Mutant viral proteins

Abstract

The present invention relates to an isolated non-naturally occurring protein comprising the amino acid sequence set forth in SEQ ID NO:1, wherein the amino acid at positions 8, 47, 209 and / or 354 is substituted by any amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO:1.

Description

[Technical Field]

[0001] The present invention relates to mutant viral proteins, in particular mutant proteins originating from oncolytic viruses. [Background technology]

[0002] Vesicular stomatitis virus (VSV) is a single-stranded enveloped RNA virus belonging to the genus Vesiculovirus in the family Rhabdoviridae. It is an arbovirus that can infect insects, cattle, horses, and pigs. In mammals, its ability to infect and kill tumor cells while sparing normal cells makes it a promising oncolytic virus for the treatment of cancer (Barber, 2005; Fernandez et al., 2002; Hastie et al., 2013). The VSV genome encodes five structural proteins, including a single-pass transmembrane glycoprotein (G). This glycoprotein is a classical type I membrane glycoprotein with an amino-terminal signal peptide, an extracellular domain of approximately 450 amino acids, a single alpha-helical transmembrane segment, and a small intraviral carboxy-terminal domain. The signal peptide is cleaved in the lumen of the endoplasmic reticulum, and the native glycoprotein is composed of the extracellular domain, transmembrane domain, and intraviral domain.

[0003] G plays a key role during the initial steps of viral infection (Albertini et al., 2012b). First, it is responsible for binding of the virus to specific receptors. After binding, the virion enters the cell via the clathrin-mediated endocytosis pathway. In the acidic environment of the endocytic vesicle, G triggers fusion of the virus with the endosomal membrane, releasing the genome into the cytosol for the subsequent steps of infection. Fusion is catalyzed by a low-pH-induced large conformational change from a pre-fusion conformation, both of which are trimeric, to a post-fusion conformation (Roche et al., 2006; Roche et al., 2007). The polypeptide chain of the G extracellular domain folds into three distinct domains: the fusion domain (FD), the pleckstrin homology domain (PHD), and the trimerization domain (TrD). During the conformational transition, the FD, PHD, and TrD retain their tertiary structure. Nevertheless, they undergo significant rearrangements of their relative orientation due to secondary changes in the hinge segments (S1–S5), which refold during the low-pH-induced conformational transition (Roche et al., 2006; Roche et al., 2007). Recently, the low-density lipoprotein receptor (LDL-R) and other members of this receptor family have been shown to serve as VSV receptors ( Finkelshtein et al., 2013 ).

[0004] The LDL-R is a type I transmembrane protein that regulates cholesterol homeostasis in mammalian cells (Brown and Goldstein, 1986). LDL-R removes cholesterol-carrying lipoproteins from the plasma circulation. Ligands bound extracellularly by LDL-R at neutral pH are internalized and released into the acidic environment of endosomes for subsequent lysosomal degradation. The receptor then recycles back to the cell surface. The LDL-R extracellular domain consists of a ligand-binding domain, an epidermal growth factor (EGF) precursor homology domain, and a C-terminal domain rich in O-linked oligosaccharides. The ligand-binding domain is made up of seven cysteine-rich repeats (CR1–CR7, Figure 1). Each repeat is made up of approximately 40 amino acids, contains six cysteine ​​residues involved in three disulfide bridges, and a Ca2+ receptor. 2+ It contains a cluster of acidic residues that coordinate ions. Intracellular release of cargo is driven by a low pH-induced conformational change of the LDL-R from an open to a closed conformation. The LDL-R gene family consists of transmembrane receptors present on the cell surface, which are involved in the endocytic uptake of lipoproteins and mediate Ca transport for ligand binding. 2+All of these receptors generally have an intracellular domain containing several CR repeats (up to several dozen), EGF precursor-like repeats, a transmembrane region, and at least one internalization signal sequence. They are found ubiquitously in all animals, including insects. VSV-G has been widely used to pseudotype other viruses, and VSV-G pseudotyped lentivirus (VSV-G-LV) exhibits the same broad tropism as VSV. On the other hand, VSV-G-LV does not allow efficient gene transfer into unstimulated T cells, B cells, and hematopoietic stem cells due to very low expression levels of LDL-R ( Amirache et al., 2014 ). Due to the ubiquitous distribution of LDL-R receptor family members, the broad tropism of VSV and VSV-G-LV limits their therapeutic use, especially in tumor therapy, where specific targeting of tumor cells is desired. Summary of the Invention

[0005] One object of the present invention is to eliminate this drawback. One object of the present invention is to provide a new mutant VSV-G protein that is deficient in one of its properties to specifically target this protein. Another object of the present invention is to provide new VSVs that express such proteins and their use in tumor therapy.

