination in bacteria.

[0021] The gene editing system of the present invention further includes replicons and / or selection markers.

[0022] Furthermore, the replicon is a medium-copy or low-copy replicon.

[0023] Furthermore, the medium or low copy number replication initiation site is selected from P15A-ori and / or pBBR1-oriV and / or pTA1060 ori used for Bacillus subtilis gene editing.

[0024] In the gene editing system of the present invention, the selection marker is selected from one or more of AmpR, KanR, CmR and / or sacB.

[0025] The gene editing system described in this invention can be composed of a dual-plasmid gene editing system or a single-plasmid gene editing system;

[0026] In the dual-plasmid gene editing system, the dual-plasmid gene editing system includes the pTSCas plasmid and the pRaA plasmid;

[0027] The pTSCas plasmid includes: the SuCas12a2 protein-coding gene controlled by the arabinose promoter and the crRNA elongation controlled by the T7 promoter;

[0028] The pRaA plasmid includes a λ-Red recombinase encoding gene and a homologous repair fragment;

[0029] The length of the RNA-guided sequence in the crRNA elongation is 29bp~31bp, and 30bp is the current optimal sequence length;

[0030] The homologous repair fragment includes: upstream fragment of the target gene - downstream fragment of the target gene; or, upstream fragment of the target gene - insertion sequence - downstream fragment of the target gene;

[0031] The inserted fragment is used to replace and / or mutate the target gene.

[0032] Furthermore, the pTSCas plasmid is obtained by inserting the SuCas12a2 protein-coding gene controlled by the arabinose promoter and the crRNA elongation controlled by the T7 promoter into the multiple cloning site of the pBBR1 plasmid as a backbone.

[0033] More specifically, the inserted fragments include: the crRNA elongation body controlled by the T7 promoter and T7 terminator, the SuCas12a2 protein-coding gene controlled by the arabinose operon (araC) and the arabinose promoter (araBAD promoter) and the TT terminator (the TT terminator is a double-terminator composed of the rrnB T1 terminator and the TE terminator);

[0034] In a specific embodiment of the present invention, the pTSCas plasmid obtained after insertion includes: a crRNA elongation body controlled by the T7 promoter and T7 terminator, an arabinose operon (araC), a SuCas12a2 protein encoding controlled by the arabinose promoter and the TT terminator (the TT terminator is a double-terminator composed of the rrnB T1 terminator and the TE terminator), a Kana selection marker, a Mob, a pBBR1-oriV replication initiation site, and a sacB selection marker. The nucleotide sequence of the pTSCas plasmid is shown in SEQ ID NO:1.

[0035] The pRaA plasmid includes λ-Red recombinase and a homology repair fragment; the promoter of the λ-Red recombinase encoding gene is the J23119 promoter.

[0036] Furthermore, the pRaA plasmid is based on the p15A plasmid, with a gene encoding a homology repair fragment and a λ-Red recombinase controlled by the J23119 promoter inserted into its multiple cloning site.

[0037] In a specific embodiment of the present invention, the pRaA plasmid obtained after insertion includes: a homology repair fragment, a modified λ-Red recombinase encoding gene controlled by the J23119 promoter, a CmR selection marker, a P15A-ori replication origin site, and a sacB selection marker. The nucleotide sequence of the pRaA plasmid is shown in SEQ ID NO:2.

[0038] In single-plasmid gene editing systems, this includes pTSCas-λ plasmid or pADKCas-λ plasmid;

[0039] The pTSCas-λ plasmid includes: a SuCas12a2 protein-coding gene controlled by an arabinose promoter, a crRNA elongation controlled by a T7 promoter, a λ-Red recombinase-coding gene, and a homologous repair fragment; the λ-Red recombinase-coding gene is controlled by an arabinose promoter.

[0040] Furthermore, the pTSCas-λ plasmid is obtained by inserting the SuCas12a2 protein-coding gene controlled by the arabinose promoter and TT terminator, the crRNA elongation controlled by the T7 promoter, the λ-Red recombinase-coding gene controlled by the arabinose promoter, and the homologous repair fragment into its multiple cloning site using the pBBR1 plasmid as a backbone.

