Live attenuated SARS-CoV-2 vaccine
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY DEPARTMENT OF HEALTH & HUMAN SERVICES
- Filing Date
- 2023-06-02
- Publication Date
- 2026-06-05
AI Technical Summary
Current COVID-19 vaccines face challenges such as waning immunity over time, complex storage requirements, and limited mucosal immunity, making them less effective against emerging variants and difficult to distribute globally.
Development of engineered SARS-CoV-2 variants with attenuating mutations, specifically a recombinant genome with a deleted polybasic site in the spike protein and modified non-structural protein 1, which are used to create a live attenuated vaccine (LAV) capable of infecting mammalian cells and replicating while being attenuated to prevent severe disease.
The attenuated SARS-CoV-2 vaccine elicits strong humoral and cellular immune responses, provides durable protection against SARS-CoV-2, including variants, and is easier to store and distribute, offering a safer and more effective alternative to existing vaccines.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
Technical Field
[0001] Cross - References to Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 348,850, filed on June 3, 2022, which is hereby incorporated by reference in its entirety.
[0002] Field The present disclosure relates to a modified SARS - CoV - 2 containing a combination of attenuating mutations and the use of the modified SARS - CoV - 2 as an attenuated live vaccine.
[0003] Incorporation of Electronic Sequence Listing The electronic sequence listing filed herewith on May 25, 2023, as XML file named 9531 - 108350 - 02.xml (72,759 bytes), is hereby incorporated by reference in its entirety.
Background Art
[0004] Background The rapid development of multiple vaccines has provided a powerful means to halt the COVID-19 pandemic. Among the 10 vaccines authorized for emergency use by the World Health Organization (WHO), 7 of them, including the mRNA vaccines from Pfizer and Moderna, 3 adenovirus vector-based vaccines (AstraZeneca / Oxford, AstraZeneca / Serum Institute of India, J&J), and 2 protein-based vaccines (Novavax and Covovax including the Novavax formulation) express the SARS-CoV-2 spike protein as an immunogen. The other 3 inactivated whole-virus vaccines (SinoPharm, Sinovac, and Bharat Biotech) are less immunogenic in inducing neutralizing antibodies. In particular, the effectiveness of current vaccines in preventing symptomatic infections against emerging variants of concern drops significantly beyond 6 months. Severe storage conditions and requirements for medical supplies to administer the vaccines are imposing further constraints on the global distribution of some vaccines. For these reasons, there is a need for new vaccines that are potent, broadly protective, elicit durable immunity, and are also easy to administer, store, and transport.
[0005] Live attenuated virus vaccines (LAVs) utilize live but weakened viruses as immunogens. There are many examples of effective LAVs, including measles, mumps and rubella vaccines, oral polio vaccines, yellow fever virus vaccines, varicella vaccines, herpes zoster vaccines, and one type of influenza virus vaccine. LAVs cause an infection that is a real but mostly asymptomatic infection in vaccine recipients and thus usually elicit both humoral and cellular immune responses. Furthermore, intranasally administered LAVs may be more effective not only in avoiding needle prick but also in eliciting mucosal immunity. The latter is particularly desirable for the prevention of COVID-19 because the human upper respiratory tract tends not to be well protected by currently available intramuscular vaccines. One obstacle to the development of LAVs against SARS-CoV-2 is the safety of the vaccine virus. Multilayered attenuation of pathogenicity is expected to ensure that the LAV does not revert to virulence.
Summary of the Invention
Means for Solving the Problems
[0006] Abstract Engineered SARS-CoV-2 variants having combinations of attenuation modifications and their use as live attenuated vaccines (LAVs) are described herein.
[0007] Attenuated SARS-CoV-2 variants having a recombinant genome are provided herein. The recombinant genome encodes a modified spike (S) protein having a deletion of a polybasic site (ΔPRRA) and encodes a modified non-structural protein 1 (Nsp1) having K164A and H165A substitutions. The recombinant genome also includes mutations that prevent the expression of open reading frames (ORFs) 6, 7a, 7b, and 8 (such as deletions of ORFs 6, 7a, 7b, and 8). The disclosed attenuated SARS-CoV-2 retains the ability to infect mammalian cells and replicate therein. In some embodiments, the attenuated SARS-CoV-2 is the SARS-CoV-2 Wuhan strain or a variant thereof derived from the alpha, beta, delta, gamma, epsilon, eta, iota, kappa, mu, zeta, or omicron lineages. In some examples, the variant is a variant of concern (VOC) such as a VOC derived from the delta or omicron lineages.
[0008] Also provided herein are immunogenic compositions comprising the attenuated SARS-CoV-2 disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition further comprises an adjuvant. In some embodiments, the immunogenic composition is formulated for nasal administration.
[0009] Further provided is a nucleic acid molecule comprising a complement of the recombinant genome of the attenuated SARS-CoV-2.
[0010] Also provided is a collection of reverse genetics plasmids comprising a complement of the recombinant SARS-CoV-2 genome. Further provided is a method for producing attenuated SARS-CoV-2, comprising: transfecting a permissive cell with the collection of reverse genetics plasmids; culturing the transfected cell under conditions sufficient to permit replication of the attenuated SARS-CoV-2; and isolating the attenuated SARS-CoV-2 from the cell culture. Also provided is the attenuated SARS-CoV-2 produced by the disclosed method.
[0011] Further provided are methods of eliciting an immune response against SARS-CoV-2 in a subject. In some embodiments, the method comprises administering to the subject an effective amount of an attenuated live SARS-CoV-2 or immunogenic composition disclosed herein. In some examples, the attenuated live SARS-CoV-2 or immunogenic composition is administered intranasally. The attenuated live SARS-CoV-2 or immunogenic composition can also be used as part of a prime-boost immunization protocol. In some examples, the attenuated live SARS-CoV-2 or immunogenic composition is used as both a prime and a boost. In other examples, the attenuated live SARS-CoV-2 or immunogenic composition is used in combination with a second SARS-CoV-2 vaccine.
[0012] The foregoing and other features of the disclosure will become more apparent from the following detailed description of some embodiments taken in conjunction with the reference to the accompanying drawings.
Brief Description of the Drawings
[0013]
Figure 1-1
Figure 1-2
Figure 1-3
[0014]
Figure 2-1
Figure 2-2
Figure 2-3
Figure 2-4
Figure 2-5
Figure 2-6
Figure 2-7
[0015]
Figure 3-1
Figure 3-2
Figure 3-3
Figure 3-4
[0016]
Figure 4-1
Figure 4-2
Figure 4-3
[0017]
Figure 5
[0018]
Figure 6-1
Figure 6-2
Figure 6-3
[0019]
Figure 7
[0020]
Figure 8
[0021]
Figure 9
[0022]
Figure 10
[0023]
Figure 11
[0024]
Figure 12
[0025]
Figure 13-1
Figure 13-2
[0026]
Figure 14-1
Figure 14-2
Figure 14-3
[0027]
Figure 15-1
Figure 15-2
Figure 15-3
[0028]
Figure 16-1
Figure 16-2
[0029]
Figure 17-1
Figure 17-2
Figure 17-3
Figure 17-4
[0030]
Figure 18
[0031]
Figure 19-1
Figure 19-2
[0032]
Figure 20-1
Figure 20-2
Figure 20-3
[0033]
Figure 21-1
Figure 21-2
Figure 21-3
Figure 21-4
[0034]
Figure 22-1
Figure 22-2
[0035]
Figure 23
Mode for Carrying Out the Invention
[0036] Sequence Listing The nucleic acid and amino acid sequences listed in the attached Sequence Listing are shown using standard letter abbreviations for nucleotide bases and the three-letter codes for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but any reference to the shown strand is understood to include the complementary strand. In the attached Sequence Listing.
[0037] SEQ ID NO: 1 is the complete genomic sequence of the Wuhan strain of SARS-CoV-2 (SARS-CoV-2 / Human / USA / WA-CDC-WA1 / 2020, deposited under GENBANK™ accession number MN985325.1).
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
Chem.
[0038] SEQ ID NO: 2 is the amino acid sequence of the wild-type spike protein derived from SARS-CoV-2 WA1 / 2020. The polybasic insert (PRRA) is underlined.
Chem.
[0039] Sequence number 3 is an exemplary amino acid sequence of a modified SARS-CoV-2 spike protein having a deletion of the polybasic insert (ΔPRRA).
Chemical formula
Chemical formula
[0040] Sequence number 4 is the amino acid sequence of wild-type Nsp1 derived from SARS-CoV-2 WA1 / 2020.
Chemical formula
[0041] Sequence number 5 is an exemplary amino acid sequence of a modified SARS-CoV-2 Nsp1 having K164A and H165A substitutions (underlined).
Chemical formula
[0042] Sequence numbers 6 to 32 are primer sequences (see Example 1).
[0043] Sequence number 33 is a nucleic acid fragment of the SARS-CoV-2 Nsp1 coding sequence (see Figure 1C).
[0044] Detailed description I. Abbreviations BALF Bronchoalveolar lavage fluid COVID-19 Coronavirus disease 2019 DPC Days post-challenge DPE Days post-exposure DPI Days post-infection ELISA Enzyme-linked immunosorbent assay FFU Focus-forming assay FFPE Formalin-fixed paraffin-embedded FFU Focus forming unit FRNT 50 50% focus reduction neutralizing titer hACE2 Human angiotensin-converting enzyme 2 HE Hematoxylin and eosin IFN Interferon ISH In situ hybridization LAV Live attenuated virus MOI Multiplicity of infection MPE Months post-exposure nAb Neutralizing antibody NP Nucleocapsid protein NW Nasal wash ORF Open reading frame PFA Paraformaldehyde PFU Plaque forming unit ProSPC Prosurfactant protein C RBD Receptor binding domain RT Room temperature SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 sgRNA Subgenomic RNA TCID 50 50% tissue culture infective dose TLR Toll-like receptor VOC Variant of concern II. Glossary summary
[0045] Unless otherwise indicated, technical terms are used according to their conventional usage. Definitions of many common terms in molecular biology can be found in Krebs et al. (eds.), Lewin's genes XII, published by Jones & Bartlett Learning, 2017. As used herein, the singular forms "a," "an," and "the" refer to both the singular and plural forms unless the context clearly indicates otherwise. For example, the term "an antigen" can be considered to include one or more antigens and is equivalent to the phrase "at least one antigen." As used herein, the term "comprises" means "includes." Any and all base sizes or amino acid sizes, and all molecular weights or molecular mass values given for a nucleic acid or polypeptide are approximate and are to be further understood as being provided for description purposes only unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particular preferred methods and materials are described herein. In case of conflict, the present specification, including explanations of terms, will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting. To facilitate a general understanding of the various aspects, explanations of the following terms are provided.
[0046] Adjuvant: A component of an immunogenic composition used to enhance antigenicity. In some embodiments, the adjuvant is a suspension of a mineral (such as alum, aluminum hydroxide, or phosphate) to which the antigen adsorbs; or may contain, for example, heat-killed mycobacteria (such as Freund's complete adjuvant) to further enhance antigenicity (inhibit antigen degradation and / or cause influx of macrophages), or an oil-in-water emulsion (such as Freund's incomplete adjuvant) in which the antigen solution is emulsified in mineral oil. In some embodiments, the adjuvant used in the disclosed immunogenic compositions is a combination of lecithin and a carbomer homopolymer (such as ADJUPLEX™ adjuvant available from Advanced BioAdjuvants, LLC; see also Wegmann, Clin Vaccine Immunol 22(9): 1004-1012, 2015). Further adjuvants for use in the disclosed immunogenic compositions include QS21 purified plant extract, Matrix M, AS01, MF59, and the ALFQ adjuvant. Immunostimulatory oligonucleotides (such as those containing CpG motifs) can also be used as adjuvants. Adjuvants include biomolecules ("biological adjuvants") such as costimulatory molecules. Exemplary biological adjuvants include toll-like receptor (TLR) agonists such as IL-2, RANTES, GM-CSF, TNF-α, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L, 4-1BBL, and TLR-9 agonists. Those skilled in the art are familiar with adjuvants (see, for example, Singh (ed.) Vaccine Adjuvants and Delivery Systems. Wiley-Interscience, 2007).
[0047] Administration: To provide or give an agent, such as an immunogenic composition provided herein, to a subject by any effective route. Exemplary routes of administration include, but are not limited to, intranasal, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, and intratumoral), sublingual, rectal, transdermal, vaginal, and inhalation routes.
[0048] Attenuated virus: A virus with reduced pathogenicity compared to a reference virus under similar infection conditions. Attenuation is usually associated with reduced viral replication compared to the replication of a reference wild-type virus under similar infection conditions. In some hosts (typically non-natural hosts including laboratory animals), the disease may not be apparent during infection with the reference virus in question, and the restriction of viral replication can be used as a surrogate marker for attenuation. In some embodiments, the disclosed attenuated SARS-CoV-2 exhibits a reduction in viral titer in the upper or lower respiratory tract of a mammal, such as at most about one-tenth or less, for example, at most about one-twentieth, one-fortieth, one-sixtieth, one-eightieth, or one-hundredth or less, compared to the titer of the non-attenuated wild-type virus in the upper or lower respiratory tract of the same species of mammal under the same infection conditions.
[0049] Codon-optimized: A nucleic acid sequence in which the codons have been changed to be optimal for expression in a particular system (such as a particular species or group of species). For example, a nucleic acid sequence can be optimized for expression in mammalian cells or a particular mammalian species (such as human cells). Codon optimization does not change the amino acid sequence of the encoded protein.
[0050] Conserved variant: A protein containing a conservative amino acid substitution that does not substantially affect and does not reduce the function of a protein such as a coronavirus spike protein. A "conservative" amino acid substitution is a substitution that does not substantially affect and does not reduce the function of a protein, such as the ability of the protein to elicit an immune response when administered to a subject. The term conserved variant also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid. Further, individual substitutions, deletions or additions that change, add or delete a single amino acid or a small percentage of amino acids (e.g., less than 5%, in some embodiments less than 1%) in the encoded sequence are conserved changes if the change results in a substitution of the amino acid with a chemically similar amino acid.
[0051] The following six groups are examples of amino acids that are considered to be conservative substitutions for each other: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0052] A non-conservative substitution is one that reduces the activity or function of a protein, such as the ability to elicit an immune response when administered to a subject. For example, if an amino acid residue is essential for the function of a protein, even a conservative substitution can disrupt its activity. Thus, conservative substitutions do not alter the basic function of the protein of interest.
[0053] Coronavirus: A large family of single-stranded RNA viruses of the order Nidovirales that can infect humans and non-human animals. Coronaviruses derive their name from the crown-like spikes on their surface. The viral envelope is composed of a lipid bilayer containing the viral membrane (M), envelope (E), and spike (S) proteins. Many coronaviruses cause mild to moderate upper respiratory tract diseases such as the common cold. However, three coronaviruses have emerged that can cause more severe disease and death: Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), SARS-CoV-2 (Alpha (B.1.1.7 and Q lineages); Beta (B.1.351 and derived lineages); Delta (B.1.617.2 and AY lineages); Gamma (P.1 and derived lineages); Epsilon (B.1.427 and B.1.429); Eta (B.1.525); Iota (B.1.526); Kappa (B.1.617.1); 1.617.3; Mu (B.1.621, B.1.621.1), Zeta (P.2) and Omicron (BA.1.1.529, BA.1, BA.1.1, BA.2, BA.3, BA.4 and BA.5) etc. of its variants), as well as Middle East Respiratory Syndrome Coronavirus (MERS-CoV). Other coronaviruses that infect humans include Human Coronavirus HKU1 (HKU1-CoV), Human Coronavirus OC43 (OC43-CoV), Human Coronavirus 229E (229E-CoV), and Human Coronavirus NL63 (NL63-CoV).
[0054] COVID-19: The disease caused by the coronavirus SARS-CoV-2.