[0006] The present invention provides an isolated non-naturally occurring protein comprising, consisting essentially of, or consisting of the amino acid sequence set forth in SEQ ID NO: 1, which corresponds to (is) the amino acid sequence of the extracellular domain of VSV strain Indiana, an isolated, non-naturally occurring protein, in which at least one amino acid at positions 8, 47, 209 and 354, numbered from the position of the first amino acid in the sequence of SEQ ID NO: 1, is substituted by an amino acid different from the amino acid shown at that position in said sequence of SEQ ID NO: 1; or any homologous protein derived from said protein set forth in SEQ ID NO: 1 by substitution, addition or deletion of at least one amino acid, provided that the derived protein retains at least 70% identity with the amino acid sequence set forth in SEQ ID NO: 1, and that said derived protein retains the ability to induce membrane fusion and to interact with the LDL membrane receptor; a homologous protein, wherein at least one amino acid of said homologous protein located at a position equivalent to positions 8, 47, 209 and 354 of said sequence of SEQ ID NO: 1 is replaced by an amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1, The invention relates to an isolated non-naturally occurring protein or a homologous protein, wherein the isolated non-naturally occurring protein retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor.

[0007] In a preferred embodiment, the amino acid at position 8 (numbered from the position of the first amino acid in the sequence of SEQ ID NO: 1) in the isolated non-naturally occurring protein of the invention, or at the equivalent position in a homologous protein derived from said protein according to SEQ ID NO: 1 of the invention, must not be a Y residue. In a preferred embodiment, the amino acid at position 209 (numbered from the position of the first amino acid in the sequence of SEQ ID NO: 1) of the isolated non-naturally occurring protein of the invention, or at the equivalent position in a homologous protein derived from said protein according to SEQ ID NO: 1 of the invention, must not be an H residue.

[0008] Thus, in other words, the present invention provides an isolated non-naturally occurring protein comprising the amino acid sequence set forth in SEQ ID NO: 1, which corresponds to the amino acid sequence of the extracellular domain of VSV strain Indiana, at least one amino acid at positions 8, 47, 209 and 354, numbered from the position of the first amino acid in the sequence of SEQ ID NO: 1, is replaced by an amino acid different from the amino acid shown at that position in said sequence of SEQ ID NO: 1, the substitution at position 8 is with any amino acid different from the amino acid shown at that position in SEQ ID NO: 1, except Y, an isolated non-naturally occurring protein, wherein the substitution at position 209 is with any amino acid other than H that is different from the amino acid shown at that position in the sequence of SEQ ID NO: 1; or any homologous protein derived from said protein set forth in SEQ ID NO: 1 by substitution, addition or deletion of at least one amino acid, provided that the derived protein retains at least 70% identity with the amino acid sequence set forth in SEQ ID NO: 1, and that said derived protein retains the ability to induce membrane fusion and to interact with the LDL membrane receptor; at least one amino acid of said homologous protein located at a position equivalent to positions 8, 47, 209 and 354 of said sequence of SEQ ID NO: 1 is replaced by an amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1, the substitution of the amino acid located at the position equivalent to position 8 with any amino acid other than the amino acid shown at that position in the sequence of SEQ ID NO: 1, except Y, a homologous protein in which the substitution of the amino acid located at the position equivalent to 209 is by any amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1, except H, The invention relates to an isolated non-naturally occurring protein or a homologous protein, wherein the isolated non-naturally occurring protein retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor.

[0009] Advantageously, the present invention provides an isolated non-naturally occurring protein comprising, consisting essentially of, or consisting of, the amino acid sequence set forth in SEQ ID NO: 1, which corresponds to (is) the amino acid sequence of the extracellular domain of VSV strain Indiana, 1. An isolated non-naturally occurring protein, wherein the amino acids at positions 8, or 47, or 209, or 354, or both 8 and 47, or both 8 and 209, or both 8 and 354, or both 47 and 209, or both 47 and 354, or both 209 and 354, or 8, 47, and 209, or 8, 47, and 354, or 8, 209, and 354, or 47, 209, and 354, or 8, 47, 209, and 354, numbered from the first amino acid in the sequence of SEQ ID NO: 1, are substituted by any amino acid different from the amino acids found in SEQ ID NO: 1. or any homologous protein derived from said protein set forth in SEQ ID NO: 1 by substitution, addition or deletion of at least one amino acid, provided that the derived protein retains at least 70% identity with the amino acid sequence set forth in SEQ ID NO: 1, and that said derived protein retains the ability to induce membrane fusion and to interact with the LDL membrane receptor; the amino acids of said homologous protein located at positions equivalent to positions 8, or 47, or 209, or 354, or both 8 and 47, or both 8 and 209, or both 8 and 354, or both 47 and 209, or both 47 and 354, or both 209 and 354, or 8, 47 and 209, or 8, 47 and 354, or 8, 209 and 354, or 47, 209 and 354, or 8, 47, 209 and 354, are substituted by any amino acid different from the amino acids found in SEQ ID NO: 1; In particular, the amino acid at position 8 is substituted by any amino acid except H, preferably except Y, the amino acid at position 47 is substituted with any amino acid except K; the amino acid at position 209 is substituted by any amino acid except Y, preferably except H, the amino acid at position 354 is substituted with any amino acid except R; homologous proteins, the numbering of which is made from the position of the first amino acid in the sequence of SEQ ID NO: 1, The invention relates to an isolated non-naturally occurring protein or a homologous protein, wherein the isolated non-naturally occurring protein retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor.