[0041] More specifically, the inserted fragments include: a homology repair fragment, an arabinose operon (araC), an arabinose promoter (araBAD promoter), and a λ-Red recombinase-encoding gene controlled by the TT terminator, a crRNA elongation controlled by the T7 promoter, and a SuCas12a2 protein-encoding gene controlled by the arabinose operon (araC) and the araBAD promoter;

[0042] In a specific embodiment of the present invention, the pTSCas-λ plasmid obtained after insertion includes: a homology repair fragment, an arabinose operon (araC), an arabinose promoter (araBAD promoter), and a λ-Red recombinase encoding gene controlled by the TT terminator, a crRNA elongation controlled by the T7 promoter, the SuCas12a2 protein encoding gene controlled by the arabinose operon (araC), and the araBAD promoter, an AmpR selection marker, and a sacB selection marker. Specifically, the nucleotide sequence of the pTSCas-λ plasmid is shown in SEQ ID NO:3.

[0043] The pADKCas-λ plasmid includes: a SuCas12a2 protein-coding gene controlled by an arabinose promoter, a crRNA elongation controlled by a T7 promoter, a λ-Red recombinase-coding gene, and a homologous repair fragment; the λ-Red recombinase-coding gene is controlled by T7.

[0044] Furthermore, the pADKCas-λ plasmid is obtained by inserting the SuCas12a2 protein-coding gene controlled by the arabinose promoter and TT terminator, the crRNA elongation controlled by the T7 promoter, the λ-Red recombinase-coding gene controlled by T7, and the homologous repair fragment into the multiple cloning site of the pADK plasmid as a backbone.

[0045] More specifically, the inserted fragments include: a crRNA elongation controlled by the T7 promoter, an arabinose operon (araC), a SuCas12a2 protein-coding gene controlled by the araBAD promoter and the TT terminator, a homologous repair fragment, a LacI repressor protein, and a λ-Red recombinase-coding gene controlled by T7.

[0046] In a specific embodiment of the present invention, the pADKCas-λ obtained after insertion includes: a crRNA elongation controlled by the T7 promoter, an arabinose operon (araC), a SuCas12a2 protein-coding gene controlled by the araBAD promoter and the TT terminator, a homology repair fragment, a λ-Red recombinase-coding gene controlled by IPTG, pTA1060 ori (pT1060 origin), a Kana selection marker, a p15A ori, and a sacB selection marker. Specifically, the nucleotide sequence of the pADKCas-λ plasmid is shown in SEQ ID NO:4. pADKCas-λ is a shuttle plasmid of Escherichia coli and Bacillus subtilis;

[0047] In this invention, the pTSCas and pRaA dual plasmid knockout system and the pTSCas-λ single plasmid editing system can both be used for gene editing in Escherichia coli. This can be achieved using electroporation and can obtain far more transformants than Cas12a and Cas9.

[0048] The pTSCas and pRaA dual-plasmid knockout system and the pTSCas-λ single-plasmid editing system used in this invention can both be used for gene editing in Shewanella. This can be achieved using electroporation, and a considerable number of transformants can be obtained.

[0049] The pADKCas-λ used in this invention can be used for gene editing of Bacillus subtilis, and a considerable number of transformants can be obtained using chemical transformation.

[0050] In this invention, the proportion of knocked-out strains is continuously enriched over time, thus extending the culture time can increase the proportion of edited strains.

[0051] This invention provides crRNA elongators obtained by spacer-induced elongation of SuCas12a2 crRNA. These crRNA mutants acquire the ability to release accessory cleavage activities against RNA, dsDNA, and ssDNA after targeting RNA with CRISPR-Cas12a2, leading to abortion infection or dormancy in un-knockout cells. After the λ recombination system (RecET recombination system) takes effect, reverse selection of successfully recombinant edited cells significantly improves the efficiency of this recombination editing method.

[0052] This invention provides a host cell containing the microbial gene editing system described herein.

[0053] This invention provides a gene editing method, which includes editing a target gene using the gene editing system described in this invention or an extract obtained after culturing the host cell.

[0054] Specifically, the extract obtained after culturing the host cells is a plasmid from a corresponding dual-plasmid gene editing system or a single-plasmid gene editing system, and the plasmid replicates and proliferates within the host cells.

[0055] Furthermore, the induction time for SuCas12a2 expression in the gene editing system is 48 hours.

[0056] In the microbial gene editing system of the present invention, the microorganisms include: Gram-positive bacteria and / or Gram-negative bacteria.

[0057] Furthermore, the organisms mentioned include: Escherichia coli, Sivali, and / or Bacillus subtilis.