[0055] Degenerate variant: A polynucleotide encoding a polypeptide that contains a sequence that is degenerate as a result of the genetic code. Twenty natural amino acids exist, many of which are specified by more than one codon. Thus, all degenerate nucleotide sequences are included as long as the amino acid sequence of the polypeptide does not change.
[0056] Effective amount: The amount of an agent (such as an attenuated live SARS-CoV-2) that is sufficient to elicit a desired response, such as an immune response, in a subject. A "therapeutically effective amount" may be the amount necessary to inhibit SARS-CoV-2 replication or to treat COVID-19 in a subject having an ongoing SARS-CoV-2 infection. A "prophylactically effective amount" refers to the amount of an agent or composition necessary to inhibit or prevent the establishment of an infection, such as an infection by SARS-CoV-2. Obtaining a protective immune response against SARS-CoV-2 may require multiple administrations of the disclosed immunogen (e.g., attenuated live SARS-CoV-2), and / or administration of the disclosed immunogen (such as a second SARS-CoV-2 vaccine) as a "prime" in a prime-boost protocol where the boost immunogen may be different from the prime immunogen. Alternatively, the disclosed immunogen may be administered as a boost dose after a prime dose of a different SARS-CoV-2 vaccine. Thus, an effective amount of the disclosed immunogen may be an amount of immunogen sufficient to elicit a priming immune response in a subject, followed by boosting with the same or a different immunogen to elicit a protective immune response. Similarly, an effective amount of the disclosed immunogen may be an amount of immunogen sufficient to elicit a protective immune response when administered after priming immunization.
[0057] In one example, the desired response is to elicit an immune response that inhibits or prevents SARS-CoV-2 infection. SARS-CoV-2 infected cells need not be completely eliminated, nor need they be precluded for an effective composition. For example, administration of an effective amount of an immunogen or immunogenic composition can elicit an immune response (removal or prevention of detectable SARS-CoV-2 infected cells) that reduces (or prevents infection of cells) the number of SARS-CoV-2 infected cells by a desired amount, such as at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100%, compared to the number of SARS-CoV-2 infected cells in the absence of immunization or other suitable control.
[0058] Heterologous: originating from different genetic sources. A heterologous gene contained in a recombinant genome is a gene that does not originate from that genome.
[0059] Host cell: A cell capable of propagating a vector and in which its nucleic acid is expressed. The cell may be a prokaryotic or eukaryotic cell. This term also includes any progeny of the subject host cell. It is understood that, due to mutations that may occur during replication, all progeny may not be identical to the parental cell. However, when the term "host cell" is used, such progeny are included.
[0060] Immune response: The response of cells of the immune system, such as B cells, T cells, or monocytes, to a stimulant. In some embodiments, the response is specific to a particular antigen, such as SARS-CoV-2 or a SARS-CoV-2 protein ("antigen-specific response"). In some embodiments, the immune response is a T cell response, such as a CD4+ response or a CD8+ response. In other embodiments, the response is a B cell response, resulting in the production of specific antibodies. "Priming an immune response" refers to the treatment of a subject with a "prime" immunogen / immunogenic composition to induce an immune response that is subsequently "boosted" with a boost immunogen / immunogenic composition. Collectively, prime and boost immunization result in a desired immune response in the subject.
[0061] Immunization: Making a subject protected from infection by a specific infectious agent, such as SARS-CoV-2. Immunization does not require 100% protection. In some examples, immunization provides at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% protection against infection compared to infection in the absence of immunization.
[0062] Immunogenic composition: A composition containing an immunogen (such as attenuated live SARS-CoV-2) or a nucleic acid molecule or vector encoding an immunogen that, when administered to a subject, elicits a measurable CTL response against the immunogen and / or a measurable B cell response (such as antibody production) against the immunogen. It further refers to an isolated nucleic acid encoding an immunogen, such as a nucleic acid that can be used to express the immunogen (and thus can be used to elicit an immune response against this immunogen). For in vivo use, the immunogenic composition may contain the immunogen in a pharmaceutically acceptable carrier and may also contain other agents such as adjuvants.
[0063] Isolated: An "isolated" biological component is substantially separated or purified from other biological components, such as other chromosomal and extrachromosomal DNA, RNA, and proteins, from which the component occurs. "Isolated" proteins, peptides, nucleic acid molecules, and viruses include those purified by standard purification methods. Isolated does not require absolute purity and may include proteins, peptides, nucleic acids, or virus molecules that are at least 50% isolated, such as at least 75%, 80%, 90%, 95%, 98%, 99%, or even 99.9% isolated.
[0064] Neutralizing antibody (nAb): An antibody that binds to a specific antigen on an infectious agent, such as a virus (e.g., coronavirus), and reduces the infectivity titer of the infectious agent. In some embodiments, an antibody specific for SARS-CoV-2 or its protein (such as the spike protein) neutralizes the infectivity titer of SARS-CoV-2. For example, an antibody that neutralizes SARS-CoV-2 can bind directly to it and inhibit the virus by restricting entry into cells. Alternatively, a neutralizing antibody may inhibit one or more post-binding interactions between a pathogen and a receptor, for example, by inhibiting virus entry using a receptor. In some embodiments, a SARS-CoV-2 neutralizing antibody inhibits SARS-CoV-2 infection of cells by, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% compared to a control antibody.
[0065] Nucleic acid molecule: A nucleic acid molecule is a polymer form of nucleotides that may include RNA, cDNA, genomic DNA, as well as both the sense and antisense strands of the above synthetic forms and hybrid polymers. Nucleotides refer to ribonucleotides, deoxynucleotides, or modified forms of either type of nucleotide. As used herein, the term "nucleic acid molecule" is synonymous with "polynucleotide". Unless otherwise specified, a nucleic acid molecule is typically at least 10 bases in length. This term includes DNA in single-stranded and double-stranded forms. A nucleic acid molecule may include either or both naturally occurring nucleotides and modified nucleotides joined to each other by naturally occurring and / or non-naturally occurring nucleotide linkages.
[0066] Operably linked: A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked nucleic acid sequences are contiguous and, where it is necessary to join two protein-coding regions, are in the same reading frame.
[0067] Permissive cells: Cells that can be infected by a virus (such as SARS-CoV-2) and can replicate in the cells, and the virus can have productive infection. Non-limiting examples of cells that are permissive for SARS-CoV-2 include Vero cells, BGMK cells, CV-1 cells, LLC-MK2 cells, A549 cells, RhMK cells, and HeLa cells (see, for example, Wang et al., Emerg Infect Dis 27(5):1380-1392, 2021).
[0068] Pharmaceutically acceptable carrier: Useful pharmaceutically acceptable carriers are conventional ones. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition, 1995 describes compositions and formulations suitable for the pharmaceutical delivery of the disclosed immunogens (such as attenuated live SARS-CoV-2) and immunogenic compositions.
[0069] Generally, the nature of the carrier will depend on the particular mode of administration used. For example, parenteral formulations usually include injectable liquids containing, as a vehicle, water, saline, balanced salt solutions, aqueous dextrose, glycerol, or other pharmaceutically and physiologically acceptable liquids. For solid compositions (e.g., powder, pill, tablet, or capsule form), conventional non-toxic solid carriers may include, for example, pharmaceutical grade mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical compositions administered may contain small amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents, such as sodium acetate or sorbitan monolaurate. In certain embodiments suitable for administration to a subject, the carrier is suspended in or otherwise contained within a unit dosage form containing a sterile and / or one or more fixed dosages of a composition suitable for eliciting the desired anti-SARS-CoV-2 immune response. It may be accompanied by agents for its use for treatment purposes. The unit dosage form may be, for example, in a sealed vial containing a sterile content or syringe for injection into the subject, or lyophilized for subsequent solubilization and administration, or in solid or controlled release dosages.
[0070] Prevention, treatment, or amelioration of a disease: "Prevention" of a disease refers to inhibiting the full development of the disease. "Treatment" refers to therapeutic intervention that improves the signs or symptoms of a disease or medical condition after the disease has begun to occur, such as a reduction in the viral load. "Amelioration" refers to a reduction in the number or severity of signs or symptoms of a disease such as coronavirus infection.
[0071] Prime-boost immunization: An immunization protocol that involves administration of a first immunogenic composition (prime immunization) to a subject, followed by administration of a second immunogenic composition (boost immunization), to induce a desired immune response. Suitable time intervals between prime and boost administrations, and examples of such time frames, are disclosed herein. In some embodiments, the prime, the boost, or both the prime and the boost further comprise an adjuvant. In some examples, the immunogenic compositions used for prime and boost are the same. In other examples, different immunogenic compositions are used for prime and boost doses.
[0072] Recombinant: A recombinant nucleic acid molecule, protein or virus is typically one produced by recombinant DNA methods from cloned cDNA. The cDNA sequence may be identical to that of a molecule from an organism or may contain sequences not found in nature: for example, it may have a sequence that contains one or more nucleic acid substitutions, deletions or insertions, and / or is made by the artificial combination of two otherwise separated segments of the sequence, and this artificial combination can be achieved, for example, by chemical synthesis, targeted mutagenesis of a naturally occurring nucleic acid molecule or protein, or by artificial manipulation of isolated segments of nucleic acid, for example by genetic engineering techniques.
[0073] Reverse genetics plasmid: A plasmid containing cDNA corresponding to an RNA virus genome or a fragment of its genome. As described in Example 1, reverse genetics plasmids containing fragments of the SARS-CoV-2 genome can be used to introduce specific mutations into one or more viral genes to generate modified infectious SARS-CoV-2 (see, for example, Xie et al., Cell Host Microbe 27:841-848 e843, 2020; Xie et al., Nat Protoc 16:1761-1784, 2021, which describe the 7-plasmid system used herein). Other SARS-CoV-2 reverse genetics plasmids have been previously described and can be used to generate the attenuated SARS-CoV-2 described herein (see, for example, Melade et al., EMBO Rep 23:e53820, 2022; Rihn et al., PLoS Biol 19(2):e3001091, 2021; Torii et al., Cell Rep 35:109014, 2021).
[0074] Sequence identity: The similarity between amino acid or nucleotide sequences is expressed in terms of the similarity between the sequences and is otherwise referred to as sequence identity. Sequence identity is often measured in units of percentage identity; the higher the percentage, the more similar the two sequences are. Homologs, orthologs, or variants of a polypeptide or polynucleotide will have a relatively high degree of sequence identity when aligned using standard methods.
[0075] Methods for aligning arrays for comparison are known. Various programs and alignment algorithms are described in Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. In the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, which present detailed considerations of sequence alignment methods and homology calculations.
[0076] Variants of a polypeptide or nucleic acid sequence typically have at least about 75%, such as at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, as counted over the full-length alignment with the amino acid or nucleotide sequence of interest. Sequences having even higher similarity to the reference sequence will, when evaluated by this method, exhibit high percentage identities such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When sequences smaller than the full-length are compared for sequence identity, homologs and variants typically have at least 80% sequence identity over a short window of 10-20 amino acids (or 30-60 nucleotides) and may have at least 85% or at least 90% or 95% sequence identity depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available on the NCBI website on the Internet.
[0077] As used herein, reference to "at least 90% identity" (or similar terms) refers to "at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity" to a particular reference sequence.
[0078] SARS-CoV-2: A coronavirus of the genus Betacoronavirus that first emerged in humans in 2019. This virus is also known as the Wuhan coronavirus, 2019-nCoV, or novel coronavirus 2019. The term "SARS-CoV-2" includes, but is not limited to, its variants such as Alpha (B.1.1.7 and Q lineages); Beta (B.1.351 and derived lineages); Delta (B.1.617.2 and AY lineages); Gamma (P.1 and derived lineages); Epsilon (B.1.427 and B.1.429); Eta (B.1.525); Iota (B.1.526); Kappa (B.1.617.1); 1.617.3; Mu (B.1.621, B.1.621.1), Zeta (P.2) and Omicron (B.1.1.529 and BA lineages). Symptoms of SARS-CoV-2 infection include fever, chills, dry cough, shortness of breath, fatigue, muscle / body aches, headache, new loss of taste or smell, sore throat, nausea or vomiting, and diarrhea. Severe cases can result in pneumonia, multiple organ failure, and death. The time from exposure to symptom onset is about 2 - 14 days. The SARS-CoV-2 virion contains a viral envelope with large spike glycoproteins. The SARS-CoV-2 genome has a common genomic organization, like many coronaviruses, containing a replicase gene in the 2 / 3 of the 5' side of the genome and structural genes in the 1 / 3 of the 3' side of the genome. The SARS-CoV-2 genome encodes a standard set of structural protein genes in the order of 5'-Spike (S)-Envelope (E)-Membrane (M) and Nucleocapsid (N)-3'. The suspected variants of concern (VOC) of SARS-CoV-2 refer to SARS-CoV-2 variants associated with increased transmissibility, more severe disease (such as increased hospitalizations or deaths), significant reduction in neutralization by antibodies generated during previous infection or vaccination, reduced effectiveness of treatments or vaccines, and / or failure of diagnostic detection (see cdc.gov / coronavirus / 2019-ncov / variants / variant-classifications).
[0079] SARS Spike (S) Protein: A class I fusion glycoprotein first synthesized as a precursor protein of approximately 1256 amino acids for SARS-CoV and 1273 amino acids for SARS-CoV-2. Individual precursor S polypeptides form homotrimers and undergo glycosylation within the Golgi apparatus, processing to remove the signal peptide, and cleavage by cellular proteases between approximately position 679 / 680 for SARS-CoV and 685 / 686 for SARS-CoV-2 to generate separate S1 and S2 polypeptide chains, remaining bound as S1 / S2 protomers within the homotrimer, thereby forming a heterodimeric trimer. The S1 subunit is distal to the viral membrane and contains a receptor-binding domain (RBD) thought to mediate the virus's attachment to the host receptor of the virus. The S2 subunit contains elements of the fusion protein machinery, such as a fusion peptide. S2 also includes two heptad repeat sequences (HR1 and HR2), as well as a central helix, transmembrane domain, and cytoplasmic tail domain typical of fusion glycoproteins.
[0080] Subject: A category including both human and veterinary subjects, living multicellular vertebrates, including humans and non-human mammals such as birds, pigs, mice, rats, rabbits, sheep, horses, cows, dogs, cats, and non-human primates. In some embodiments, the subject is a human. In some examples, a subject in need of inhibiting or preventing SARS-CoV-2 infection is selected. For example, the subject may be uninfected and may be at risk of SARS-CoV-2 infection.
[0081] Under conditions sufficient for ~: A phrase used to describe any environment that enables the desired activity.
[0082] Unit dosage form: Each unit is a physically distinct unit, such as a capsule, tablet, or solution, suitable as a single dosage for a human patient, containing a predetermined amount of one or more active ingredients (such as attenuated live SARS-CoV-2) calculated to produce a therapeutic effect, together with at least one pharmaceutically acceptable diluent or carrier, or a combination thereof.
[0083] Vaccine: A pharmaceutical composition that elicits a prophylactic or therapeutic immune response in a subject. In some cases, the immune response is a defensive immune response. Typically, a vaccine elicits an antigen-specific immune response against an antigen of a pathogen, such as a viral pathogen, or against a cellular component correlated with a disease state. A vaccine may include a virus (such as an attenuated and / or recombinant virus), a polynucleotide (such as a nucleic acid encoding the disclosed antigen), a peptide or polypeptide (such as the disclosed antigen), a cell, or one or more cellular components. In one particular non-limiting example, the vaccine reduces the severity of symptoms associated with SARS-CoV-2 infection and / or reduces the viral load, as compared to a control. In another non-limiting example, the vaccine reduces SARS-CoV-2 infection and / or transmission, as compared to a control. An attenuated live vaccine (LAV) refers to a vaccine that includes a recombinant virus containing one or more modifications that attenuate the virus (such as mutations that reduce viral replication and / or render the virus less able to cause disease). In the context of the present disclosure, attenuated live SARS-CoV-2 is a modified form of SARS-CoV-2 that can still infect and replicate in mammalian cells but includes a combination of modifications that attenuate the virus.