[0010] Advantageously, the present invention relates to an isolated non-naturally occurring protein comprising, consisting essentially of, or consisting of, the amino acid sequence set forth in SEQ ID NO: 1, TIFF0007799945000001.tif70149 or any protein derived from said protein set forth in SEQ ID NO: 1 by at least one amino acid substitution, addition or deletion, provided that said protein derived from said protein set forth in SEQ ID NO: 1 retains the boxed amino acids shown above, or positions 8, 47, 209, or 354, or both positions 8 and 47, or both positions 8 and 209, or both positions 8 and 354, or both positions 47 and 209, or both positions 47 and 354, or both positions 209 and 354, or 8, 47, and 209, or 8, 47, and 354, or 8, 209 and 354, or 47, 209 and 354, or 8, 47, 209 and 354, or the corresponding positions in a protein derived from said protein set forth in SEQ ID NO: 1, are substituted by any amino acid different from the amino acid found in SEQ ID NO: 1, In particular, the amino acid at position 8 is substituted by any amino acid except H, preferably except Y, the amino acid at position 47 is substituted with any amino acid except K; the amino acid at position 209 is substituted by any amino acid except Y, preferably except H, the amino acid at position 354 is substituted with any amino acid except R; any protein, the numbering of which is made from the position of the first amino acid in the sequence SEQ ID NO: 1, The isolated non-naturally occurring protein relates to an isolated non-naturally occurring protein or any protein that retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor.

[0011] Advantageously, the present invention provides an isolated non-naturally occurring protein comprising, consisting essentially of, or consisting of, the amino acid sequence set forth in SEQ ID NO: 1, which corresponds to (is) the amino acid sequence of the extracellular domain of VSV strain Indiana, An isolated non-naturally occurring protein, in which the amino acid at positions 47 or 354, or both 47 and 354, numbered from the first amino acid in the sequence of SEQ ID NO: 1, is substituted by any amino acid, in particular by any amino acid except K or R. or any homologous protein derived from said protein set forth in SEQ ID NO: 1 by substitution, addition or deletion of at least one amino acid, provided that the derived protein retains at least 70% identity with the amino acid sequence set forth in SEQ ID NO: 1, and that said derived protein retains the ability to induce membrane fusion and to interact with the LDL membrane receptor; the amino acid of said homologous protein located at position 47 or 354, or at a position equivalent to both positions 47 and 354, is replaced by any amino acid, in particular any amino acid except K or R; homologous proteins, the numbering of which is made from the position of the first amino acid in the sequence of SEQ ID NO: 1, The invention relates to an isolated non-naturally occurring protein or a homologous protein, wherein the isolated non-naturally occurring protein retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor.

[0012] In one embodiment, the isolated non-naturally occurring protein further comprises a substitution of the amino acid at position 8, or 209, or both positions 8 and 209, numbered from the first amino acid in the sequence of SEQ ID NO: 1, with any amino acid; Preferably, the amino acid at position 8 is substituted with any amino acid except H or Y, Preferably, the amino acid at position 209 is substituted with any amino acid except H or Y.

[0013] Advantageously, the present invention relates to an isolated non-naturally occurring protein comprising, consisting essentially of, or consisting of, the amino acid sequence set forth in SEQ ID NO: 1, TIFF0007799945000002.tif68149 or any protein derived from said protein set forth in SEQ ID NO: 1 by at least one amino acid substitution, addition or deletion, provided that said protein derived from said protein set forth in SEQ ID NO: 1 retains the boxed amino acids shown above, the amino acid at position 47, or at position 354, or at both positions 47 and 354, or at the corresponding positions in a protein derived from said protein according to SEQ ID NO: 1, is substituted by any amino acid, in particular by any amino acid except K or R, any protein, the numbering of which is made from the position of the first amino acid in the sequence SEQ ID NO: 1, The isolated non-naturally occurring protein relates to an isolated non-naturally occurring protein or any protein that retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor.

[0014] In one embodiment, the isolated non-naturally occurring protein further comprises a substitution of amino acid at position 8, or 209, or both positions 8 and 209, numbered from the first amino acid position in the sequence of SEQ ID NO: 1, with any amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1 or at the equivalent position in the homologous protein; Preferably, the amino acid at position 8 is substituted with any amino acid except H or Y, Preferably, the amino acid at position 209 is substituted with any amino acid except H or Y. The present invention is based on the unexpected observation made by the inventors that substitution of at least one amino acid residue, or a combination of two, three, or four amino acids, at positions 8, 47, 209, or 354 affects the ability of the VSV G protein to interact with its receptor (the LDL membrane receptor) while retaining its ability to induce membrane fusion, particularly at low pH.

[0015] The present invention encompasses a protein that corresponds to the native form of the Indiana strain of VSV and lacks the signal peptide, and contains the amino acid sequence of SEQ ID NO: 1. The present invention also encompasses any G protein derived from a VSV strain, provided that the protein retains the boxed amino acids in SEQ ID NO: 1. The G protein from a VSV strain may differ by the addition, substitution or insertion of at least one amino acid other than the amino acid represented by the arrow in SEQ ID NO:1.