[0058] The microbial gene editing system described in this invention has the following effects:

[0059] Extending the recognition sequence of crRNA, i.e. the spacer sequence, can improve the editing efficiency of this method, and 30 bp is currently the optimal sequence length;

[0060] Extending the length of the homologous arm can also improve editing efficiency, and 1000 bp is a more appropriate homologous arm length;

[0061] The proportion of knockout strains increases over time, so extending the culture time can increase the proportion of edited strains.

[0062] The gene editing system developed in this invention screens editable cells through targeted RNA activation and abortion infection. Compared with classic Cas9 and Cas12a-related methods that kill cells by generating DBS, it has two significant advantages: First, this editing method does not directly target DNA to generate DBS and cause cell death. Instead, it achieves cell selection by targeting RNA to induce abortion infection, bypassing the inherent defects of previous editing systems. It has low cytotoxicity, can generate far more transformants than the other two Cas proteins, has a greater probability of generating edited strains, and has the potential to be used in DBS-sensitive strains, thus exhibiting better broad-spectrum applicability. Second, its screening process essentially occurs after the cells produce the target RNA, exhibiting a certain lag. This lag allows the bacterial community to produce a certain number of editable cells, enabling the editing effect to reach or exceed that of previous CRISPR editing tools.

[0063] In addition, the gene editing system of the present invention has universality and can achieve large-fragment knockout, while producing 103 to 104 times more transformants with knockout efficiency comparable to or exceeding theirs.

[0064] This invention provides a CRISPR / SuCas12a2-based editing system, comprising both dual-plasmid and single-plasmid editing systems. These systems enable gene integration and knockout in *Escherichia coli*, *Shewanella*, and *Bacillus subtilis*. The system efficiently knocks out, inserts, and replaces gene fragments of varying lengths (500 bp-10000 bp) in bacteria, and produces a significantly higher number of transformants than previous CRISPR gene editing systems. This invention represents the first implementation of a target RNA-dependent anti-selection genome editing tool that, while achieving editing efficiency comparable to or exceeding that of the classic Cas12a editing system, produces a far greater number of transformants (102). 3 ~10 4 times).

[0065] This invention explores the anti-selection potential of CRISPR-SuCas12a2 and combines it with λ recombinase to construct a highly efficient anti-selection recombination editing tool. This method enables highly efficient gene recombination editing using dual-plasmid and single-plasmid systems carrying SuCas12a2 and λ recombinase, significantly improving efficiency compared to current λ recombinase-based recombination editing methods. It also significantly improves upon previous methods that relied on the specific cleavage of target double-stranded DNA by CRISPR-Cas proteins to promote recombination editing, and offers advantages such as a higher number of transformants and a lower probability of immune escape. Plasmid construction, recombination editing, and plasmid removal can be completed within one week. These features provide a powerful tool for gene recombination editing. Attached Figure Description

[0066] Figure 1 The pBBR1 plasmid map is shown.

[0067] Figure 2 The p15A plasmid map is shown.

[0068] Figure 3 pADK plasmid map;

[0069] Figure 4 This demonstrates the principles and operational procedures of gene editing using the SURE editing system;

[0070] Figure 5 The map shows the pTSCas plasmid (pYYDT-ara-suCas12a-Bsa1) containing SuCas12a2 and crRNA;

[0071] Figure 6 This diagram illustrates the pRaA plasmid used in a dual plasmid editing system for knockout.

[0072] Figure 7This paper presents primer design methods for validating different gene editing techniques using the SURE editing system; where a represents primer design for validating gene knockout fragments; b represents primer design for validating gene substitution and insertion; and c represents primer and probe design methods for digital PCR.

[0073] Figure 8 The following figures compare the knockout efficiency and number of transformants when using different Cas proteins: a) the ratio of the number of transformants on the plate after introducing SuCas12a2 and LbCas12a and inducing protein expression, respectively; b) the ratio of the number of transformants on the plate after introducing SuCas12a2 and FrCas9 and inducing protein expression, respectively; c) the knockout efficiency of the knockout systems using FrCas9, LbCas12a, and SuCas12a2 proteins; d) the number of transformants obtained using the knockout systems using FrCas9, LbCas12a, and SuCas12a2 proteins; e) the editing efficiency of reverse selection using SuCas12a2 when λ-red recombinase is not expressed; f) the recombination editing efficiency of reverse selection using SuCas12a2 when λ-red recombinase is expressed. The crRNA targets two different positions of the target gene to exclude the influence of sequence on the editing efficiency.