[0084] Vector: An entity containing a DNA or RNA molecule carrying a promoter operably linked to a coding sequence of a protein of interest (such as an immunogenic protein) and capable of expressing the coding sequence. Non-limiting examples include naked or packaged (lipid and / or protein) DNA, naked or packaged RNA, subcomponents of viruses or bacteria or other microorganisms that may or may not have replication ability, or viruses or bacteria or other microorganisms that may have replication ability. Vectors are sometimes referred to as constructs. A recombinant DNA vector is a vector having recombinant DNA. A vector may contain nucleic acid sequences that enable its replication in a host cell, such as an origin of replication. A vector may also contain one or more selectable marker genes and other genetic elements. A viral vector is a recombinant nucleic acid vector having at least some nucleic acid sequences derived from one or more viruses. Non-limiting examples of viral vectors include adenoviral vectors, adeno-associated virus (AAV) vectors, and poxvirus vectors (e.g., vaccinia, fowlpox). III. Attenuated SARS-CoV-2
[0085] Engineered SARS-CoV-2 variants having combinations of attenuation modifications, and their use as attenuated SARS-CoV-2 vaccines are described herein. The recombinant genome of the attenuated SARS-CoV-2 encodes a modified spike (S) protein having a deletion of a polybasic site (ΔPRRA) and encodes a modified non-structural protein 1 (Nsp1) having K164A and H165A substitutions. This recombinant genome also includes mutations (such as deletions) that prevent the expression of open reading frames (ORFs) 6, 7a, 7b, and 8. The disclosed attenuated SARS-CoV-2 is capable of infecting mammalian cells and retaining the ability to replicate therein.
[0086] Removal of the polybasic site (PRRA) reduces the ability of SARS-CoV-2 to infect the lungs. The non-structural protein 1 (Nsp1) and accessory proteins encoded by ORF6, 7a, 7b and 8 are potent interferon (IFN) antagonists that disrupt the host innate immune response that promotes viral infection. Furthermore, clinical isolates containing a 382 nucleotide deletion in ORF8 are associated with milder infections. Thus, mutations in Nsp1 and deletions or modifications of ORF6, 7a, 7b and 8 as disclosed herein reduce the ability of SARS-CoV-2 to antagonize IFN and thereby inhibit SARS-CoV-2 replication.
[0087] Since all organisms are recognized by the host immune system, unlike SARS-CoV-2 vaccines that express only the spike protein as an immunogen, LAVs provide broader and / or more persistent protection. As disclosed herein, live attenuated SARS-CoV-2 with the above combination of attenuation modifications exhibited titers 1 / 100 to 1 / 1000 that of the corresponding wild-type virus while also eliciting a significantly suppressed inflammatory response. In particular, inoculation with as little as 100 PFU of live attenuated SARS-CoV-2 resulted in a strong humoral immune response, prevented lung pathology, and provided complete protection against weight loss and pneumonia after SARS-CoV-2 challenge in an animal model. The observed protection was accompanied by a greater than 5 log 10 decrease in viral load in the lungs and trachea after challenge. The immunized animals had a greater than 4 log 10There was also a decrease exceeding this, which indicates the possibility of a decrease in virus budding and transmission. This feature is particularly desirable for a SARS-CoV-2 vaccine to suppress the pandemic. Natural infection by SARS-CoV-2 is known to induce both mucosal and systemic antibody responses (Smith et al., Nat Immunol 22:1428-1439, 2021). Secretory immunoglobulin A (IgA) is thought to play a major role in protecting the upper and lower respiratory tracts from acute infection. However, vaccines administered intramuscularly or intradermally strongly induce IgG, but induce only a very small amount of secretory IgA (Krammer et al., Nature 586:516-527, 2020; Azzi et al., EBioMedicine 75:103788, 2022). In contrast, intranasal administration of vaccines such as the live-attenuated SARS-CoV-2 disclosed herein is expected to induce stronger mucosal immunity (King et al., Vaccines 9(8):881, 2021; Alu et al., EBioMedicine 76:103841, 2022). Furthermore, replication of the live-attenuated virus provides more targets for inducing T cell epitopes, so the disclosed live-attenuated SARS-CoV-2 will activate a broader cellular immunity that provides cross-protection against the variants of concern compared to spike-based vaccines. Thus, the disclosed live-attenuated SARS-CoV-2 is a safe and effective vaccine against SARS-CoV-2 infection and COVID-19 disease.
[0088] Provided herein is an attenuated SARS-CoV-2 having a recombinant genome encoding a modified spike (S) protein having a deletion (ΔPRRA) of a polybasic site corresponding to residues 681-684 of the reference sequence described as SEQ ID NO: 2, and encoding a modified non-structural protein 1 (Nsp1) having K164A and H165A substitutions corresponding to the reference sequence described as SEQ ID NO: 4. This recombinant genome further comprises mutations that prevent the expression of open reading frames (ORFs) 6, 7a, 7b, and 8. The disclosed attenuated SARS-CoV-2 can infect mammalian cells and replicate therein. The above modifications are described with reference to the Wuhan strain, but the same modifications can be made at the polybasic site in any SARS-CoV-2 variant, and the Nsp1 K164 / H165 residues and ORFs 6-8 are conserved among all major SARS-CoV-2 variants of concern (VOCs).
[0089] In some embodiments, the attenuated SARS-CoV-2 is the SARS-CoV-2 Wuhan strain. In other embodiments, the attenuated SARS-CoV-2 is a variant of the Wuhan strain, such as a variant derived from the alpha, beta, delta, gamma, epsilon, eta, iota, kappa, mu, zeta, or omicron lineages. In some examples, the attenuated SARS-CoV-2 is a variant of concern (VOC) of SARS-CoV-2, such as a VOC derived from the delta lineage (e.g., B.1.617.2 or AY lineages) or the omicron lineage (e.g., B.1.1.529, BA.1, BA.1.1, BA.2, BA.3, BA.4, or BA.5).
[0090] In some embodiments, the amino acid sequence of the modified S protein of the attenuated SARS-CoV-2 is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2 and has a deletion of the polybasic insert. In some examples, the amino acid sequence of the modified S protein comprises, or consists of, SEQ ID NO: 3.
[0091] In some embodiments, the amino acid sequence of the attenuated SARS-CoV-2 modified Nsp1 is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 4 and includes the K164A and H165A substitutions. In some examples, the amino acid sequence of the modified Nsp1 comprises, or consists of, SEQ ID NO: 5.
[0092] In some embodiments, the mutations that prevent the expression of ORF6, 7a, 7b and 8 are complete or partial deletions of ORF6, 7a, 7b and 8 that prevent the expression of ORF6, 7a, 7b and 8.
[0093] The attenuated SARS-CoV-2 may include one or more additional modifications, such as additional attenuation modifications. In some embodiments, the attenuated SARS-CoV-2 includes one or more modifications (such as one or more deletions or substitutions) in the Nsp14, Nsp16, Nsp5 and / or E genes of SARS-CoV-2. In some examples, the modification of Nsp14 is a modification that inhibits the N7-methyltransferase activity of the protein, such as the Y420A substitution (Pan et al., mBio 13(1):e0366221, 2022). In some examples, the modification of Nsp16, such as the substitution or deletion of D130A in the Nsp16 gene, inhibits the 2’O-methyltransferase activity of the protein (Ye et al., Cell Mol Immunol 19(5):588-601, 2022). IV. Immunogenic Compositions
[0094] Also provided are immunogenic compositions comprising the disclosed immunogens (e.g., attenuated SARS-CoV-2) and a pharmaceutically acceptable carrier. Such compositions can be administered to a subject by various modes of administration, such as intranasal, supratonsillar, inhalation, oral, intramuscular, subcutaneous, intravenous, intraarterial, intraarticular, intraperitoneal, or parenteral routes. Methods for preparing administrable compositions are described in Remingtons Pharmaceutical Sciences, 19th It is described in detail in publications such as Ed., Mack Publishing Company, Easton, Pennsylvania, 1995.
[0095] The immunogens described herein can be formulated with a pharmaceutically acceptable carrier to help retain biological activity while also promoting increased stability during storage within an acceptable temperature range. Potential carriers include, but are not limited to, physiologically balanced culture media, phosphate buffered saline aqueous solutions, water, emulsions (e.g., oil / water or water / oil emulsions), various types of wetting agents, cryoprotective additives or stabilizers such as proteins, peptides or hydrolysates (e.g., albumin, gelatin), sugars (e.g., sucrose, lactose, sorbitol), amino acids (e.g., sodium glutamate), or other protective agents. The resulting aqueous solution can be used as is, or lyophilized and packaged for use. The lyophilized preparation is mixed with a sterile solution prior to administration for single or multiple doses.
[0096] The formulated compositions, particularly liquid formulations, may contain bacteriostatic agents, such as, but not limited to, benzyl alcohol, phenol, m-cresol, chlorobutanol, methylparaben, and / or propylparaben at effective concentrations (usually 1% w / v or less), to prevent or minimize degradation during storage. Bacteriostatic agents can be contraindicated for some patients; thus, the lyophilized formulation can be reconstituted in a solution with or without such components.
[0097] The immunogenic compositions of the present disclosure may contain pharmaceutically acceptable vehicle substances required to approximate physiological conditions, such as pH adjusters and buffers, isotonicity adjusters, wetting agents, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate.
[0098] The pharmaceutical composition may optionally contain an adjuvant for enhancing the host's immune response. Suitable adjuvants include, for example, toll-like receptor agonists, alum, AlPO4, hydrogels, lipid A and its derivatives or variants, oil emulsions, saponins, neutral liposomes, liposomes containing a vaccine, and cytokines, nonionic block copolymers, and chemokines. Nonionic block polymers containing polyoxyethylene (POE) and polyxylpropylene (POP), such as POE-POP-POE block copolymers, MPL (trademark) (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, IN) and IL-12 (Genetics Institute, Cambridge, MA) may be used as adjuvants (Newman et al., 1998, Critical Reviews in Therapeutic Drug Carrier Systems 15:89-142). These adjuvants have the advantage of helping to stimulate the immune system in a non-specific way and thus enhancing the immune response to the pharmaceutical product. In some embodiments, an adjuvant is not required and thus is not administered with the attenuated live SARS-CoV-2.
[0099] In some embodiments, the composition can be provided as a sterile composition. The pharmaceutical composition typically contains an effective amount of the disclosed immunogen and can be prepared by conventional techniques. Typically, the amount of immunogen in each dose of the immunogenic composition is selected as an amount that elicits an immune response without significant adverse side effects. In some examples, the dose is about 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 or 1×10 6 viral particles, for example, about 1×10 4 to about 10 6 viral particles, for example, about 5×10 4 to about 5×10 5 viral particles or about 1×10 5 viral particles.
[0100] In some embodiments, the composition can be provided in a unit dosage form for use in eliciting an immune response in a subject, e.g., for preventing SARS-CoV-2 infection in a subject. The unit dosage form contains a suitable single preselected dosage for administration to the subject, or a suitable marked or measured plurality of two or more preselected unit dosages, and / or a metering mechanism for administering the unit dosage or plural dosages thereof. In some examples, the unit dosage is from about 1×10 4 to about 10 6 virus particles, e.g., from about 5×10 4 to about 5×10 5 virus particles. In certain examples, the unit dosage is about 1×10 5 virus particles.
[0101] In some embodiments, the immunogenic composition is formulated for nasal administration. V. Methods of Eliciting an Immune Response
[0102] The attenuated live SARS-CoV-2 and compositions containing the same disclosed herein can be used in methods of inducing an immune response against SARS-CoV-2 to prevent, inhibit (including inhibiting transmission), and / or treat SARS-CoV-2 infection.
[0103] Methods of eliciting an immune response against SARS-CoV-2 in a subject are provided herein. In some embodiments, the method includes administering to the subject an effective amount of the attenuated live SARS-CoV-2 or immunogenic composition disclosed herein. In some examples, the attenuated live SARS-CoV-2 or immunogenic composition is administered intranasally (such as in a spray) or orally (such as by using enteric-coated tablets).
[0104] When inhibiting, treating, or preventing SARS-CoV-2 infection, the methods can be used to avoid infection in SARS-CoV-2 seronegative subjects (e.g., by inducing an immune response that provides protection against SARS-CoV-2 infection), or to treat existing infections in SARS-CoV-2 seropositive subjects.
[0105] To identify a subject for prevention or treatment by the methods of the present disclosure, an acceptable screening method is used to determine a risk factor associated with a target, or suspected disease or condition, or to determine the status of an existing disease or condition in the subject. These screening methods include, for example, conventional elaborate examinations for determining environmental, familial, occupational, and other such risk factors that may be associated with a target, or suspected disease or condition, and diagnostic methods such as various ELISAs and other immunoassay methods for detecting and / or characterizing SARS-CoV-2 infection. By these and other routine methods, a physician can select patients in need of therapy using the methods and immunogenic compositions of the present disclosure. In accordance with these methods and principles, the compositions can be administered as an independent prevention or treatment program, or as a follow-up, adjunctive, or co-therapeutic regimen to other treatments, in accordance with the teachings herein, or other conventional methods.
[0106] In some embodiments, an effective amount of the attenuated live SARS-CoV-2 or immunogenic composition is administered as a single dose. In other embodiments, the attenuated live SARS-CoV-2 or immunogenic composition is administered as part of a prime-boost immunization protocol. In some examples, the attenuated live SARS-CoV-2 or immunogenic composition is administered as both a prime dose and a boost dose. In other examples, the attenuated live SARS-CoV-2 or immunogenic composition is administered as a prime dose and a second SARS-CoV-2 vaccine is administered as a boost dose. In yet other examples, the attenuated live SARS-CoV-2 or immunogenic composition is administered as a boost dose and a second SARS-CoV-2 vaccine is administered as a prime dose. In some examples, the second SARS-CoV-2 vaccine is administered intramuscularly.
[0107] In certain embodiments, the combinatorial immunogenic composition and coordinated immunization protocol employ separate immunogens or formulations, each directed to eliciting an anti-SARS-CoV-2 immune response, such as an immune response to the SARS-CoV-2 spike protein. Separate immunogenic compositions that elicit an anti-SARS-CoV-2 immune response can be combined in a multivalent immunogenic composition administered to a subject in a single immunization step or administered separately in a coordinated immunization protocol (in monovalent immunogenic compositions).
[0108] In one aspect, a suitable immunization regimen includes at least two separate inoculations with one or more immunogenic compositions comprising the disclosed live attenuated SARS-CoV-2, wherein the second inoculation is administered more than about 2 weeks, about 3 weeks, or about 4 weeks after the first inoculation, for example, about 3 - 8 weeks. A third inoculation may be administered several months after the second inoculation, in certain aspects, more than about 4 months, 5 months, or 6 months after the first inoculation, more than about 6 months to about 2 years after the first inoculation, or from about 8 months to about 1 year after the first inoculation. To enhance the "immune memory" of the subject, periodic inoculations beyond the third are also desirable. The appropriateness of the selected vaccination parameters, such as formulation, dosage, regimen, etc., can be determined by taking an aliquot of serum from the subject and assaying antibody titers during the course of the immunization program. Alternatively, the T cell population can be monitored by conventional methods. Additionally, the clinical status of the subject can be monitored for a desired effect, such as prevention of SARS-CoV-2 infection, improvement of the disease situation (e.g., reduction in viral load), or decrease in the transmission rate. If such monitoring indicates that the vaccination is not optimal, the subject may be boosted with an additional dose of the immunogenic composition, and the vaccination parameters may be modified in a manner expected to enhance the immune response. Thus, for example, the dose of the disclosed immunogen may be increased or the route of administration may be changed.
[0109] It is contemplated that there may be several boosts and that each boost may be with a different immunogen. Also contemplated in some instances is that a boost may be with the same immunogen as another boost or the prime.