[0016] With regard to amino acid numbering, this numbering is conventionally based in the present invention on the amino acid numbering of the native form of the G protein of VSV G Indiana, as set forth in SEQ ID NO: 1. Those skilled in the art are aware of sequence alignment algorithms and programs (e.g., ClustalW) and can easily compare the sequences of various G proteins and recalculate the exact position of a given G protein relative to the numbering given in SEQ ID NO: 1. For clarity, the amino acids at positions 8, 47, 209, and 354 are shown in bold in SEQ ID NO: 1 above. The present invention encompasses proteins containing the amino acid sequence of SEQ ID NO: 1. The present invention also encompasses any homologous G protein from a VSV strain, provided that the protein retains at least 70% identity with the amino acid sequence of SEQ ID NO: 1.

[0017] By "at least 70% identity" in the present invention is meant 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity with the sequence of SEQ ID NO:1. With regard to the percentage of identity, it is defined by the percentage of amino acid residues of SEQ ID NO: 1 that align with the same amino acids in the sequence of the homologous protein. Sequence alignments are performed using dedicated algorithms and programs (such as, for example, ClustalW).

[0018] Thus, the protein according to the invention may be derived from the following amino acid sequence: - SEQ ID NO: 2, which is the full-length VSV G protein from the Indiana strain, in which the amino acid at position 63, or at position 370, or both, is substituted with any amino acid except K or R; SEQ ID NO: 3, which is the extracellular domain of the VSV G protein from the Marraba strain, in which the amino acid at position 47, or at position 354, or both, is substituted by any amino acid except K or R; - SEQ ID NO: 4, which is the full-length VSV G protein from the Marraba strain, in which the amino acid at position 63, or at position 370, or both, is substituted with any amino acid except K or R; - SEQ ID NO: 5, which is the extracellular domain of the VSV G protein from the New Jersey strain, in which the amino acid at position 47, or at position 358, or both, is substituted with any amino acid except K or R; - SEQ ID NO: 6, which is the full-length VSV G protein from the New Jersey strain, in which the amino acid at position 63, or at position 374, or both, is substituted with any amino acid except K or R; SEQ ID NO: 7, which is the extracellular domain of the VSV G protein from the Carajas strain, in which the amino acid at position 47, or at position 358, or both, is substituted by any amino acid except K or R; SEQ ID NO: 8, which is the full-length VSV G protein from the Carajas strain, in which the amino acid at position 63, or at position 374, or both, is substituted with any amino acid except K or R; SEQ ID NO: 9, which is the extracellular domain of the VSV G protein from the Alagoa strain, in which the amino acid at position 47, or at position 354, or both, is substituted by any amino acid except K or R; - SEQ ID NO: 10, which is the full-length VSV G protein from the Alagoa strain, in which the amino acid at position 64, or at position 371, or both, is substituted with any amino acid except K or R; SEQ ID NO: 11, which is the extracellular domain of the VSV G protein from the Cocal strain, in which the amino acid at position 47 or 354, or both, is substituted by any amino acid except K or R; - SEQ ID NO: 12, which is the full-length VSV G protein from the Cocal strain, in which the amino acid at position 64, or at position 371, or both, is substituted with any amino acid except K or R; - SEQ ID NO: 13, which is the extracellular domain of the VSV G protein from the Morreton strain, in which the amino acid at position 47, or at position 354, or both, is substituted with any amino acid except K or R; and - SEQ ID NO: 14, which is the full-length VSV G protein from the Morreton strain, in which the amino acid at position 64, or position 371, or both, is substituted with any amino acid except K or R.

[0019] Through crystallographic characterization of the G protein, the inventors have shown that residues K47 and R354 are crucial for interaction with the LDL-derived receptor. If one or both residues are replaced by amino acid residues with different physical and chemical properties, the resulting G protein loses its ability to interact with cellular receptors. In contrast, the resulting protein retains its fusion properties under appropriate pH conditions.

[0020] In the present invention, the protein is isolated, meaning that it has been isolated from its natural context. The protein is non-naturally occurring, meaning that the only way to obtain this protein is to perform the substitution in the laboratory by using artificial, technical methods well known in the art.