[0074] Figure 9 The efficiency optimization methods and results for the SURE system are shown; where a represents the effect of crRNA spacer sequence length and induction time; b represents the effect of homologous arm length; and c represents the effect of different recombinases.

[0075] Figure 10 The efficiency optimization methods and results for the SURE system are shown; where a represents the gene loci and knockout efficiency of E. coli; b represents the efficiency of replacing the kanamycin resistance gene in the RP4 plasmid with mcherry; and c represents the efficiency for different knockout fragment lengths at the lacZ site.

[0076] Figure 11 Efficiency of replacing and inserting the lacZ gene locus in E. coli with mcherry;

[0077] Figure 12 A schematic diagram of the pTSCas-λ plasmid used for single plasmid editing is shown.

[0078] Figure 13 The diagram shows the recombination efficiency of a single plasmid system for the lacZ site in Escherichia coli by changing different inducible promoters, and a schematic diagram of the single plasmid system; where a represents the recombination efficiency; and b represents a schematic diagram of the single plasmid system.

[0079] Figure 14 A schematic diagram of the pADKCas-λ plasmid used in a single plasmid editing system is shown.

[0080] Figure 15 The gene knockout efficiency of Shewanella and Bacillus subtilis was demonstrated.

[0081] Figure 16 b shows the concentration change of ethylene glycol before and after metabolism, and the growth of edited and unedited strains when using ethylene glycol for growth. Detailed Implementation

[0082] This invention provides a CRISPR / SuCas12a2-based gene editing system and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0083] Component Description

[0084] pBBR1-oriV: Broad host-range origin of replication (orange arrow), enabling the plasmid to replicate in a variety of Gram-negative bacteria;

[0085] rep: Replication-related genes (gray arrow);

[0086] Km-R: Kanamycin resistance gene (orange arrow), used as a selection marker;

[0087] Mob: Conjugation transfer-related genes (green arrow).

[0088] Expression box element

[0089] araC: A gene that regulates the expression of arabinose operon proteins (purple arrow);

[0090] rbs: Ribosome binding sites (small white squares);

[0091] sacB: Sucrose sensitivity gene (gray arrow), often used for reverse selection;

[0092] end of terminator: Termination sub-end (marked in blue);

[0093] MCS (Multiple Cloning Site Region): Located between araC and sacB, used for inserting the target gene;

[0094] This is a pBBR1-derived broad-host-range expression plasmid with the following characteristics:

[0095] It has an arabinose-inducible promoter (araC regulation).

[0096] Contains sacB reverse selection marker (sucrose sensitive, used to assist plasmid elimination); kanamycin resistance selection;

[0097]

[0098]

[0099]

[0100]

[0101]

[0102] Nucleotide sequence encoding gam protein: atggatattaatactgaaactgagatcaagcaaaagcattcactaaccccctttcctgttttcctaatcagcccggcatttcgcgggcgatattttcacagctatttcaggagttcagccatgaacgcttattacattcaggatcgtcttgaggctcagagctgggcgcgtcactaccagcagctcgcccgtgaagagaaagaggcagaactggcagacgacatggaaaaaggcctgccccagcacctgtttgaatcgctatgcatcgatcatttgcaacgccacggggccagcaaaaaatccattacccgtgcgtttgatgacgatgttgagtttcaggagcgcatggcagaacacatccggtacatggttgaaaccattgctcaccaccaggttgatattgattcagaggtataa (SEQ ID NO: 6);

[0103] Nucleotide sequence encoding Bet protein: atgagtactgcactcgcaacgctggctgggaagctggctgaacgtgtcggcatggattctgtcgacccacaggaactgatcaccactcttcgccagacggcatttaaaggtgatgccagcgatgcgcagttcatcgcattactgatcgttgccaaccagtacggccttaatccgtggacgaaagaaatttacgcctttcctgataagcagaatggcatcgttccggtggtgggcgttgatggctggtcccgcatcatcaatgaaaaccagcagtttgatggcatggactttgagcaggacaatgaatcctgtacatgccggatttaccgcaaggaccgtaatcatccgatctgcgttaccgaatggatggatgaatgccgccgcgaaccattcaaaactcgcgaaggcagagaaatcacggggccgtggcagtcgcatcccaaacggatgttacgtcataaagccatgattcagtgtgcccgtctggccttcggatttgctggtatctatgacaaggatgaagccgagcgcattgtcgaaaatactgcatacactgcagaacgtcagccggaacgcgacatcactccggttaacgatgaaaccatgcaggagattaacactctgctgatcgccctggataaaacatgggatgacgacttattgccgctctgttcccagatatttcgccgcgacattcgtgcatcgtcagaactgacacaggccgaagcagtaaaagctcttggattcctgaaacagaaagccgcagagcagaaggtggcagcatga (SEQ ID NO:7);