[0110] Prime and boost can be administered as a single dose or multiple doses, for example, 2 doses, 3 doses, 4 doses, 5 doses, 6 doses or more doses, and can be administered to a subject over several days, weeks or months. Multiple boosts, such as 1 to 5 times or more, can also be given. Different dosages can be used in a series of sequential vaccinations. For example, a relatively large dose can be used for the first vaccination, and then a boost with a relatively small dose can be used. An immune response to a selected antigenic surface can be elicited by one or more vaccinations of a subject.
[0111] In some embodiments, the disclosed immunogen can be administered to a subject simultaneously with the administration of an adjuvant. In other embodiments, the immunogen can be administered to the subject after the administration of the adjuvant and within a time period sufficient to elicit an immune response. In other embodiments, no adjuvant is administered.
[0112] SARS-CoV-2 infection need not be completely inhibited in an effective manner. For example, eliciting an immune response against SARS-CoV-2 can reduce or inhibit SARS-CoV-2 infection by a desired amount, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% compared to SARS-CoV-2 infection in the absence of immunization (removal or prevention of detectable SARS-CoV-2-infected cells). In a further example, the replication of SARS-CoV-2 can be reduced or inhibited by the disclosed methods. The replication of SARS-CoV-2 need not be completely eliminated in an effective manner. For example, an immune response elicited using one or more of the disclosed immunogens can reduce the replication of SARS-CoV-2 by a desired amount, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% compared to the replication of SARS-CoV-2 in the absence of an immune response (removal or prevention of detectable SARS-CoV-2 replication).
[0113] After immunization of a subject, serum can be collected from the subject at an appropriate time point, frozen, and stored for neutralization testing. Methods for assaying for neutralizing activity include, but are not limited to, plaque reduction neutralization (PRNT) assays, micro-neutralization assays, flow cytometry-based assays, single-cycle infection assays, and pseudovirus neutralization assays. VI. Nucleic Acid Molecules, Reverse Genetics Plasmids and Kits
[0114] Also provided are nucleic acid molecules comprising a complement of the recombinant genome of the attenuated live SARS-CoV-2 disclosed herein. In some embodiments, a single nucleic acid molecule comprises a complement of the SARS-CoV-2 recombinant genome. For example, the single nucleic acid molecule may comprise a bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), human artificial chromosome (HAC), P1-derived artificial chromosome (PAC), cosmid, or plasmid. In other embodiments, multiple nucleic acid molecules, such as at least two, at least three, at least four, at least five, at least six or at least seven nucleic acid molecules, collectively comprise the complete recombinant SARS-CoV-2 genome. In some examples, the multiple nucleic acid molecules are plasmids.
[0115] Further provided is a collection of reverse genetics plasmids comprising a complement of the recombinant genome of the attenuated live SARS-CoV-2 disclosed herein. As described in Example 1, reverse genetics plasmids each containing a fragment of the SARS-CoV-2 genome can be used to introduce specific mutations into one or more viral genes to generate modified infectious SARS-CoV-2 (see, for example, Xie et al., Cell Host Microbe 27:841-848 e843, 2020; Xie et al., Nat Protoc 16:1761-1784, 2021, which describe the 7-plasmid system used herein). Other SARS-CoV-2 reverse genetics plasmids have been previously described and can be used to generate the attenuated SARS-CoV-2 described herein (see, for example, Melade et al., EMBO Rep 23:e53820, 2022; Rihn et al., PLoS Biol 19(2):e3001091, 2021; Torii et al., Cell Rep 35:109014, 2021).
[0116] Methods for producing attenuated SARS-CoV-2 are also provided herein. In some embodiments, the method comprises transfecting a permissive cell with a reverse genetics plasmid described herein; culturing the transfected cells under conditions sufficient to permit replication of the attenuated SARS-CoV-2; and isolating the attenuated SARS-CoV-2 from the cell culture. A permissive cell is any cell that is susceptible to infection by SARS-CoV-2 and supports SARS-CoV-2 replication. In some examples, permissive cells are mammalian cells such as, but not limited to, Vero cells, BGMK cells, CV-1 cells, LLC-MK2 cells, A549 cells, RhMK cells, and HeLa cells (see, e.g., Wang et al., Emerg Infect Dis 27(5):1380-1392, 2021 for a list of SARS-CoV-2 permissive cells). Attenuated SARS-CoV-2 produced by the disclosed methods is further provided.
[0117] Kits are also provided, such as kits for the production of attenuated SARS-CoV-2 disclosed herein. In some embodiments, the kit comprises a collection of reverse genetics plasmids disclosed herein. In some examples, the kit further comprises a transfection reagent, cultured cells (such as cells that are permissive to infection by SARS-CoV-2), cell culture medium, and / or a cell culture flask. In some examples, the components of the kit are present in separate vials or containers, which in some examples are composed of glass, metal, or plastic.
Examples
[0118] The following examples are provided to illustrate certain features of certain embodiments of the present disclosure, but the claims should not be limited to these illustrated features.
[0119] (Example 1) Materials and Methods (Part 1) This example describes the materials and methods used for the tests described in Examples 2 to 5. List of Reagents [Table 1-1] [Table 1-2] [Table 1-3]
[0120] Cells and Viruses The Vero E6 cell line (catalog number CRL-1586) was purchased from the American Type Cell Collection (ATCC) and cultured in Eagle's Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (Invitrogen) and 1% penicillin / streptomycin and L-glutamine. A549-hACE2 (NR-53821) cells were obtained from BEI Resources and maintained at 37 °C with 5% CO2 in DMEM supplemented with 5% penicillin and streptomycin, and 10% fetal bovine serum (FBS).
[0121] EpiAirway cells (AIR-100-HCF) and culture medium were purchased from MatTek. EpiAirway is a ready-to-use 3D mucociliary tissue model consisting of normal human-derived tracheal / bronchial epithelial cells cultured at the air-liquid interface (ALI). The cells were cultured in MatTek-owned medium for 2 days before use. Mucus was washed away at the time of infection.
[0122] The SARS-CoV-2 isolate WA1 / 2020 (NR-52281, lot number 70033175) was obtained from BEI Resources, NIAID, NIH, and was passaged 3 times on Vero cells and 1 time on Vero E6 cells before being obtained. It was passaged one more time on Vero E6 cells before use. The virus was sequenced to confirm that it contained no mutations compared to its original parental virus.
[0123] Production of SARS-CoV-2 recombinant virus The SARS-CoV-2 recombinant virus was generated using a 7-plasmid reverse genetics system based on the virus strain (2019-nCoV / USA_WA1 / 2020) isolated from the first reported SARS-CoV-2 case in the United States (Xie et al., Cell Host Microbe 27:841-848, 2020). Subsequently, fragment 4 was subcloned into the low-copy plasmid pSMART LCAmp (Lucigen) to increase stability. Nsp1 N128S / K129E To introduce the N128S and K164A / H165A mutations, the pUC57-CoV2-F1 plasmid containing the mutated Nsp1 was first created by using the overlapping PCR method with the following primers: M13F: gtaaaacgacggccagt (SEQ ID NO: 19) N128S / K129Ef: taagaacggtAGTGAGggagctggtggccatagtta (SEQ ID NO: 20) N128S / K129Er: caccagctccCTCACTaccgttcttacgaagaagaa (SEQ ID NO: 21) K164A / H165Af: aaaactggaacactGCcGCcagcagtggtgttacccgtga (SEQ ID NO: 22) K164A / H165Ar: gggtaacaccactgctgGCgGCagtgttccagttttcttgaa (SEQ ID NO: 23) NheIr: cacgagcagcctctgatgca (SEQ ID NO: 24)
[0124] The PCR fragment was digested with BglII / NheI and ligated into the F1 plasmid digested with BglII / NheI. The spike ΔPRRA mutation was introduced into pUC57-CoV2-F6 using overlapping PCR with the following primers: M13F: gtaaaacgacggccagt (SEQ ID NO: 25) ΔPRRA-f: actcagactaattctcgtagtgtagctagtcaatc (SEQ ID NO: 26) ΔPRRA-r: actagctacactacgagaattagtctgagtctgat (SEQ ID NO: 27) BglIIr: cagcatctgcaagtgtcact (SEQ ID NO: 28)
[0125] The PCR fragment was digested with KpnI / BglII and ligated into the F6 plasmid digested with KpnI / BglII. To delete the ORF6 - OFR8 region, overlapping PCR was performed using the following primers: Mf: ttaattttagccatggcaga (SEQ ID NO: 29) ORF68f: tttgcttgtacagtaaacgaacaaactaaaatgtc (SEQ ID NO: 30) ORF68r: ttttagtttgttcgtttactgtacaagcaaagcaa (SEQ ID NO: 31) AvrIIr: gaagtccagcttctggccca (SEQ ID NO: 32).
[0126] The PCR fragment was digested with MluI / AvrII and ligated into the pCC1 - CoV - 2 - F7 plasmid digested with MluI / AvrII. The resulting plasmid was verified by restriction enzyme digestion and Sanger sequencing.
[0127] In vitro transcription and electroporation were performed according to the procedures detailed elsewhere (Xie et al., Nat Protoc 16:1761 - 1784, 2021). To recover the virus, the RNA transcript was electroporated into Vero E6 cells. The virus after the first passage was titrated by plaque - forming assay in Vero E6 cells and verified by deep sequencing.
[0128] Hamster challenge experiment Adult male outbred Syrian hamsters were purchased from Envigo and maintained in an FDA-approved housing unit. All experiments were performed within a biosafety level 3 (BSL-3) suite. Animals were implanted subcutaneously with an IPTT-300 transponder (BMDS), randomized, and housed two per cage in sealed, individually ventilated rat cages (Allentown). Hamsters were fed irradiated 5P76 (Lab Diet) ad libitum and housed on autoclaved aspen chip bedding with reverse osmosis-treated water provided in bottles. After acclimating all animals to the BSL3 facility for 4 - 6 days or longer, experiments were conducted.
[0129] For the challenge experiments, adult (6 - 12 months old) Syrian hamsters were anesthetized with 3 - 5% isoflurane according to previously described procedures (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96 - 100, 2021). Intranasal inoculation was performed by pipetting 10 4 PFU or the desired dose of SARS-CoV-2 in a 50 μl volume into the nares of anesthetized hamsters. After infection, hamsters were monitored daily for clinical signs and weight loss. Nasal wash samples were collected on days 1, 2, 3, and 4 post-infection and tested for sgRNA by RT-qPCR and for infectious virus by TCID 50 in Vero E6 cells. Nasal washes were collected by pipetting approximately 160 μl of sterile phosphate-buffered saline into one naris when the hamster was anesthetized with 3 - 5% isoflurane. For tissue collection, a subset of hamsters was humanely euthanized by intraperitoneal injection of 200 mg / kg pentobarbital, and lungs were processed for histopathology. Blood collection was performed under anesthesia (3 - 5% isoflurane) by gingival venipuncture or cardiac puncture if the animal was euthanized.
[0130] Mouse infection experiments Adult K18-hACE2 mice were purchased from the Jackson laboratory and maintained in an FDA-approved facility. All experiments were performed within a biosafety level 3 (BSL-3) suite. For the infection study, mice were first anesthetized with 3–5% isoflurane. Intranasal inoculation was performed by pipetting 10 5 PFU of SARS-CoV-2 in a 50 μl volume into the nares of the mice. Mice were weighed and observed daily. For tissue collection, mice were euthanized by CO2 overdose on days 2, 4, and 6 as needed.
[0131] SARS-CoV-2 pseudovirus production and neutralization assay Procedures were as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96–100, 2021).
[0132] RNA isolation and qRT-PCR Procedures were as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96–100, 2021).
[0133] RNAseq To prepare the sequencing library, RNA was first extracted from lung homogenates and turbinates using the Trizol-chloroform method. The aqueous portion was further purified using the RNeasy Mini Kit (Qiagen, Gaithersburg, MD). When the quality of the RNA was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), the RNA integrity number (RIN) was higher than 9 for all. An aliquot (1 μg) of each sample of total RNA was used to prepare the sequencing library using Illumina Stranded Messenger RNA Prep (ligation-based). The cDNA library was normalized and loaded onto a NovaSeq 6000 sequencer (Illumina, San Diego, CA) for 2×100 cycle paired-end reads of deep sequencing. The sequencing reads of each sample were mapped to each reference genome of Mesocricetus auratus (BCM_Maur_2.0) by Tophat (v2.1.2). Then, Cufflinks (v2.2.1) was used to assemble transcripts, estimate abundances, and test for differential expression. Sequencing and initial data analysis using Qiagen CLC Genomics Workbench (version 21) were performed by the FDA's Next Generation Sequencing Core Facility. Sequencing and initial data analysis using Qiagen CLC Genomics Workbench (version 21) were performed by the FDA's Next Generation Sequencing Core Facility. The raw data and processed data were deposited in NCBI (GEO accession number GSE199922s).
[0134] Further data analysis was performed using R Studio 1.4.1106 (R-project.org). Heatmaps were constructed using the heatmap library. The gene list of signaling pathways was obtained from the hallmark gene sets in the Molecular Signatures Database (MSigDB) (Subramanian et al., Proc Natl Acad Sci U S A 102, 15545-15550, 2005). Drawings were compiled in Adobe Photoshop (registered trademark). This work utilized the computer resources of the NIH HPC Biowulf cluster (hpc.nih.gov).
[0135] Histopathological analysis The procedure was as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96-100, 2021). Tissues (heart, brain, lung, trachea, and nasal turbinate) were fixed overnight in 10% neutral buffered formalin and then processed for paraffin embedding. 5-μm sections were stained with hematoxylin and eosin for histopathological examination. Images were scanned using Aperio ImageScope. Blind samples were graded by a licensed pathologist for the following 12 categories: consolidation, alveolar wall thickening, alveolar airway infiltration, perivascular infiltration, perivascular edema, type II alveolar epithelial cell hyperplasia, atypical alveolar epithelial cell hyperplasia, bronchiolar mucosal hyperplasia, bronchiolar airway infiltration, proteinaceous fluid, hemorrhage, vasculitis. Grades: 0 = none, 1 = mild, 2 = moderate, 3 = severe. A graph was prepared by summing the scores for each category.
[0136] In situ hybridization (RNAscope) To detect SARS-CoV-2 genomic RNA in formalin-fixed paraffin-embedded (FFPE) tissues, in situ hybridization (ISH) was performed using the RNAscope 2.5HD RED kit, single assay (Advanced Cell Diagnostics; catalog number 322373) according to the manufacturer's instructions. Briefly, the Mm PPIB probe detects the peptidylprolyl isomerase B gene (a housekeeping gene) (catalog number 313911, positive control RNA probe), the dapB probe detects the dihydrodipicolinate reductase gene derived from Bacillus subtilis strain SMY (a soil bacterium) (catalog number 310043, negative control RNA probe) and V-nCoV2019-Orf1ab targets SARS-CoV-2 plus-sense (genomic) RNA (catalog number 895661). Tissue sections were deparaffinized with xylene, subjected to a series of ethanol washes and peroxidase blocking, heated in the antigen retrieval buffer provided by the kit, and digested with the protease provided by the kit. The sections were exposed to the ISH target probe and incubated in a hybridization oven at 40 °C for 2 hours. After washing, the ISH signal was amplified using the preamplifier provided by the kit, the amplifier was conjugated to alkaline phosphatase, and incubated with the fast red substrate solution at room temperature for 10 minutes. The sections were then stained with a 50% hematoxylin solution, treated with 0.02% ammonium water, dried in a drying oven at 60 °C, mounted, and stored at 4 °C until image analysis.