[0021] More advantageously, the present invention relates to an isolated non-naturally occurring protein as previously disclosed, said protein comprising, consisting essentially of, or consisting of one of the following amino acid sequences: - SEQ ID NOs: 15-20; - SEQ ID NOs: 21-26; - SEQ ID NOs: 27-32; - SEQ ID NOs: 33 to 38; - SEQ ID NOs: 39-44; SEQ ID NOs: 45 to 50; and - SEQ ID NO: 51 to 56 (wherein the amino acid at position 47, or 354, or both 47 and 354, or the corresponding positions in a protein derived from said protein according to SEQ ID NO: 1, is any amino acid except K or R.) In other words, in the present invention, the amino acid Xaa corresponds to any amino acid except R or K. SEQ ID NO: 15 corresponds to the extracellular domain of the VSV G protein from the Indiana strain with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 16 corresponds to the extracellular domain of the VSV G protein from the Indiana strain with a substitution at position 354 with any amino acid except K or R. SEQ ID NO: 17 corresponds to the extracellular domain of the VSV G protein from the Indiana strain with substitutions at positions 47 and 354 with any amino acid except K or R. SEQ ID NO: 18 corresponds to the full-length VSV G protein from the Indiana strain with a substitution at position 63 with any amino acid except K or R. SEQ ID NO: 19 corresponds to the full-length VSV G protein from the Indiana strain with a substitution at position 370 with any amino acid except K or R. SEQ ID NO: 20 corresponds to the full-length VSV G protein from the Indiana strain with substitutions at positions 63 and 370 with any amino acid except K or R. SEQ ID NO: 21 corresponds to the extracellular domain of the VSV G protein from the Marraba strain with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 22 corresponds to the extracellular domain of the VSV G protein from the Marraba strain, with a substitution at position 354 with any amino acid except K or R. SEQ ID NO: 23 corresponds to the extracellular domain of the VSV G protein from the Marraba strain with substitutions at positions 47 and 354 with any amino acid except K or R.

[0022] SEQ ID NO: 24 corresponds to the full-length VSV G protein from the Marraba strain with a substitution at position 63 with any amino acid except K or R. SEQ ID NO: 25 corresponds to the full-length VSV G protein from the Marraba strain with a substitution at position 370 with any amino acid except K or R. SEQ ID NO: 26 corresponds to the full-length VSV G protein from the Marraba strain with substitutions at positions 63 and 370 with any amino acid except K or R. SEQ ID NO: 27 corresponds to the extracellular domain of the VSV G protein from the New Jersey strain with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 28 corresponds to the extracellular domain of the VSV G protein from the New Jersey strain with a substitution at position 358 with any amino acid except K or R. SEQ ID NO: 29 corresponds to the extracellular domain of the VSV G protein from the New Jersey strain with substitutions at positions 47 and 358 with any amino acid except K or R. SEQ ID NO: 30 corresponds to the full-length VSV G protein from the New Jersey strain with a substitution at position 63 with any amino acid except K or R. SEQ ID NO: 31 corresponds to the full-length VSV G protein from the New Jersey strain with a substitution at position 374 with any amino acid except K or R. SEQ ID NO: 32 corresponds to the full-length VSV G protein from the New Jersey strain with substitutions at positions 63 and 374 with any amino acid except K or R. SEQ ID NO: 33 corresponds to the extracellular domain of the VSV G protein from the Carajas strain with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 34 corresponds to the extracellular domain of the VSV G protein from the Carajas strain with a substitution at position 358 with any amino acid except K or R. SEQ ID NO: 35 corresponds to the extracellular domain of the VSV G protein from the Carajas strain with substitutions at positions 47 and 358 with any amino acid except K or R. SEQ ID NO: 36 corresponds to the full-length VSV G protein from the Carajas strain with a substitution at position 68 with any amino acid except K or R. SEQ ID NO: 37 corresponds to the full-length VSV G protein from the Carajas strain with a substitution at position 379 with any amino acid except K or R. SEQ ID NO: 38 corresponds to the full-length VSV G protein from the Carajas strain with substitutions at positions 68 and 379 with any amino acid except K or R. SEQ ID NO: 39 corresponds to the extracellular domain of the VSV G protein from the Alagoa strain, with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 40 corresponds to the extracellular domain of the VSV G protein from the Alagoa strain, with a substitution at position 354 with any amino acid except K or R. SEQ ID NO: 41 corresponds to the extracellular domain of the VSV G protein from the Alagoa strain with substitutions at positions 47 and 354 with any amino acid except K or R. SEQ ID NO: 42 corresponds to the full-length VSV G protein from the Alagoa strain with a substitution at position 64 with any amino acid except K or R. SEQ ID NO: 43 corresponds to the full-length VSV G protein from the Alagoa strain with a substitution at position 371 with any amino acid except K or R. SEQ ID NO: 44 corresponds to the full-length VSV G protein from the Alagoa strain with substitutions at positions 64 and 371 with any amino acid except K or R. SEQ ID NO: 45 corresponds to the extracellular domain of the VSV G protein from the Cocal strain with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 46 corresponds to the extracellular domain of the VSV G protein from the Cocal strain with a substitution at position 354 with any amino acid except K or R. SEQ ID NO: 47 corresponds to the extracellular domain of the VSV G protein from the Cocal strain with substitutions at positions 47 and 354 with any amino acid except K or R. SEQ ID NO: 48 corresponds to the full-length VSV G protein from the Cocal strain with a substitution at position 64 with any amino acid except K or R. SEQ ID NO: 49 corresponds to the full-length VSV G protein from the Cocal strain with a substitution at position 371 with any amino acid except K or R. SEQ ID NO: 50 corresponds to the full-length VSV G protein from the Cocal strain with substitutions at positions 64 and 371 with any amino acid except K or R. SEQ ID NO: 51 corresponds to the extracellular domain of the VSV G protein from the Morreton strain with a substitution at position 47 with any amino acid except K or R. SEQ ID NO: 52 corresponds to the extracellular domain of the VSV G protein from the Morreton strain with a substitution at position 354 with any amino acid except K or R. SEQ ID NO: 53 corresponds to the extracellular domain of the VSV G protein from the Morreton strain with substitutions at positions 47 and 354 with any amino acid except K or R. SEQ ID NO: 54 corresponds to the full-length VSV G protein from the Morreton strain with a substitution at position 64 with any amino acid except K or R. SEQ ID NO: 55 corresponds to the full-length VSV G protein from the Morreton strain with a substitution at position 371 with any amino acid except K or R. SEQ ID NO: 56 corresponds to the full-length VSV G protein from the Morreton strain with substitutions at positions 64 and 371 with any amino acid except K or R. In other words, the present invention advantageously relates to an isolated non-naturally occurring protein comprising or consisting of one of the sequences of SEQ ID NOs: 15 to 56 below, in which Xaa corresponds to any amino acid except R or K. Advantageously, the invention relates to an isolated non-naturally occurring protein as defined above, in which the amino acid at position 47, or at position 354, or at both positions 47 and 354, is substituted by A, G, F or Q, preferably by A or Q. In other words, the present invention advantageously relates to an isolated non-naturally occurring protein comprising or consisting of one of the following sequences: SEQ ID NOs: 15 to 56, in which Xaa corresponds to any amino acid except R or K.