[0104] Nucleotide sequence encoding the exo protein: (SEQ ID NO:8);

[0105] Table 1. Primer sequences used in the experiment

[0106]

[0107]

[0108] The bolded portions are the enzyme cleavage sites. The 5' end of lacZ500-P is modified with VIC and the 3' end with BHQ1; the 5' end of GyrA-P is modified with FAM and the 3' end with BHQ1.

[0109] Table 2. Homologous arm sequences used in the experiment

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] gRNA is the RNA guide sequence of crRNA, which specifically recognizes the target cleavage site of the target gene. In this invention, it is also the spacer sequence of crRNA.

[0120] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:

[0121] Example 1: SURE enables the editing of exogenous genes on the E. coli genome.

[0122] The SURE editing system, a dual-plasmid editing system, is used. The principles and operational procedures of gene editing using the SURE editing system are as follows: Figure 4 As shown; the SURE editing system includes the pTSCas plasmid and the pRaA plasmid;

[0123] Synthesis of pTSCas plasmid: SuCas12a2 and its corresponding crRNA from sulfur-oxidizing ε-proteobacterium Sulfuricurvum sp. were synthesized. A BsaI restriction site was designed upstream and downstream of the spacer part, respectively. After restriction, multiple target sites were rapidly replaced by designing the upper and lower polymer chains (a) 5'-AGATNNNNNNNNNNNNNNNNNNNNNNNNNNNN (N24 sense strand, N24 is the sequence corresponding to the crRNA of different target genes or the reverse complementary sequence)-3' (SEQ ID NO:69); (b) 5'-CTAGNNNNNNNNNNNNNNNNNNNNNNNNNN (N24 antisense strand, N24 is the sequence corresponding to the crRNA of different target genes or the reverse complementary sequence)-3' (SEQ ID NO:70). Figure 5 ), to obtain plasmid pYYDT-ara-suCas12a2-Bsa1 (pTSCas).

[0124] Synthesis of pRaA plasmid: Recombinases derived from λ phage (exo, bet, and gam, from the λ-Red system) are synthesized, and the homologous arm regions of the recombinant plasmid pRaA are replaced with homologous fragments (1000 bp, e.g., upstream and downstream of the target gene sequence to be edited) Figure 6 ), and obtained plasmid p15a-homological arm-lambda (pRaA).

[0125] The following study uses GFP as the target gene to investigate the effects of different Cas proteins on knockout efficiency and transformant number in a dual-plasmid system. SuCas12a2 in the pTSCas plasmid was replaced with FrCas9 or LbCas12a to obtain dual-plasmid editing systems containing different proteins.

[0126] Escherichia coli MG1655-gfp was obtained by integrating the exogenous gene gfp into the genome of MG1655. Using the exogenous gene gfp on the genome of MG1655-gfp as the target, replacement primers (SEQ ID NO: 9, 10, 11, 12) and homologous arm sequences (SEQ ID NO: 41, 42) for crRNA were designed, and pRaA-GFP plasmid and pTSCas-GFP plasmid were constructed.

[0127] The recombinant plasmid pRaA-GFP was then introduced into cells. Transformants were picked from plates, cultured, and then the pTSCas-GFP plasmid was introduced. The plasmids were then plated on plates containing inducers and antibiotics. PCR verification of the target fragment was performed by picking transformants (see verification method). Figure 7 Statistical analysis showed that its GFP editing efficiency was 100%, and the number of transformants from the dual-plasmid gene editing system containing SuCas12a2 far exceeded that of FrCas9 and LbCas12a, with a transformant fold increase of 10 compared to the other two proteins (FrCas9 and LbCas12a). 3 ~10 4 ( Figure 8 , Figure 8 In the diagram, NT represents the control containing all elements but without cleavage, with its gRNA sequence being ggagaccgagattggtctcg, SEQ ID NO:71; T-1 and T-2 represent the editing effects at different cleavage sites of the target; the gRNA of T-1 is ctgtacgtaaccttcgggcatggc (obtained by amplification from SEQ ID NO:9 and 10), SEQ ID NO:72; the gRNA of T-2 is gaaagggcagattgtgtggacagg, SEQ ID NO:73, obtained by amplification from SEQ ID NO:11 and 12).