[0137] Lung immunofluorescence analysis FFPE lung sections with a thickness of 4 μm were deparaffinized, rehydrated, and heat-treated in a microwave oven for 15 minutes in 10 mM Tris / 1 mM EDTA buffer (pH 9.0). After cooling at room temperature for 30 min, the heat-recovered sections were blocked in PBST containing 2.5% bovine serum albumin (BSA) at room temperature (RT) for 30 minutes, and then incubated overnight at 4 °C with primary antibodies in 1% BSA. The primary antibodies used included SARS nucleocapsid protein (Sino Biologicals, 40143-MM05), pro-surfactant protein C (EMD Millipore, AB3786), Iba1 (Abcam, ab5076), and RAGE (Abcam, ab216329). The sections were washed and incubated at RT for 1 hour with secondary antibodies conjugated to Alexa Fluor 488 and Alexa Fluor 647 (ThermoFisher, Waltham, MA). The nuclei were counterstained with Hoechst 33342. For double-labeling experiments, the primary antibodies were mixed and incubated overnight at 4 °C. For negative controls, the sections were incubated without primary antibodies or mouse and rabbit isotype antibody controls. Sections stained with only the conjugated secondary antibodies showed no specific staining. Whole-slide fluorescence imaging was performed using a Hamamatsu NanoZoomer 2.0-RS whole-slide digital scanner equipped with a 20x objective lens and fluorescence module #L11600. The analysis software NDP.view2 was used for image processing (Hamamatsu Photonics, Japan).
[0138] TCID 50 The procedure was as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96-100, 2021).
[0139] Plaque assay The nasal wash samples were serially diluted 10-fold and added to 24-well plates containing fresh confluent Vero E6 cells. For tissue samples, the entire trachea or turbinates or left lung lobe (about 0.2 grams) was resuspended in 1 milliliter of MEM and homogenized on a Precellys Evolution tissue homogenizer (Bertin) equipped with a cooling unit. The tissue homogenate was then serially diluted 10-fold and added to Vero E6. After 1 h, the mixture was removed and the tragacanth gum overlay was replenished (final concentration 0.3%). The cells were incubated at 37 °C and 5% CO2 for 2 days, then fixed with 4% paraformaldehyde (PFA) and then the cells were stained for 5 - 10 minutes with 0.1% crystal violet in 20% methanol. The infectious titer was then calculated and plotted as plaque-forming units per milliliter (PFU / ml).
[0140] Measurement of antibodies by ELISA SARS-CoV-2 S and RBD antigens for ELISA were prepared in a baculovirus expression system using procedures published elsewhere (Meseda et al., NPJ Vaccines 6:145, 2021).
[0141] Statistical analysis One-way analysis of variance was used to calculate statistical significance by GraphPad Prism (9.1.2) software for Windows® by GraphPad Software, San Diego, California USA.
[0142] (Example 2) Rational attenuation of SARS-CoV-2 A single mutation can attenuate the virus, but LAVs that differ from the wild-type virus by only one or two mutations pose a concern for inherent safety due to the potential for reversion. For this reason, the following modifications were made to the ancestral WA1 / 2020 virus genome. First, the polybasic insert (PRRA) immediately upstream of the furin cleavage site was removed from the virus. Such a modification inactivates the S1 / S2 cleavage of the spike protein and significantly reduces lung infection (Johnson et al., Nature 591:293-299, 2021; Liu et al., J Virol 95(11):e01751-20, 2021). Second, the known IFN antagonists, ORF6-8, were deleted from the virus genome. Third, the pair of mutations (K164A / H165A) that significantly reduce the cytotoxicity of SARS-CoV-2 (Liu et al., J Virol 96(6):e0221621, 2022) was introduced into the C-terminus of Nsp1. Genetic modifications from three aspects should reduce lung infection, reduce inflammation and interferon antagonism, and mitigate Nsp-1-mediated cytotoxicity. Finally, a recombinant virus called "WA1-ΔPRRA-ΔORF6-8-Nsp1 K164A / H165A " was obtained. For comparison, two other recombinant viruses, WA1-ΔPRRA and WA1-ΔPRRA-ΔORF6-8-Nsp1 N128S / K129E , were also generated (Figure 1A). Only WA1-ΔPRRA has the removed polybasic insert, while WA1-ΔPRRA-ΔORF6-8-Nsp1 N128S / K129E has both the deletion of the polybasic insert and ORF6-8, and then contains a pair of mutations (N128S / K129E) that did not efficiently inactivate Nsp1-mediated cytotoxicity like K164A / H165A (Liu et al., J Virol 96(6):e0221621, 2022). All recombinant viruses formed plaques in Vero E6 cells, 10 7Reached a titer of pfu / ml (Figure 1B). For simplicity, the three recombinant viruses are also referred to throughout the text as "ΔPRRA", "Nsp1-K164A / H165A", and "Nsp1-N128S / K129E". To monitor genomic stability, the recombinant viruses were passaged 5 times in Vero E6 cells and then deep sequenced to confirm identity. Sanger sequencing was also performed to detect the presence of K164A / H165A in Nsp1 (Figure 1C). Overall, no revertants were observed and the genomes of the recombinant viruses were considered stable after cell passage. The three recombinant viruses grew with similar kinetics to an equivalent titer in A549-hACE2 cells (Figure 1D). Compared to the ancestral virus (WA1 / 2020), all three recombinant viruses showed little infection of primary human airway cells cultured at the air-liquid interface, and Nsp1-K164A / H165A showed the lowest infectivity (Figure 1E).
[0143] (Example 3) Attenuation of Nsp1-K164A / H165A in K18-hACE2 transgenic mice To test attenuation in vivo, adult K18-hACE2 transgenic mice were divided into 5 groups (n = 10 / group) and 10 5Mice were either intranasally inoculated with WA1 / 2020, ΔPRRA, Nsp1-K164A / H165A, or Nsp1-N128S / K129E plaque-forming units (PFU), or left uninoculated. Body weight, survival, and clinical signs of disease were monitored over 8 days. All infected mice succumbed to infection by day 8 (Figs. 2A–2D). Since encephalitis following SARS-CoV-2 infection is known to be lethal in this model (Winkler et al., Nat Immunol 21:1327–1335, 2020; Oladunni et al., Nat Commun 11, 6122, 2020; Rathnasinghe et al., Emerg Microbes Infect 9: 2433–2445, 2020; Golden et al., JCI Insight 5(19):e142032, 2020; Yinda et al., PLoS Pathog 17(1):e1009195, 2021; Rathnasinghe et al., Emerg Microbes Infect 9(1):2433–2445, 2020; Bao et al., Nature 583:830–833, 2020), the potential for virus attenuation in the airway was masked by the lethality caused by encephalitis. To mitigate the limitations of the K18-hACE2 mouse model, virus amounts were quantified in the turbinates, lungs, and brains at 2, 4, and 6 days post-infection (DPI). In the turbinates, the median log 10 transformed infectious titers peaked at 5.33, 4.01, 3.01, and 3.89 by 2 DPI for WA1 / 2020, ΔPRRA, Nsp1-K164A / H165A, and Nsp1-N128S / K129E-infected mice, respectively. The titers decreased to near the limit of quantification by 4 DPI (Figs. 2E, 2F). In the lungs of Nsp1-K164A / H165A-infected mice, the infectious virus titers were approximately 2 log 10was low (Figs. 2G - 2J). The amount of lung virus in Nsp1 - K164A / H165A - infected mice also tended to be lower than that from the ΔPRRA and Nsp1 - N128S / K129E groups and reached statistical significance at 4 and 6 DPI. However, the amount of virus in the brain was mostly equivalent among the four infected groups, except that the Nsp1 - K164A / H165A group had the lowest virus titer at 6 DPI (Figs. 2K - 2M). At 2 DPI, there was only a very small amount of detectable infectious virus in the brain, but the amount of virus in the brain increased with a delayed kinetics, contrary to that in the airway. The high amount of virus in the brain of the Nsp1 - K164A / H165A group at 6 DPI was associated with the absence of pathology in the lung tissue. Hematoxylin and eosin (HE) staining (Figs. 2N - 2W) identified lung lesions in WA1 / 2020, ΔPRRA, and Nsp1 - N128S / K129E - infected mice. Generally, there were peribronchiolar and perivascular immune infiltrations. In contrast, the lungs infected with Nsp1 - K164A / H165A had less than 1% affected area with little pathology, which was almost indistinguishable from uninfected mice. Collectively, these results indicated that the Nsp1 - K164A / H165A virus was attenuated mainly in the upper and lower airways of K18 - hACE2 mice but was still neuroinvasive in this highly sensitive mouse model.
[0144] (Example 4) Attenuation of Nsp1 - K164A / H165A in Syrian hamsters Syrian hamsters are highly susceptible to SARS-CoV-2 and have been widely used in COVID-19 research (Sia et al., Nature 583:834-838, 2020; Chan et al., Clin Infect Dis 71:2428-2446, 2020; Imai et al., Proc Natl Acad Sci U S A 117:16587-16595, 2020). Considering the inherent drawbacks of the K18-hACE2 mouse model due to fatal neuroinvasion, the potential of Nsp1-K164A / H165A attenuation was further evaluated in hamsters. For this purpose, five groups of 6-month-old Syrian hamsters were either intranasally inoculated with 10 4 PFU of each virus or left uninoculated. This inoculum consistently resulted in weight loss, clinical signs, and lung pathology in Syrian hamsters (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021). As shown in Figure 3A, hamsters infected with WA1 / 2020 showed an 18% weight loss at 7 DPI, while the ΔPRRA and Nsp1-N128S / K129E groups showed less than 5% weight loss over a 14-day period. Nsp1-K164A / H165A-infected animals (n = 8) showed no weight loss throughout the test, similar to the uninfected group. During the first 4 days after infection, the log 10 transformed infectious virus titers in nasal wash samples were measured by TCID 50 assay. As shown in Figure 3B, the infectivity titers from Nsp1-K164A / H165A-infected animals were approximately 2 log 10 lower than those of WA1 / 2020-infected hamsters at 1 and 2 DPI and tended to be lower than those from ΔPRRA and Nsp1-N128S / K129E-infected animals. The infectious nasal virus titers from all groups decreased to just above the limit of quantification at 4 DPI. Similarly, the subgenomic RNA (sgRNA) titers in the turbinates from all groups were just above the limit of quantification at 4 DPI (Figure 3C). The log per milliliter in lung homogenates 10The converted sgRNA copies were 5.55, 4.0, 3.37, and 4.71, respectively, for WA1 / 2020, ΔPRRA, Nsp1-K164A / H165A, and Nsp1-N128S / K129E-infected hamsters at 4 DPI (Figure 3C). Log in lung homogenates 10 The converted infectious virus titers were 7.13, 5.96, 4.42, and 5.95, respectively, for WA1 / 2020, ΔPRRA, Nsp1-K164A / H165A, and Nsp1-N128S / K129E-infected hamsters (Figure 3D). RNAscope showed that viral RNA was present only along the bronchial epithelium in Nsp1-K164A / H165A-infected hamsters and that the amount of staining was much less than in the other three infected groups (Figure 8). Overall, the viral load in Nsp1-K164A / H165A-infected hamsters was 1 / 100 to 1 / 1000 that of WA1 / 2020-infected animals and was significantly lower than that in ΔPRRA- and Nsp1-N128S / K129E-infected animals. Subsequently, lung pathology was scored. Again, Nsp1-K164A / H165A-infected hamsters had minimal histopathological changes in the lungs at 4 DPI (Figure 3E). In contrast, WA1 / 2020 infection induced extensive peribronchiolar edema and perivascular immune cell infiltration, which led to significant consolidation (Figures 3F–3T). The ΔPRRA and Nsp1-N128S / K129E groups also had areas with type II hyperplasia and immune infiltration. Nsp1-K164A / H165A-infected hamsters sometimes showed minimal pathological changes in the lungs and were indistinguishable from uninfected animals. Tracheal pathology followed the same trend observed in the lungs for Nsp1-K164A / H165A-infected animals, showing only minimal submucosal lymphoplasmacytic infiltration (Figures 9A–9E). None of these infections resulted in significant changes in the heart and other vital organs as previously reported (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021).
[0145] Immunofluorescence analysis showed that the consolidated areas in the lungs infected with WA1 / 2020 were biased towards macrophages expressing Iba1 (Figure 4). Consolidated Iba1 staining was not detected or minimal in the uninfected, ΔPRRA, and Nsp1-K164A / H165A groups, but consolidated Iba1 areas were visible in Nsp1-N128S / K129E-infected animals. Prominent staining of the viral nucleocapsid was present in the alveolar epithelium surrounding the consolidated areas and also within the affected bronchioles in WA1 / 2020 (Figures 4A, 4B). Nucleocapsid staining was limited to the bronchiolar epithelium in the Nsp1-K164A / H165A group (Figure 4A), but reached the alveolar epithelium in the ΔPRRA and Nsp1-N128S / K129E-infected animals. Reduced staining for RAGE and ProSPC, markers of type 1 and type 2 epithelial cells, respectively, emphasized excessive epithelial damage in the consolidated areas (Figures 4F, 4G).
[0146] To further evaluate changes at the molecular level, RNA was isolated from both the turbinates and lung homogenates at 4 DPI and RNAseq analysis was performed. In the turbinates, comparison between WA1 / 2020 and ΔPRRA, Nsp1-N128S / K129E and Nsp1-K164A / H165A infected animals showed that WA1 / 2020 upregulated 34 genes in the inflammatory pathway, downregulated 17 genes, upregulated 33 genes in the type I IFN response pathway, downregulated 25 genes, upregulated 39 genes in the type II IFN response pathway, and downregulated 8 genes (Figs. 5A - 5D). Most notably, Nsp1-K164A / H165A infection had the minimal effect on the expression of inflammatory markers such as Mx2, Ifit3, Tlr6, Cxcl10, and Nfkb1 (Fig. 5A). Nsp1-K164A / H165A infection upregulated the minimal number of genes in the interferon-alpha and gamma responses, probably due to the lowest viral load among all the tested groups (Figs. 5B, 5C). In some cases, the gene expression profiles of Nsp1-K164A / H165A infected hamsters were indistinguishable from those of uninfected hamsters. Surprisingly, Nsp1-K164A / H165A specifically upregulated genes such as Irf8, Tap1, and Stat1, all important for antiviral defense (Fig. 5B). In the lung, WA1-2020 induced 50 inflammatory genes, 14 TLR signaling genes, 25 genes of type I IFN, and 37 genes of the type II IFN pathway at higher levels than in ΔPRRA, Nsp1-K164A / H165A, and Nsp1-N128S / K129E infected hamsters. For genes significantly downregulated in WA1 / 2020 infected animals, their expression was restored in ΔPRRA, Nsp1-K164A / H165A, and Nsp1-N128S / K129E infected hamsters (Fig. 10). In particular, no significant differences were observed in the gene expression profiles of the lung among ΔPRRA, Nsp1-K164A / H165A, and Nsp1-N128S / K129E infected animals, which could be the result of a limited number of samples or overall very low viral loads in the lung.
[0147] (Example 5) Intranasal immunization of Syrian hamsters with Nsp1-K164A / H165A induced a strong humoral response and provided protection against WA1 / 2020 challenge Based on the data obtained from Examples 2-4, Nsp1-K164A / H165A was the most attenuated recombinant virus and was thus selected for subsequent evaluation of its immunogenicity and efficacy as a LAV candidate. Adult Syrian hamsters were intranasally immunized with 10 2 , 10 3 , and 10 4 PFU of Nsp1-K164A / H165A. For comparison, hamsters were also inoculated with 10 4 PFU of WA1 / 2020, ΔPRRA, and Nsp1-N128S / K129E, and the animals were maintained until convalescence (Figure 6A). A single dose of Nsp1-K164A / H165A induced binding and neutralizing antibodies to levels comparable to those derived from WA1 / 2020-infected hamsters 14 or 28 days after immunization (Figures 6B, 6C). The 100 PFU dose was as potent as the 10 4 PFU dose. Subsequently, immunized and convalescent hamsters were challenged with 10 4 PFU of WA1 / 2020 virus and monitored for 7 days prior to necropsy. Mock-vaccinated hamsters lost more than 15% of their body weight by day 7 post-challenge (DPC), while immunized hamsters from all three dosage groups did not lose weight (Figure 6D). At 1 and 2 days post-challenge, the infectious virus titers in nasal wash samples collected from immunized animals were 3-4 logs lower than those derived from non-vaccinated but challenged animals 10Low (Figs. 6E, 6F) and mostly resolved by 4 DPC (Figs. 6G, 6H). Infectious virus titers and sgRNA titers in the trachea and lungs were often below the limit of quantification at 4 and 7 DPC in many immunized and convalescent hamsters (Figs. 6I–6L). The amount of virus in the turbinates of immunized and convalescent hamsters was at least 4 logs lower at 4 DPC and then undetectable at 7 DPC. Finally, single-dose immunization with Nsp1-K164A / H165A completely protected hamsters from developing pneumonia upon challenge, showing nearly 0% consolidation at 4 and 7 DPC and no histopathological changes (Figs. 7A–7C and Fig. 11). A pre-existing antibody response was not observed in hamsters vaccinated with Nsp1-K164A / H165A (Fig. 12), which similarly reflected robust protection and minimal virus replication in these animals as observed in convalescent animals (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021).