[0023] Advantageously, the present invention relates to an isolated protein comprising, consisting essentially of or consisting of one of the following sequences SEQ ID NOs: 155 to 322. In other words, the present invention advantageously relates to an isolated protein comprising, consisting essentially of or consisting of one of the following sequences SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 2 81, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186 6, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215 , SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244,SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264, SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267, SEQ ID NO:268, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:272, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:275, SEQ ID NO:276, SEQ ID NO:277, SEQ ID NO:278, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:286, SEQ ID NO:287, SEQ ID NO:288, SEQ ID NO:289, SEQ ID NO:290, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:31 The present invention relates to an isolated protein as defined above, comprising, consisting essentially of or consisting of one of the sequences set forth in SEQ ID NO:287, SEQ ID NO:288, SEQ ID NO:289, SEQ ID NO:290, SEQ ID NO:291, SEQ ID NO:292, SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO:321 and SEQ ID NO:322.

[0024] More advantageously, the present invention relates to an isolated non-naturally occurring protein as defined above, in which the amino acid at position 8 of SEQ ID NO: 1 or at the corresponding position in a protein derived from said protein as set forth in SEQ ID NO: 1 has been substituted by any amino acid except H or Q or Y.

[0025] More advantageously, the present invention relates to an isolated non-naturally occurring protein as defined above, in which the amino acid at position 209 of SEQ ID NO: 1 or at the corresponding position in a protein derived from said protein as set forth in SEQ ID NO: 1 has been substituted by any amino acid except Y or H. More advantageously, the present invention relates to an isolated non-naturally occurring protein as defined above, wherein said protein comprises, consists essentially of or consists of one of the following amino acid sequences: SEQ ID NOs: 57 to 154.

[0026] SEQ ID NOs: 57 to 154 represent proteins in which the amino acid at position 47, or position 354, or both positions 47 and 354, or the amino acid at the corresponding positions in a protein derived from the protein set forth in SEQ ID NO: 1, is substituted with any amino acid except K or R, - the amino acid at position 8 of SEQ ID NO: 1 or at the corresponding position in a protein derived from said protein according to SEQ ID NO: 1 is substituted by any amino acid except H or Q, or preferably by any amino acid except Y, - the amino acid at position 209 of SEQ ID NO: 1 or at the corresponding position in a protein derived from said protein according to SEQ ID NO: 1 is substituted by any amino acid except Y or H, or - a protein in which the amino acid at position 8 of SEQ ID NO: 1 or at the corresponding position in a protein derived from said protein according to SEQ ID NO: 1 is substituted by any amino acid except H or Q, or preferably except Y, and the amino acid at position 209 of SEQ ID NO: 1 or at the corresponding position in a protein derived from said protein according to SEQ ID NO: 1 is substituted by any amino acid except Y or H.

[0027] More advantageously, the present invention provides Ranks 192-202, or Ranks 240-257, or Ranks 347-353, or Ranks 364-366, or 376~379th place The present invention relates to an isolated non-naturally occurring protein as defined above, further comprising the insertion of a peptide between the amino acids of SEQ ID NO: 1 and SEQ ID NO: 2, wherein said peptide originates from a protein other than the protein set forth in SEQ ID NO: 1. The inventors have determined that the insertion of a peptide originating from a protein other than the G protein of VSV within said region does not alter the fusion properties of the protein according to the invention.