[0128] Example 2: SURE enables the editing and optimization of endogenous genes in the E. coli genome.

[0129] Spacers (SEQ ID NO: 13, 14) and homologous arm sequences (SEQ ID NO: 43, 44) were designed for the endogenous gene lacZ in Escherichia coli according to the above method, and pRaA-GFP and pTSCas-GFP plasmids were constructed; however, only about 40% editing efficiency was achieved.

[0130] Therefore, optimizations were made for induction time (24h, 48h), crRNA length (24bp, 30bp, 35bp, 40bp) (SEQ ID NO: 13, 14, 21, 22, 23, 24, 25, 26), recombinase selection (recET and λ-Red), and homologous arm length (200bp, 400bp, 1000bp). The optimal operating conditions were obtained: 48h induction, 30bp crRNA length, 1000bp homologous arm length, and optimal recombinase selection of λ-Red. This achieved a 90% knockout efficiency for the lacZ gene site. Figure 9 )

[0131] Knockout experiments were performed on other gene loci on the genome, namely ackA, KatG, and ahpC genes (SEQ ID NO: 15, 16, 17, 18, 19, 20), with homologous arms (SEQ ID NO: 45, 46, 47, 48, 49, 50), and pRaA and pTSCas plasmids were constructed.

[0132] Then the recombinant plasmid was used, and a knockout efficiency of 30% was achieved. Figure 10 It is speculated that this editing tool requires a post-transcriptional RNA activation anti-selection process, thus exhibiting a certain dependence on RNA expression levels. Transcriptome analysis showed that the expression levels of the three genes were all lower than those of lacZ to some extent.

[0133] Example 3: SURE enables gene knock-in and substitution in the E. coli genome.

[0134] Knock-in and replacement of the mcherry gene were performed at the lacZ gene site in *E. coli*: spacer sequences (SEQ ID NO: 21, 22) of crRNA for knock-in and replacement of the endogenous gene lacZ were synthesized. The editing systems used for knock-in and replacement shared the same crRNA. The design and sequence of the homologous arms are described in [reference needed]. Figure 11 And Table 2 (SEQ ID NO: 65, 66, 67, 68). The constitutively expressed mcherry gene was inserted between the upstream and downstream homologous arms.

[0135] pRaA and pTSCas plasmids were introduced using the above method, plated on plates containing inducers and antibiotics, and the target region was verified by PCR using transformants. The knock-in efficiency was 85%, and the gene substitution efficiency was 90%. Figure 11 ).

[0136] Example 4: Replacing gene loci on the RP4 plasmid using the SURE system.

[0137] The RP4 plasmid is a widely conjugating plasmid that has attracted much attention for its efficient conjugation transfer ability and broad-spectrum host adaptability in Gram-negative bacteria. However, its large sequence length makes plasmid modification difficult. Therefore, it is of great significance to be able to modify plasmids directly in cells.

[0138] Spacer sequences (SEQ ID NO: 33, 34) and corresponding homologous arms (SEQ ID NO: 63, 64) of crRNA targeting the kanamycin resistance gene site on the RP4 plasmid were designed. The mcherry gene was inserted between the upstream and downstream homologous arms and introduced into the pRaA and pTSCas plasmids using the above method. The plasmids were plated on plates containing inducers and antibiotics, and the target region was verified by PCR using transformants. An editing efficiency of over 90% was achieved. Figure 10 (b) in the middle.

[0139] Example 5: Large-fragment knockout of the E. coli genome using the SURE system

[0140] For the lacZ site and surrounding sequences, knockout sequences of homologous arm lengths of 500 bp, 1 kb, 5 kb, and 10 kb were designed. Figure 10 (c) and maintain the same crRNA spacer (lacZ2-F and lacZ2-R) sequences, and perform gene knockout according to the above experimental procedures. Homologous arm sequences are shown in Table 2 (SEQ ID NO: 51, 52, 53, 54, 55, 56). Digital PCR was introduced to verify the knockout efficiency. Using the housekeeping gene (cyrA) as the reference gene, the primer and probe sequences (SEQ ID NO: 35, 36, 37, 38, 39, 40) were used to verify the gene knockout efficiency. The knockout efficiency for fragments of 500 bp, 1 kb, and 5 kb lengths all reached over 90%, while a knockout efficiency of 4.69% was achieved for a 10 kb gene. Figure 10 (c in the text)