[0148] (Example 6) Materials and Methods (Part 2) This example describes the materials and experimental procedures for the tests described in Examples 7–12.
[0149] Cells and Viruses The Vero E6 cell line (catalog number CRL-1586) was purchased from the American Type Culture Collection (ATCC) and cultured in Dulbecco's Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (Invitrogen) and 1% penicillin / streptomycin and L-glutamine. The Calu-3 cell line (catalog number HTB-55) was obtained from the ATCC and maintained in EMEM + 20% FBS. H1299-hACE2 is a human lung cancer cell line that stably expresses human ACE2. This cell line was generated by transducing the NCI-1299 human lung cancer cell line (ATCC CRL-5803) with pLVX-hACE2 by lentivirus and selecting with 1 μg / mL puromycin. Western blot was performed to confirm the expression of hACE2. H1299-hACE2 cells were maintained at 37°C with 5% CO2 in DMEM supplemented with 5% penicillin and streptomycin, and 10% fetal bovine serum (FBS).
[0150] The SARS-CoV-2 isolate WA1 / 2020 (NR-52281, lot number 70033175) was obtained from BEI Resources, NIAID, NIH and passaged 3 times on Vero cells and 1 time on Vero E6 cells before being acquired. It was further passaged 1 time on Vero E6 cells. The SARS-CoV-2 hCoV-19 / USA / MD-HP05647 / 2021 (Delta variant, Pango lineage B.1.617.2) was obtained from BEI resources, NIAID, NIH (NR-55672, lot number 70046635) and passaged 1 time in Vero E6-TMPRSS2 and 1 time in Calu-3 cells before being acquired. It was further passaged 1 time in H1299-hACE2 cells to generate a virus stock. The passaged viruses were deep sequenced to confirm identity (100% identical to the original sequence and without tissue culture adaptation mutations such as loss of the polybasic site between the S1 and S2 subunits of the spike protein). The SARS-CoV-2 isolates hCoV-19 / USA / HI-CDC-4359259-001 / 2021 (B.1.1.529 Omicron, NR-56475), hCoV-19 / USA / NY-MSHSPSP-PV56475 / 2022 (BA.2.12.1 Omicron, NR-56782), USA / MD-HP30386 / 2022 (BA.4, Omicron, NR-56802), and hCoV-19 / USA / COR-22-063113 / 2022 (BA.5 Omicron, NR-58620) were obtained from BEI resources and used directly in the experiments. Recombinant SARS-CoV-2 viruses were generated as previously described (Liu et al., Nat Commun 13:6792, 2022; Liu et al., Nat Comm 13(1):6792, 2022). BA.1-LAV and BA.5 LAV were generated using standard molecular biology techniques. Briefly, the WA1 spike sequence in the prototype Nsp1-K164A / H165A virus was replaced with the corresponding BA.1 and BA.5 spike protein sequences. The polybasic insert "HRRA" was removed.
[0151] Hamster Load Experiment Adult male outbred Syrian hamsters were purchased in advance from Envigo. All experiments were performed within a biosafety level 3 (BSL-3) suite. The animals were implanted subcutaneously with an IPTT-300 transponder (BMDS), randomized, and housed two per cage in sealed, individually ventilated rat cages (Allentown). The hamsters were fed irradiated 5P76 (Lab Diet) ad libitum and housed on autoclaved aspen chip bedding with reverse osmosis-treated water provided in bottles. After acclimating all animals to the BSL3 facility for 4 - 6 days or longer, the experiments were conducted.
[0152] Adult male (5 - 6 months old) Syrian hamsters (Mesocricetus auratus) were anesthetized with (3 - 4% v / v) isoflurane and oxygen according to previously described procedures (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96 - 100, 2021; Jiron et al., J Am Assoc Lab Anim Sci 58:40 - 49, 2019). Intranasal inoculation was performed by pipetting 10 2 PFU or 10 4 PFU of SARS-CoV-2 into the nostrils of anesthetized hamsters. After infection, the hamsters were monitored daily for clinical signs and weight loss. When the hamsters were anesthetized with 3 - 5% isoflurane, nasal wash fluids were collected by pipetting approximately 200 μl of sterile phosphate-buffered saline into one nostril. Nasal swabs were performed as previously described (Langel et al., Sci Transl Med 14:eabn6868, 2022).
[0153] For airborne infection, 10 2A subset of hamsters (n = 7) inoculated with WA1 / 2020 of PFU or Nsp1-K164A / H165A were paired in divided cages to prevent direct contact and measure transmission to naive sentinels (Nunez et al., mSphere 6(3):e0050721, 2021). One hamster (WH363) paired with a vaccinated animal with actively budding Nsp1-K164A / H165A showed no evidence of productive infection or seroconversion at 14 DPE and remained seronegative until immediately prior to the BA.2.12.1 load 4.5 months later. For these reasons, WH363 was excluded from the load dataset.
[0154] For tissue collection, a subset of hamsters were humanely euthanized at 4 and 7 DPC by intraperitoneal injection of 200 mg / kg pentobarbital. Lungs, tracheas, and turbinates were sectioned for histopathology or homogenized for RNA extraction or titration in cell culture. Blood collection was performed under anesthesia (3 - 5% isoflurane) by gingival venipuncture or cardiac puncture if the animal was euthanized. The left lung lobe (approximately 0.2 grams) of hamsters was minced, divided, resuspended in 1 milliliter of MEM or TriZol reagent (for RNA extraction), and homogenized on a Precellys Evolution tissue homogenizer (Bertin) equipped with a cooling unit. Tracheas and turbinates were homogenized in the same manner in TriZol reagent. Spleen cells were extracted from vaccinated and naive hamsters at 14 DPI, stimulated with spike and nucleocapsid antigen pools (BEI catalog numbers NR-52418 and NR-52419), and IFN-γ secreting cells were identified by ELISpot (MABTECH, 3102-2H).
[0155] RNA Isolation and qRT-PCR The procedure was as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96-100, 2021). Briefly, RNA was extracted from 0.1 g of tissue homogenate using the QIAamp vRNA Mini Kit or the RNeasy 96 Kit (QIAGEN) and eluted in 60 μl of water. 5 μL of RNA was used for each reaction in real-time RT-PCR. When graphing the results in Prism 9, values below the limit of quantification (LoQ) were arbitrarily set to half of the LoQ value. Unless otherwise specified, the unit of RNA copy is Log 10 as presented as RNA copies per 1 μg of tissue RNA.
[0156] Histopathological analysis The procedure was as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96-100, 2021). Tissues (lung, trachea, and nasal turbinates) were fixed overnight in 10% neutral buffered formalin and then processed for paraffin embedding. 5-μm sections were stained with hematoxylin and eosin for histopathological examination. Images were scanned using Aperio ImageScope. Blinded samples were graded by a licensed pathologist for the following 12 categories: consolidation, alveolar wall thickening, alveolar airway infiltration, perivascular infiltration, perivascular edema, type II alveolar epithelial cell hyperplasia, atypical alveolar epithelial cell hyperplasia, bronchiolar mucosal hyperplasia, bronchiolar airway infiltration, proteinaceous fluid, hemorrhage, and vasculitis. Grades: 0 = none, 1 = mild, 2 = moderate, 3 = severe. A graph was prepared by summing the scores for each category.
[0157] Virus titration 50% tissue culture infective dose (TCID 50) The assay was performed as previously described (Selvaraj et al., Life Sci Alliance 4(4):e202000886, 2021; Stauft et al., Virology 556:96 - 100, 2021) for the initial nasal wash titration after inoculation. Briefly, Vero E6 cells were seeded in a 96 - well plate at 1.5×10 4 cells / well the day before infection. On the day of the experiment, serial dilutions of 20 μl of nasal wash samples were made in medium, and a total of 6 - 8 wells were infected with each serial dilution of the virus. After incubation for 48 hours, the cells were fixed in 4% PFA and then stained with 0.1% crystal violet. Then, the formula: log(TCID 50 ) = log(do)+log(R)(f + 1) was used to calculate TCID 50 . In the formula, do represents the dilution that gives a positive well, f is a number derived from the number of positive wells calculated by the moving average, and R is the dilution factor.
[0158] For the focus - forming assay (FFA), nasal wash, BALF, and lung homogenate samples were serially diluted 10 - fold in a 96 - well plate, and the dilutions were added to a 96 - well black - well plate for fluorescence FFA in H1299 - hACE2 cells (Stauft et al., J Infect Dis 227(2):202 - 205, 2023). After 1 hour, a tragacanth gum overlay (final concentration 0.3%) was added. After incubating the cells at 37 °C and 5% CO2 for 1 day, they were fixed with 4% PFA and then stained with a primary rabbit anti - N Wuhan - 1 antibody (Genscript) overnight, followed by staining the cells with a secondary anti - rabbit Alexa - 488 conjugated antibody and then DAPI staining. Then, the infectivity titer was counted using Gen5 software on a Cytation7 instrument and calculated and plotted as focus - forming units per milliliter (FFU / ml). The limit of detection for FFA was set at the lowest dilution rate (10 -1) and based on the minimum detectable titer that gave 1 FFU with the inoculum volume (50 μl). Any value below the lower limit (200 FFU / ml) was arbitrarily evaluated as 100 FFU / ml for statistical analysis.
[0159] SARS-CoV-2 neutralization assay Samples were serially diluted two-fold in 5% FBS DMEM and mixed with 100 PFU of SARS-CoV-2 in 96-well plates for 1 hour at 37°C. The sample:virus mixture was then added to confluent H1299-hACE2 cells in 96-well plates. Cells were infected for 1 hour before removing the inoculum and washed three times with DPBS. A second overlay containing 1.2% tragacanth gum, 2X MEM, 5% FBS, and DMEM was added to the plates. After incubating the cells at 37°C for 1 day, they were fixed with 4% PFA and then stained with primary rabbit anti-SARS-CoV-2 N antibody (Genscript U739BGB150-5) overnight and then with secondary anti-rabbit Alexa-488 conjugated antibody, followed by 4’,6-diamidino-2-phenylindole (DAPI) staining. Plates were imaged on a Cytation7 (Agilent) and foci were counted using Gen5 software. For the neutralization assay, recombinant LY-CoV555 (bamlanivimab) mixed with WA1 / 2020 (Wang et al., Proc Natl Acad Sci U S A 118:(29):e2102775118, 2021) was included as a positive control. The 50% end-point neutralization titer was determined as the reciprocal of the highest dilution rate that provided less than half the number of foci obtained from the negative control wells (plain DMEM mixed with 100 PFU of virus).
[0160] Measurement of antibodies by ELISA The preparation of SARS-CoV-2 RBD antigen in a baculovirus expression system and its use in ELISA have been described previously (Meseda et al., NPJ Vaccines 6:145, 2021). ELISA was performed with slight modifications. Briefly, Immulon 2HB Plates were coated with 1 μg / mL of recombinant RBD protein at 4 °C overnight. Test serum samples were pre-diluted in assay diluent (PBS [PBST] containing 0.05% Tween®-20 and 10% fetal bovine serum), and then serial two-fold dilutions of each sample were performed in duplicate across the plate. Starting dilution rates of 1:160, 1:80, and 1:20 were used for serum (IgA and IgG), BALF (IgG), and nasal wash and BALF (IgA) samples, respectively. The plates were incubated with the test serum samples at 37 °C for 2 hours. After thoroughly washing the plates in a microplate washer, the plates were incubated with anti-hamster antibody. For IgG ELISA, a 1:4000 dilution of HRP-conjugated goat anti-hamster IgG (6060-05, Southern Biotech, Birmingham, Alabama) was added to the assay wells. For IgA ELISA, rabbit anti-hamster IgA antibody [sandwich antibody; (catalog number sab 3001a) Brookwood Biomedical, Jemison, Alabama] was added to the assay wells at a 1:4000 dilution rate, and the plates were incubated at 37 °C for 1 hour. Unbound sandwich antibody was washed away, and a 1:4000 dilution of HRP-conjugated goat anti-rabbit IgG (4030-05, Southern Biotech, Birmingham, Alabama) was added to the assay plates. In both IgG and IgA ELISAs, incubation with the HRP-conjugated secondary antibody continued for 1 hour after thoroughly washing the plates to remove unbound antibody. ABTS / H2O2 peroxidase substrate (SeraCare, Gaithersburg, Maryland) was added to the assay wells, and the plates were left at room temperature for 20 - 30 minutes. Color development was stopped by adding 1% SDS, and OD 405 values were captured on a VersaMax microplate reader (Molecular Devices) containing Softmax Pro 7 software. In the IgG ELISA, the mean OD of the PBS-treated group 405Subtract the value from the average OD 405 derived from other treatment groups, and the assay endpoint is the average OD 405 value of 0.05 (after background subtraction). In the IgA ELISA, the assay endpoint is the average OD 405 value of 0.02 for duplicate wells. The antibody titer was determined as the reciprocal of the highest dilution rate of samples where the average OD 405 value was 0.02 (for IgA) or 0.05 (for IgG after background subtraction).
[0161] IFN-gamma ELISpot Hamster interferon gamma (IFN-γ) enzyme-linked immunosorbent spot (ELISpot) assays were performed using the Hamster IFN-γ ELISpot BASIC (MABTECH Mabtech 3102-2H, Nacka Strand, Sweden) kit according to the manufacturer's instructions. MSIP plates (Millipore) were washed five times with sterile water, coated with mAb (MTH21), and incubated overnight at 4°C. The coated plates were washed five times with 1X PBS and blocked for 30 minutes (room temperature) by adding RPMI 1640 (GibcoBRL) containing 10% heat-inactivated FBS, 1% 100X penicillin, streptomycin, and L-glutamine solution (GibcoBRL). Freshly isolated splenocytes (2.5×10 5(number) were seeded into each well and stimulated at 37 °C for 45 - 48 hours with a SARS-CoV-2 spike protein peptide pool (2 μg / ml of each peptide) (BEI Catalog number NR-52418) or a nucleocapsid protein peptide pool (2 μg / ml of each peptide) (BEI Catalog number NR-52419) prepared in serum-free RPMI 1640. Negative and positive plate controls were medium or 2 μg / ml concanavalin A (ConA, Sigma-Aldrich), respectively. The plates were incubated with 1 μg / ml of mAb (MTH29-biotin) for 2 hours, then with streptavidin-HRP for 1 hour, and finally developed after adding the TMB substrate (product number 3651-10). Distinct spots typically appear within 20 minutes. After drying, spots were counted using a BioTek Cytation 7 imaging reader (Agilent) and analysis software Gen5 version number 3.11. ELISpot data were analyzed in Microsoft Excel. For each plate, the average number of spots from two negative wells (unstimulated cells) was subtracted from the wells stimulated with the peptide pool. Results were presented as the difference in spot-forming cells (SFC) per 10 6 PBMC. Results were plotted using GraphPad Prism 9.