[0028] In the present invention, the insertion "between amino acid positions 192-202, 240-257, 347-353, 364-366, or 376-379" means that the peptide is between two consecutive amino acids, for example, between amino acids 192 and 193, 193 and 194, 194 and 195, 195 and 196, 196 and 197, 197 and 198, 198 and 199, 199 and 200, 200 and 201, 201 and 202, 240 and 241, 241 and 242, 242 and 243, 243 and 244, 244 and 245, 245 and 246, 246 and 247, 247 and 248 , 248 and 249, 249 and 250, 250 and 251, 251 and 252, 252 and 253, 253 and 254, 254 and 255, 255 and 256, 256 and 257, 347 and 348, 348 and 349, 349 and 350, 350 and 351, 351 and 352, 352 and 353, 364 and 365, 365 and 366, 376 and 377, 377 and 378, and 378 and 379 - or means an insertion between two non-consecutively numbered amino acids due to the deletion of one or more amino acids; for example, the peptide can be inserted between the amino acids at positions 192 and 194 because the amino acid at position 193 has been deleted or replaced by the inserted peptide (etc.). Given the above description, one skilled in the art will be able to determine the locations of insertions encompassed by the present invention.

[0029] More advantageously, the present invention relates to an isolated non-naturally occurring protein as defined above, further comprising an insertion of a peptide between amino acids 351 and 352, said peptide originating from a protein other than the protein set forth in SEQ ID NO: 1. Advantageously, the present invention relates to an isolated non-naturally occurring protein as defined above, further comprising an insertion of a peptide at position 1 (i.e., at the N-terminus, i.e., upstream of the amino acid at position 1), said peptide originating from a protein other than the protein set forth in SEQ ID NO: 1. In the present invention, the insertion of a peptide at position 1 means the insertion of said peptide at the N-terminus of the non-naturally occurring protein as defined above. Thus, in this embodiment, the first amino acid residue of the sequence of said non-naturally occurring protein as defined above is conserved (maintained). In other words, said first amino acid residue at position 1 of the sequence of said non-naturally occurring protein as defined above is not deleted. In an alternative embodiment, the present invention relates to an isolated non-naturally occurring protein as defined above, further comprising an insertion of a peptide in place of the amino acid residue at position 1, said peptide originating from a protein other than the protein set forth in SEQ ID NO: 1. Thus, in this alternative embodiment, the first amino acid residue of the non-natural protein sequence defined above is deleted and replaced (i.e., substituted) with the sequence of the peptide.

[0030] Advantageously, the inventors have identified that insertions at position 1 (i.e., the N-terminus) of SEQ ID NO: 1 or between amino acid positions 351 and 352 or at corresponding positions in SEQ ID NOs: 2 to 14, and mutations at positions 47, or 354 or both, or at corresponding positions in SEQ ID NOs: 2 to 14, do not alter the fusion properties of the mutant proteins. Therefore, we propose inserting a tag peptide, a luminescent substance, a nanobody, or any peptide that specifically recognizes a membrane protein between these two amino acids in the VSV G protein, which allows it to interact with its receptor. In other words, the present inventors therefore propose to provide a mutant VSV G protein in which any peptide that allows specific targeting of the target cell is inserted between the two above-mentioned amino acids. More advantageously, the invention relates to an isolated non-naturally occurring protein as defined above, wherein said peptide is at least part of a ligand for a cellular receptor. Using the mutant proteins of the present invention with inserted peptides or nanobodies, it becomes possible to produce VSV that specifically target cells of interest, in particular tumor cells, and thus specifically kill these determined cells by using the oncolytic properties of the virus.

[0031] Indeed, in this case, the G protein according to the invention will not interact with its natural receptor (LDL-R), but will recognize a receptor that is the target for a peptide inserted between the amino acids at positions 351 and 352 of SEQ ID NO: 1 or the corresponding positions in SEQ ID NOs: 2 to 14. As the protein according to the invention retains its fusogenic properties, it allows viral entry and therefore the virus can kill the target cell. For example, the inserted peptide may be an anti-HER2 nanobody, an anti-MUC18 nanobody, or an anti-PD-1 nanobody. The present invention also relates to a nucleic acid molecule encoding an isolated non-naturally occurring protein as defined above. In other words, the present invention relates to nucleic acid molecules encoding any of the proteins set forth in SEQ ID NOs: 15 to 322 as defined above. In another aspect, the present invention relates to a recombinant virus expressing an isolated non-native protein as defined above. The preferred virus is VSV, which expresses all viral proteins in wild-type form, except for the G protein corresponding to the mutant protein according to the invention. Advantageously, the invention relates to a recombinant virus comprising a nucleic acid molecule as defined above. The present invention also relates to eukaryotic cells containing or expressing an isolated non-native protein as defined above or containing a nucleic acid molecule as defined above. Advantageously, the present invention relates to eukaryotic cells infected with a virus as defined above.

[0032] The present invention also provides the following: a protein as defined above; or a nucleic acid molecule as defined above; a virus as defined above; or Eukaryotic cells as defined above The present invention relates to a composition comprising at least one of the following: In particular, the present invention relates to compositions comprising a virus encoding a G protein comprising or consisting of one of the following sequences: SEQ ID NOs: 15-322.