[0141] Example 6: Construction of a single-plasmid editing system in Escherichia coli

[0142] To further simplify the operation process, a single-plasmid system was constructed by integrating the λ-Red gene expressed using different inducible promoters with the SuCas12a2 gene expressed using homologous arms, crRNA, and arabinose onto the pTSCas plasmid. Figure 12 The efficiency of this single-plasmid system was validated at the lacZ site in E. coli. By changing different inducible promoters, the editing efficiency of this system was restored to a level comparable to that of the two-plasmid system. Figure 13 ).

[0143] Example 7 Gene knockout of Shewanella and Bacillus subtilis using single plasmid editing

[0144] To further simplify the operation process, we started the λ-Red gene using the IPTG inducible promoter and integrated it along with its homologous arm into the pTSCas plasmid, constructing the pADKCas-λ single-plasmid editing system. Figure 14 This system was transferred to the Escherichia coli-Bacillus subtilis shuttle plasmid pADK, constructing a single-plasmid knockout system crRNA (SEQ ID NO: 27, 28, 29, 30, 31, 32) and homologous arm sequences (SEQ ID NO: 57, 58, 59, 60, 61, 62) targeting the Gram-positive bacterium Bacillus subtilis. This single-plasmid system was introduced into Shewanella and Bacillus subtilis respectively and induced to express. Single colonies were selected for PCR verification and counting of the knockout sites. Knockout efficiencies of 100% and 91.6% were achieved for the cymA and omcA genes in Shewanella, respectively, and 100% for the rocA gene in Bacillus subtilis. Figure 15 ).

[0145] Example 8: Construction of Escherichia coli using ethylene glycol as the sole carbon source via SURE

[0146] Using SURE, an E. coli strain with ethylene glycol as its sole carbon source was constructed by introducing the NAD-dependent ethylene glycol dehydrogenase gene etgB into the genome of E. coli. Ethylene glycol degradation experiments verified the high efficiency of this strain in degrading ethylene glycol. Figure 16 ).

[0147] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A gene editing system based on CRISPR / SuCas12a2, characterized in that, include: The SuCas12a2 protein-coding gene controlled by the arabinose promoter, the crRNA elongation controlled by the T7 promoter, the λ-Red recombinase-coding gene, and the homologous repair fragment; The length of the RNA-guided sequence in the crRNA elongation is 29bp~31bp; The homologous repair fragment includes: upstream fragment of the target gene - downstream fragment of the target gene; or, upstream fragment of the target gene - insertion sequence - downstream fragment of the target gene; The inserted fragment is used to replace and / or mutate the target gene.

2. The gene editing system according to claim 1, characterized in that, The promoter of the λ-Red recombinase is selected from the J23119 promoter, the arabinose promoter, or the T7 promoter.

3. The gene editing system according to claim 1, characterized in that, The length of the upstream fragment and / or downstream fragment of the target gene is 500~1500bp.

4. The gene editing system according to claim 3, characterized in that, The nucleotide sequence of the gene encoding the SuCas12a2 protein is shown in SEQ ID NO:5; The λ-Red recombinase includes gam protein, Bet protein, and exo protein; The nucleotide sequence encoding the gam protein is shown in SEQ ID NO:6; The nucleotide sequence encoding the Bet protein is shown in SEQ ID NO:7; The nucleotide sequence encoding the exo protein is shown in SEQ ID NO:

8.

5. The gene editing system according to claim 4, characterized in that, The gene editing system also includes a replication initiation site and / or selection markers.

6. The gene editing system according to claim 5, characterized in that, The initiation site is selected from P15A-ori, pBBR1-oriV and / or pTA1060 ori.

7. The gene editing system according to claim 5, characterized in that, The selection markers are selected from one or more of the following: AmpR, KanR, CmR, leu2, and / or sacB.

8. A host cell, characterized in that, The system comprises the gene editing system according to any one of claims 1 to 7.

9. A method for gene editing, characterized in that, This includes editing the target gene using the gene editing system according to any one of claims 1 to 7 or an extract obtained after culturing the host cell.

10. The method according to claim 9, characterized in that, The induction time for SuCas12a2 expression in the gene editing system was 48 hours.