[0162] Lung immunofluorescence analysis FFPE lung sections with a thickness of 4 μm were deparaffinized, rehydrated, and heat-treated in a microwave oven for 15 minutes in 10 mM Tris / 1 mM EDTA buffer (pH 9.0). After cooling at room temperature for 30 minutes, the heat-recovered sections were blocked in PBST containing 2.5% bovine serum albumin (BSA) at RT for 30 minutes and then incubated overnight at 4 °C with primary antibodies in 1% BSA. The primary antibodies used included SARS nucleocapsid protein (NP) (1:800, Sino Biologicals, 40143-MM05), MX1 (Proteintech, 13750-1-AP), pro-surfactant protein C (ProSPC) (1:200, EMD Millipore, AB3786), Iba1 (1:100, Abcam, ab5076), RAGE (1:400, Abcam, ab216329), and E-cadherin (ECAD) (Abcam, ab219332). The sections were washed and incubated at RT for 1 hour with secondary antibodies conjugated to ALEXA FLUOR 488 (A-21206) and ALEXA FLUOR 647 (A-31571, A-21447) (ThermoFisher, Waltham, MA). The nuclei were counterstained with Hoechst 33342. For double-labeling experiments, the primary antibodies were mixed and incubated overnight at 4 °C. For negative controls, the sections were incubated without primary antibodies or mouse and rabbit isotype antibody controls. Sections stained with only the conjugated secondary antibodies showed no specific staining. Whole-slide fluorescence imaging was performed using a Hamamatsu NanoZoomer 2.0-RS whole-slide digital scanner equipped with a 20× objective lens and fluorescence module #L11600. The analysis software NDP.view2 was used for image processing (Hamamatsu Photonics, Japan).In addition, immunofluorescence and differential interference images were captured using an Axio Observer Z1 inverted microscope (Carl Zeiss, Thornwood, NY) equipped with an Axiocam 506 monochrome camera, an ApoTome.2 optical sectioning system, and Plan-Apochromat 63x / 1.4NA oil immersion lens with WD = 0.19 and a Plan-Apochromat 20x / 0.8 objective lens. Post-processing and analysis of digital images were performed using ZEN 2 ver.2.0 imaging software. Images were constructed from Z-stack slices collected at 0.48 μm intervals (total thickness of 4 μm) and visualized as maximum intensity projections in orthogonal mode. For semi-quantitative analysis of NP staining, high-resolution whole-slide digital images of each lung section were acquired and the NP staining area was measured as a percentage of the total area of the section using NDP.view2 software. For TUNEL staining, sections were deparaffinized, hydrated, pretreated with proteinase K and then EDTA, washed with distilled H2O, and blocked with BSA. Sections were then incubated in the reaction mixture (TdT, dUTP, and buffer), washed, and incubated with anti-digoxigenin antibody. Sections were then visualized with alkaline phosphatase-ImmPACT Vector Red and counterstained with hematoxylin.
[0163] SARS-CoV-2 pseudovirus production and infection assay Human codon-optimized cDNA encoding the SARS-CoV-2 S glycoprotein of WA1 / 2020 and the BA.5 variant (with a 19-amino acid deletion at the C-terminus) was synthesized by GenScript and cloned between the BamHI and XhoI sites of the eukaryotic expression vector pcDNA3.1. Pseudovirions were produced by co-transfecting plasmids expressing psPAX2, pTRIP-GFP, and SARS-CoV-2 S into Lenti-X 293T cells using Lipofectamine 3000. Supernatants were collected 48 and 72 hours after transfection and filtered through a 0.45-μm membrane. Infection was performed as previously described (Liu et al., Cell Rep 40:111359, 2022). Forty-eight hours after infection, cells were fixed and imaged with a Leica Stellaris 5 confocal microscope. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI).
[0164] Statistical analysis Statistical significance was calculated using one-way analysis of variance or Student's t-test with GraphPad Prism (9.1.2) software for Windows® by GraphPad Software, San Diego, California USA.
[0165] (Example 7) Mucosal and systemic immunogenicity of Nsp1-K164A / H165A Serum samples and nasal washings from Syrian hamsters following intranasal inoculation with 100 PFU of Nsp1-K164A / H165A or wild-type WA1 / 2020 virus were evaluated for anti-SARS-CoV-2 spike immunoglobulin G (IgG) and IgA. Serum collected at 14 and 30 days post-infection (DPI) from both groups contained high titers of IgG antibodies specific for the WA1 / 2020 receptor binding domain (RBD) (Figure 13B). Serum neutralizing antibody (nAb) titers increased for animals in both groups from 0 DPI to 14 DPI (p<0.0001, mixed effects analysis), and then from 14 DPI to 30 DPI (p<0.0001). The 50% focus forming reduction neutralizing titer (FRNT 50) The geometric mean titers (GMTs) of serum nAbs against WA1 / 2020, as shown by , were 2100 (interquartile range, IQR, 3840) and 3169 (IQR 2560) at 30 DPI for the Nsp1-K164A / H165A and WA1 / 2020 groups, respectively (Figure 13C). At 30 DPI, the IgA titers detected in nasal washes were significantly higher in the Nsp1-K164A / H165A (GMT 145, IQR 240) and WA1 / 2020 (GMT 68, IQR 80) groups compared to naive controls (p < 0.0001) (Figure 13D). In this experiment, the IgA titers were two-fold higher in the Nsp1-K164A / H165A group compared to animals infected with WA1 / 2020 (p = 0.0336). When the same sera were measured for anti-delta variant RBD IgG, a two-fold decrease was observed in both the WA1 / 2020 (GMT 139621 vs 250997) and Nsp1-K164A / H165A (GMT 127911 vs 243465) groups compared to the WA1 / 2020 RBD-specific IgG titers (Figure 13E compared to Figure 13B). At the same time, the serum nAb titers against the delta variant decreased to approximately one-tenth compared to those against the ancestral WA1 / 2020 in both the Nsp1-K164A / H165A (GMT 215, IQR 160) and WA1 / 2020 (GMT 285, IQR 240) groups (Figure 13F compared to Figure 13C). Similarly, the serum omicron BA.1 RBD-specific IgG titers compared to the WA1 / 2020 RBD-specific IgG titers decreased to approximately one-fourth at 30 DPI in animals vaccinated with Nsp1-K164A / H165A (GMT 243465 vs 70613) and hamsters infected with WA1 / 2020 (GMT 250997 vs 62749) (Figure 13G compared to Figure 13B). The NAbs against the BA.1 variant reached titers just above the limit of detection in both the Nsp1-K164A / H165A vaccinated group (GMT 36, IQR 20, a decrease to less than 1 / 50 of the nAb titer against the ancestral WA1 / 2020) and the WA1 / 2020 infected group (GMT 44.2, IQR 40, a decrease to less than 1 / 70 of the nAb titer against the ancestral WA1 / 2020) (Figure 13H compared to Figure 13C).
[0166] To ensure that the loss of serum neutralizing antibodies against Omicron BA.1 is not due to the low-dose vaccine (100 PFU), Syrian hamsters were given 10 4PFU's Nsp1-K164A / H165A was inoculated and the antibody responses against various Omicron subvariants were characterized. Since secretory IgA (SIgA) is important for antiviral immunity in the lung (Oh et al., Sci Immunol 6(66):eabj5129, 2021), anti-SARS-CoV-2 spike IgG and IgA in serum and then bronchoalveolar lavage fluid (BALF) were evaluated. At 14 and 28 DPI, the serum anti-RBD IgG titers against WA1 / 2020 (GMTs of 137772 and 163840, respectively) were 20-fold higher than those against the BA.1 variant (GMTs of 3044 and 12177, respectively) (p<0.0001) (Figure 14A). BALF collected at 14 and 28 DPI contained detectable levels of IgG specific for the ancestral RBD (GMTs of 452 and 761, respectively), but the IgG titers specific for the BA.1 RBD were below the detection limit (Figure 14B). The IgA titers specific for serum WA1 / 2020 RBD decreased 5.65-fold from 14 DPI (GMT 115852, IQR 81920) to 28 DPI (GMT 20480, IQR 28800) (p = 0.0233, Sidak's multiple comparison test), while the IgA titers specific for serum anti-BA.1 RBD remained at equivalent levels at 14 and 28 DPI (Figure 14C). In BALF, IgA specific for the BA.1 RBD was undetectable at 14 and 28 DPI, but IgA specific for the WA1 / 2020 RBD was detected at both 14 DPI (p = 0.0003) and 28 DPI (p<0.0001) (Figure 14D). The GMT nAb titers against WA1 / 2020 were 761 (IQR 1680, 14 DPI) and 640 (IQR 720, 28 DPI), and decreased to less than 1 / 32 when measured against the Omicron subvariants BA.1, BA.2.12.1, BA.4, and BA.5 (Figure 14E). Finally, the cellular immunity induced by Nsp1-K164A / H165A vaccination was evaluated.Significant induction of IFNγ-secreting cells was observed by ELISpot assay at 14 DPI in splenocytes recovered from the vaccinated groups pulsed with nucleocapsid antigen pools N1 (p = 0.0096), N3 (p = 0.0096), and N4 (p < 0.0001) (Figure 14F). Collectively, a single dose of Nsp1-K164A / H165A, when administered intranasally, induced IgA / IgG against the SARS-CoV-2 spike protein in both the airway and circulation. However, these anti-spike antibodies are variant-specific and are subject to escape by the Omicron variant.
[0167] (Example 8) Efficacy of Nsp1-K164A / H165A against challenge with Delta and Omicron variants To evaluate whether intranasal administration of Nsp1-K164A / H165A provides protection against VOCs, male 5-month-old Syrian hamsters were inoculated intranasally with 100 PFU of Nsp1-K164A / H165A (n = 14) or WA1 / 2020 (n = 14) via the intranasal route (derived from the study depicted in Figure 13). At 35 days post-infection (DPI), vaccinated, convalescent hamsters (n = 6-7 / group) were challenged with 10 4Hamsters were challenged with the PFU delta isolate (hCoV-19 / USA / MD-HP05647 / 2021) or the BA.1 Omicron isolate (hCoV-19 / USA / HI-CDC-4359259-001 / 2021). At 4 and 7 days post-challenge (DPC), the animals were euthanized and tissues were collected for analysis of viral replication and pathology (Figure 15A). Nasal wash samples were also collected from each hamster after challenge. The inventors noted a significant decrease (p<0.0001) in infectious virus in nasal wash samples at 2, 3, 4, and 5 DPC by delta in animals inoculated with Nsp1-K164A / H165A or WA1 / 2020 compared to unvaccinated controls (Figure 15B). Similarly, hamsters vaccinated with Nsp1-K164A / H165A and hamsters in the convalescent phase of WA1 / 2020 also showed a decrease in nasal virus load at 1 (WA1 / 2020, p≦0.0001; Nsp1-K164A / H165A, p=0.0001), 2 (WA1 / 2020 only, p=0.0002), 3 (p<0.0001), and 4 (p<0.0001) DPC by BA.1. By 5 DPC, the infectious virus titers had declined to baseline in all BA.1-challenged animals (Figure 15C). At 4 DPC, subgenomic viral RNA (sgRNA) of the envelope (E) protein, a characteristic of viral replication, was readily detectable in the lungs, tracheas, and turbinates of unvaccinated animals challenged with delta and BA.1 (Figure 15D). In contrast, sgRNA levels decreased to less than 1 / 4400 (p≦0.0001) in the lungs, to about 1 / 300 (p<0.0001) in the tracheas, and to 1 / 300 (p<0.0001) in the turbinates of animals vaccinated with Nsp1-K164A / H165A and animals in the convalescent phase of WA1 / 2020 after challenge with the delta variant. For animals challenged with BA.1, sgRNA decreased to less than 1 / 100 in the lungs (p<0.0001), tracheas (p=0.0041), and turbinates (p<0.0001) at 4 DPC in both animals vaccinated with Nsp1-K164A / H165A and animals in the convalescent phase of WA1 / 2020 compared to the unvaccinated group.The infectious virus titers in the lung homogenates also decreased below the detection limit in the group vaccinated with Nsp1-K164A / H165A and in the group in the convalescent phase of WA1 / 2020 at 4 DPC after Delta or Omicron BA.1 challenge (Figure 15E). At 7 DPC, the sgRNA levels in the lungs were below the detection limit except for the unvaccinated / challenged hamsters (Figure 15F). Collectively, these results indicate that intranasal vaccination with Nsp1-K164A / H165A effectively reduces viral loads in both the upper and lower airways of Syrian hamsters upon heterologous virus challenge.
[0168] To further examine the presence of viral antigens and host innate immune activation, lung sections from uninfected (mock) or challenged hamsters were stained with hematoxylin and eosin (H&E) or immunostained for the viral nucleocapsid protein (NP) and myxovirus resistance 1 (MX1), an antiviral host response marker induced by interferon (Halfmann et al., J Infect Dis 225:282-286, 2022; Frere et al., Sci Transl Med 14:eabq3059, 2022) (Figure 16). Lungs from unvaccinated hamsters challenged with Delta at 4 DPC showed extensive immune infiltration and areas of viral NP deposition characterized by prominent staining of the inner layer of the infected bronchiolar epithelium with intense staining of the surrounding alveolar epithelium (Figures 16A-16B). Two of four unvaccinated animals challenged with BA.1 at 4 DPC showed NP deposition in a similar staining pattern (Figures 16B-16C). The unvaccinated groups challenged with Delta and BA.1 also showed increased MX1 immunoreactivity in these NP-positive lung regions, which was particularly evident in the bronchial epithelium. Vaccination with Nsp1-K164A / H165A or infection with WA1 / 2020 blocked NP deposition and MX1 upregulation in the groups challenged with Delta and BA.1 (Figures 16B-16C). High-resolution imaging of representative lung sections from unvaccinated hamsters challenged with Delta highlighted the prominent upregulation of MX1 in the nuclei and cytoplasmic compartments of infected bronchial epithelial cells and attenuation in hamsters vaccinated with Nsp1-K164A / H165A (Figure 16D). In summary, the absence of NP staining and MX1 upregulation means that the challenge virus was unable to establish infection in the lungs of hamsters vaccinated with Nsp1-K164A / H165A and hamsters in the convalescent phase of WA1 / 2020, whether the challenge virus was Delta or the Omicron BA.1 variant.
[0169] Of the hamsters challenged with Delta, only the unvaccinated group (n = 8) showed significant weight loss over 7 days (Figure 17A). In contrast, none of the three groups showed weight loss after challenge with BA.1 (Figure 17A). At 4 DPC, the percentage of lung consolidation in hamsters challenged with the Delta variant was significantly reduced in the WA1 / 2020 (p = 0.0352, n = 3) and Nsp1-K164A / H165A vaccinated groups (n = 0.0386, n = 4) compared to unvaccinated controls (Figure 17B). The cumulative pathology score was also significantly lower at 4 DPC in the WA1 / 2020 group (p = 0.0002) and Nsp1-K164A / H165A group (p < 0.0001) challenged with Delta compared to unvaccinated and Delta-challenged animals (Figures 17B–17C). In contrast to the Delta variant, challenge with Omicron BA.1 resulted in overall low pathology, with minimal consolidation (Figure 17B) and low pathology scores at 4 DPC (Figures 17C–17D). At 7 DPC, both the Nsp1-K164A / H165A vaccinated group and the WA1 / 2020 vaccinated group (n = 3) of hamsters challenged with Delta had significantly (p < 0.0001) reduced consolidation compared to unvaccinated controls (Figure 17E). After challenge with BA.1, only two animals in the unvaccinated group had >20% lung consolidation at 7 DPC (Figure 17E), although lung pathology was evident in 3 out of 4 animals in this group (Figures 17F–17G). Again, lung pathology was barely detectable in animals vaccinated with Nsp1-K164A / H165A (n = 3, p = 0.0195).
[0170] To further characterize these histopathological changes using specific markers of inflammation and epithelial injury, serial lung sections from uninfected hamsters (mock), unvaccinated hamsters, as well as hamsters in the convalescent phase of WA1 / 2020 and hamsters vaccinated with Nsp1-K164A / H165A were immunostained for Iba1 (a marker of macrophages), pro-surfactant protein C (ProSPC, a marker of AT2 cells), RAGE (a marker of AT1 cells), and E-cadherin (a marker of intercellular epithelial junctions). At 7 DPC, lungs from all 4 unvaccinated hamsters challenged with Delta and 2 of 4 unvaccinated hamsters challenged with BA.1 showed consolidation regions that coincided with extensive accumulation of Iba1-expressing macrophages (Figs. 18A - 18B) and regions containing increased terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) (Fig. 23) as shown by routine H&E. These consolidated regions also showed a marked decrease in ProSPC-expressing AT2 cells and a marked loss of alveolar RAGE expression along the boundaries of AT1 cells. Clear regions of epithelial cell loss and Iba1-positive macrophage consolidation formed around bronchioles labeled with E-cadherin, presumably affected by viral challenge (Fig. 18C). Increased E-cadherin staining also identified hyperplastic epithelium in the consolidated spaces and was particularly prominent in unvaccinated lungs challenged with Delta. Vaccination with Nsp1-K164A / H165A attenuated macrophage consolidation of Iba1-positive macrophages and provided protection against loss of ProSPC and RAGE expression in the Delta- and BA.1-challenged groups (Figs. 18A - 18C). Prior infection with WA1 / 2020 also provided protection against epithelial injury in the Delta-challenged group.
[0171] (Example 9) Transmission of Nsp1-K164A / H165A in Syrian Hamsters To characterize the infectivity of Nsp1-K164A / H165A, further tests were performed in an airborne infection model in which two Syrian hamsters in the same cage were separated from each other by a custom perforated metal partition that allowed air exchange while preventing physical contact (Figure 19A).
[0172] First, donor hamsters (male, 4 months old, n = 14) were inoculated with 100 PFU of WA1 / 2020 or Nsp1-K164A / H165A, which is immunogenic and has previously been shown to confer protection against WA1 / 2020 challenge. Significant weight loss was observed in hamsters infected with WA1 / 2020 at 3 - 9 (p<0.0001), 10 - 11 (p<0.001), and 12 - 14 (p<0.01) DPI, and one hamster had to be euthanized at 7 DPI due to severe clinical signs (hypothermia, hunched posture, lethargy) (Figure 19B). In contrast, no significant weight loss was observed in animals vaccinated with Nsp1-K164A / H165A (n = 14). Hamsters inoculated with WA1 / 2020 also showed significantly higher infectious virus loads in nasal wash samples at 1, 2, and 3 DPI compared to the Nsp1-K164A / H165A inoculated group (1 DPI, 158-fold, p<0.0001; 2 DPI, ~33-fold, p = 0.0003; and 3 DPI, 10-fold, p = 0.0105) (Figure 19C).
[0173] At 1 DPI, seven sentinel hamsters were individually paired with either hamsters inoculated with WA1 / 2020 or Nsp1-K164A / H165A in cages with dividers. Nasal wash fluids were collected from sentinel hamsters at 1 - 4 days post-exposure (DPE), and serum conversion was determined 2 weeks later to confirm infection. The infectious virus titers of nasal wash fluids derived from sentinels exposed to Nsp1-K164A / H165A were undetectable at 1 DPE and were significantly lower at 2 DPE (less than 1 / 100, p = 0.0006) and 3 DPE (less than 1 / 290, p < 0.0001) compared to those derived from sentinels exposed to WA1 / 2020 (Figure 19D). At 4 DPE, two of the Nsp1-K164A / H165A sentinels had nasal wash fluid titers below the detection limit (200 TCID 50 / mL), but there was no statistical significant difference between the sentinel groups. Overall, transmission of Nsp1-K164A / H165A to sentinel hamsters showed delayed kinetics. Weight loss was not evident in sentinel hamsters exposed to Nsp1-K164A / H165A, while sentinels exposed to WA1 / 2020 experienced weight loss at 4 - 5 DPE (p < 0.05), 6 DPE (p = 0.0005), 7 - 12 DPE (p < 0.0001), 13 DPE (p = 0.0003), and 14 DPE (p = 0.0016), with a maximum mean weight loss of 15.6% at 9 DPE (Figure 19E). By 14 DPE, all exposed sentinel animals had not seroconverted, except for one animal in the sentinel group exposed to Nsp1-K164A / H165A (animal ID WH363) (no detectable infectious virus was present in the nasal wash fluid collected from this animal), and had high levels of anti-RBD IgG in serum (Figure 19F).
[0174] 4.5 months post-exposure (MPE), all seroconverted sentinel animals were tested for nAb titers against WA1 / 2020 and BA.2.12.1. Serum nAb titers against WA1 / 2020 from sentinel animals exposed to WA1 / 2020 (GMT 4637, IQR 7680) were 4-fold higher than those from sentinel hamsters exposed to Nsp1-K164A / H165A (GMT 1140, IQR 960) (p = 0.0026, unpaired t-test) (Figure 19G). However, neutralization of BA.2.12.1 was only observed in 2 animals from the Nsp1-K164A / H165A sentinel group and 5 animals from the WA1 / 2020 sentinel group prior to challenge (Figure 19H).
[0175] (Example 10) Passively vaccinated sentinel hamsters are protected from BA.2.12.1 challenge 4.5 months after the first exposure, seroconverted sentinel hamsters from Figure 19 were challenged with 10 4Hamsters were challenged with Omicron BA.2.12.1 via the intranasal route. No weight loss occurred in any of the BA.2.12.1-challenged hamsters (Figure 20A). A decrease in nasal viral load was observed in sentinel hamsters (n = 7) exposed to WA1 / 2020 at 3 DPC (p = 0.0492) and 4 DPC (p = 0.0011) compared to naive hamsters challenged with BA.2.12.1 (Figure 20B). Despite low or absent nAb titers specific for BA.2.12.1 in Nsp1-K164A / H165A sentinel animals (Figure 19H), the nasal viral load in these animals was significantly lower compared to controls at 4 DPC (p = 0.0094) (Figure 20B). The infectious virus titer in BALF was at least 1 log lower in WA1 / 2020 and Nsp1-K164A / H165A sentinel hamsters compared to naive controls at 4 DPC (p < 0.0001) (Figure 20C). The infectious virus titer in lung homogenates of control animals (n = 4) infected with BA.2.12.1 was approximately 1000 FFU / mL at 4 DPC, but 2 out of 4 sentinel hamsters had no detectable infectious virus in the lungs (Figure 20D). As a result, the log detected between Nsp1-K164A / H165A (p = 0.0043) and WA1 / 2020 sentinel hamster lungs (p = 0.0004) 10 The converted sgRNA copies were at least one order of magnitude lower at 4 DPC compared to controls (Figure 20E).
[0176] Fixed histopathological analysis of the lungs showed minimal consolidation at 4 DPC (n = 4) and 7 DPC (n = 3) in all groups. At 7 DPC, a slightly higher percentage of lung consolidation was observed in sentinels exposed to WA1 / 2020 compared to Nsp1-K164A / H165A (4 DPC, p = 0.0490) or Nsp1-K164A / H165A sentinel hamsters (p = 0.0269) and control animals (p = 0.0326) (Figure 20F). Consolidation is most likely a residual pathology from the initial WA1 / 2020 infection and not due to BA.2.12.1 burden. There was no significant difference in pathological scores at 4 or 7 DPC between groups (Figure 20G), but sentinel hamsters exposed to WA1 / 2020 showed bronchiolar mucosal hyperplasia at 4 DPC (Figure 20H) and 7 DPC (Figure 20I). Marked lung pathology in naive animals after BA.2.12.1 burden included alveolar wall thickening, airway infiltration, and type II alveolar epithelial cell hyperplasia. In contrast, such pathology was not present in the lungs of sentinel hamsters exposed to Nsp1-K164A / H165A after burden (Figures 20H-20I). In summary, sentinel hamsters exposed to Nsp1-K164A / H165A were protected from BA.2.12.1 burden in the lungs.
[0177] (Example 11) Nsp1-K164A / H165A vaccination confers protection against BA.5 challenge Since only Omicron BA.1 and BA.2.12.1 caused mild disease in Syrian hamsters, another vaccination-challenge study was performed using a BA.5 isolate that induces more severe disease. As shown in Figure 21A, 60 days after vaccination with 100 PFU of Nsp1-K164A / H165A, Syrian hamsters were challenged with 10 4Loaded with the PFU BA.5 isolate. Unvaccinated animals rapidly lost weight over the next 7 days, while the weight of vaccinated animals remained constant throughout the course of the test (Figure 21B). Vaccinated animals had detectable virus from nasal wash samples collected at 1 DPC and minimal (minimal or below) infectious virus at subsequent time points. In contrast, unvaccinated animals shed at least 2 log higher infectious virus in nasal wash samples at 1 - 3 DPC (Figure 21C). The viral loads in the turbinates, BALF, and lungs were nearly undetectable in vaccinated animals at 4 and 7 DPI (Figures 21D - 21G). Finally, hamsters vaccinated with Nsp1 - K164A / H165A also showed very mild lung pathology at 4 and 7 DPC compared to unvaccinated animals (Figures 21H - 21K). BA.4 / BA.5 and some later Omicron subvariants exhibit even higher immune evasion than the early BA.1 and BA.2 variants, but the Nsp1 - K164A / H165A LAV provided protection against BA.5 in both the upper and lower airways of Syrian hamsters.
[0178] (Example 12) Variant - specific Nsp1 - K164A / H165A as a booster To test whether Nsp1-K164A / H165A can be used as a booster vaccine candidate, two additional attenuated viruses were generated by replacing the WA1 spike with the BA.1 or BA.5 spike protein, namely BA.1-LAV and BA.5-LAV, respectively (Figure 22A). BA.1 enters cells expressing mouse ACE2 (mACE2) and infects experimental mouse strains such as Balb / c (Liu et al., Cell Rep 40:111359, 2022). In this study, it was also confirmed that BA.5 infects 293T cells expressing mACE2 (Figure 22B). Therefore, BA.1-LAV and BA.5-LAV were thought to infect Balb / c and induce variant-specific antibody responses. To test this possibility, Balb / c mice were first vaccinated with two doses of the vaccinia virus Ankara vector expressing the full-length WA1 spike (MVA-S) (Meseda et al., NPJ Vaccines 6:145, 2021). Eight weeks later, 10 4 PFU of BA.1-LAV or BA.5-LAV was administered intranasally to these mice (Figure 22C) (Liu et al., Cell Rep 40:111359, 2022). A dose of 10 4 PFU was chosen to ensure that the candidate vaccine virus infects mice with pre-existing immunity. The pre-boost sera contained high levels of nAbs against the original WA1 isolate, but no detectable anti-BA.1 nAbs or anti-BA.5 nAbs. Two weeks after a single dose of BA.1-LAV and BA.5-LAV, the GMT values of the corresponding nAb titers increased to 143 (IQR 387.6) and 84 (IQR 315.9), respectively (Figure 22D).
[0179] It will be apparent that the exact details of the methods or compositions described can be varied or modified without departing from the spirit of the described embodiments of the present disclosure. The inventors claim all such modifications and variations that fall within the scope and spirit of the following claims.
Claims
1. It is a weakened metaviral severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), This encodes a modified spike (S) protein having a polynucleotide deletion (ΔPRRA) corresponding to residues 681-684 of the reference sequence described as SEQ ID NO: 2, and a modified non-structural protein 1 (Nsp1) having K164A and H165A substitutions corresponding to the reference sequence described as SEQ ID NO:
4. Includes mutations that prevent the expression of open reading frames (ORFs) 6, 7a, 7b, and 8. Includes recombinant genome, The aforementioned attenuated SARS-CoV-2 is capable of infecting mammalian cells and replicating within them.
2. The attenuated SARS-CoV-2 according to claim 1, which is the SARS-CoV-2 Wuhan strain containing the recombinant genome, or a variant thereof derived from the alpha, beta, delta, gamma, epsilon, eta, iota, kappa, mu, zeta, or omicron series.
3. The attenuated SARS-CoV-2 according to claim 1, which is a variant of SARS-CoV-2 of concern (VOC) comprising the recombinant genome.
4. The attenuated SARS-CoV-2 according to claim 3, wherein the VOC is derived from the delta series or the omicron series.
5. The attenuated SARS-CoV-2 according to claim 1, wherein the modified S protein is at least 90% identical to SEQ ID NO: 2 and has a deletion of a polynucleotide insertion.
6. The attenuated SARS-CoV-2 according to claim 5, wherein the amino acid sequence of the modified S protein includes or consists of SEQ ID NO:
3.
7. The attenuated SARS-CoV-2 according to claim 1, wherein the amino acid sequence of the modified Nsp1 is at least 90% identical to that of SEQ ID NO: 4 and includes K164A and H165A substitutions.
8. The attenuated SARS-CoV-2 according to claim 7, wherein the amino acid sequence of the modified Nsp1 includes or consists of Sequence ID No.
5.
9. The attenuated SARS-CoV-2 according to claim 1, wherein the mutation that prevents the expression of ORF6, 7a, 7b, and 8 is a deletion of ORF6, 7a, 7b, and 8.
10. An immunogenic composition comprising a weakened SARS-CoV-2 according to any one of claims 1 to 9 and a pharmaceutically acceptable carrier.
11. The immunogenic composition according to claim 10, further comprising an adjuvant.
12. The immunogenic composition according to claim 10, characterized in that it is formulated for intranasal administration.
13. A nucleic acid molecule or a plurality of nucleic acid molecules comprising the complement of the recombinant genome of the attenuated SARS-CoV-2 according to any one of claims 1 to 9.
14. An aggregate of reverse genetic plasmids comprising the complement of the recombinant genome of the attenuated SARS-CoV-2 described in any one of claims 1 to 9.
15. A method for producing attenuated SARS-CoV-2, Transfecting tolerant cells with the reverse genetics plasmid described in claim 14; Culture the transfected cells under conditions sufficient to enable replication of the attenuated SARS-CoV-2; and To isolate the attenuated SARS-CoV-2 from the cell culture. Methods that include...
16. A weakened SARS-CoV-2 produced by the method described in claim 15.
17. The aggregate of reverse genetic plasmids according to claim 14; and A kit comprising transfection reagents, cultured cells, cell culture medium, and / or cell culture flasks.
18. A composition comprising attenuated SARS-CoV-2 according to any one of claims 1 to 9, or an immunogenic composition comprising attenuated SARS-CoV-2 according to any one of claims 1 to 9 and a pharmaceutically acceptable carrier, for inducing an immune response to SARS-CoV-2 in a subject.
19. The composition or immunogenic composition according to claim 18, characterized in that the composition or immunogenic composition is administered intranasally.
20. The composition or immunogenic composition according to claim 18, characterized in that the composition or immunogenic composition is administered in a single dose.
21. The composition or immunogenic composition according to claim 18, characterized in that the composition or immunogenic composition is administered as part of a prime-boost immunization protocol.
22. The composition or immunogenic composition according to claim 21, characterized in that the composition or immunogenic composition is administered as both a prime dose and a boost dose.
23. The composition or immunogenic composition according to claim 21, characterized in that the composition or immunogenic composition is administered as a prime dose, and a second SARS-CoV-2 vaccine is administered as a boost dose.
24. The composition or immunogenic composition according to claim 21, characterized in that the composition or immunogenic composition is administered as a boost dose, and a second SARS-CoV-2 vaccine is administered as a prime dose.
25. The composition or immunogenic composition according to claim 23, characterized in that the second SARS-CoV-2 vaccine is administered intramuscularly.
26. The composition or immunogenic composition according to claim 24, characterized in that the second SARS-CoV-2 vaccine is administered intramuscularly.