[0033] The present invention also provides the following for use as a medicament: a protein as defined above; or a nucleic acid molecule as defined above; a virus as defined above; or Eukaryotic cells as defined above The present invention relates to a composition comprising at least one of the following: In particular, the present invention relates to a composition comprising a virus encoding a G protein comprising or consisting of one of the sequences set forth below in SEQ ID NOs: 15 to 322, for use as a drug. Advantageously, the invention relates to a composition as defined above, for use in treating cancer. As mentioned above, viruses expressing mutant proteins according to the invention can be used to specifically target and therefore specifically kill determined cells. The present invention relates to the in vitro use of a protein as defined above, immobilized in a surface, advantageously a lipid membrane, for targeting said surface, advantageously a lipid membrane, to a specific target, e.g. a cell, in particular a cell to be killed, such as a cancer cell.

[0034] The present invention proposes the in vitro use of proteins according to the present invention anchored to such membranes in order to specifically target the membranes to their target destinations. For example, mutant proteins according to the present invention can be anchored in the membrane of liposomes, vesicles, exosomes, capsules, nanoparticles, etc., so that the proteins according to the present invention can specifically target the liposomes, vesicles, capsules or nanoparticles to a particular target, for example, cells, in particular cells to be killed, such as cancer cells. This use is particularly advantageous for drug delivery targeting purposes, where the protein according to the invention allows specific targeting of drugs. Drugs can be therapeutic molecules, proteins, and nucleic acids. The present invention relates to a protein as defined above immobilized in a surface, advantageously a lipid membrane, for use in targeting said surface, advantageously a lipid membrane, to a specific target, e.g. a cell, in particular a cell to be killed, such as a cancer cell.

[0035] The present invention proposes proteins according to the invention anchored to such membranes for use in specifically directing such membranes to a target destination. For example, a mutant protein according to the present invention can be anchored in the membrane of a liposome, vesicle, exosome, capsule, nanoparticle, etc., so that the protein according to the present invention can specifically target the liposome, vesicle, capsule or nanoparticle to a particular target, e.g., a cell, in particular a cell to be killed, such as a cancer cell. This use is particularly advantageous for drug delivery targeting purposes, where the protein according to the invention specifically targets the drug to a particular target, e.g., a cell, in particular a cell to be killed, such as a cancer cell. Thus, the present invention relates to a mutant protein according to the invention for use as a drug delivery system, wherein the mutant protein is immobilized in the membrane of a liposome, or a vesicle, or an exosome, or on a capsule, or on a nanoparticle. Drugs can be therapeutic molecules, proteins, and nucleic acids. The invention will be better understood from the following figures and examples. [Brief explanation of the drawings]

[0036] [Figure 1] Figure 1 is a schematic representation of the modular structure of the LDL-R, showing the seven CR modules (1-7), three EGF repeats (a, b, and c), the seven-bladed β-propeller domain (β) of the epidermal growth factor precursor-like domain (B), and the C-terminal domain containing O-linked oligosaccharides (C). SP = signal peptide; X = transmembrane domain. A.: CR domain and D.: extracellular domain. [Figure 2] Figure 2 shows the results of SDS-PAGE analysis of the interaction of Gth with seven GST-CR domains (1–7) bound to GSH magnetic beads at pH 8. C represents the control. The migration positions of the proteins are indicated by arrows: A.: Gth, B.: CRx-GST, and D.: GST. [Figure 3] Figure 3 illustrates the experiment presented in Figures 6 and 7. Four hours after infection, BSR cells were labeled with an antibody against the VSV nucleoprotein (anti-VSV N antibody) to visualize infection (green fluorescence) and GST-CRATTO550 (red fluorescence) to probe CR domain recognition by surface-displayed glycoproteins. [Figure 4]Figures 4A-4I show photographs of labeling of G on the surface of VSV-infected BSR cells using fluorescent GST-CR1ATTO550, GST-CR2ATTO550, and GST-CR3ATTO550. Four hours after infection, cells were incubated with the appropriate GST-CRATTO550 for 30 minutes at 4°C, then fixed and permeabilized. Then, they were immunolabeled with an anti-VSV N antibody to visualize infection. DAPI was used to stain nuclei. Scale bars are 20 μm. Figure 4A shows labeling of cells using an anti-VSV N antibody. Figure 4B shows labeling of cells using fluorescent GST-CR1ATTO550. Figure 4C shows a fluorescent overlay of Figures 6A and 6B. Figure 4D shows labeling of cells using an anti-VSV N antibody. Figure 4E shows labeling of cells using fluorescent GST-CR2ATTO550. Figure 4F shows a fluorescent overlay of Figures 6D and 6E. Figure 4G shows cell labeling using anti-VSV N antibody. Figure 4H shows cell labeling using fluorescent GST-CR3ATTO550. Figure 4I shows the fluorescence overlay of Figures 6G and 6H. [Figure 5] Figure 5 shows representative plots of isothermal titration calorimetry (ITC) analysis between Gth and CR1, Gth and CR2, and Gth and CR3 at 20°C. Binding parameters were determined by curve-fitting analysis using a single-site binding model. Values ​​shown in the panels correspond to the curves presented. Kd values ​​reported in the text are the mean ± standard error of three independent experiments. BC: Inhibition of VSV infection by soluble forms of the CR domains. Upper x-axis: time (min); upper y-axis: μcal / sec; lower x-axis: molar ratio and lower y-axis: kcal / mol of injected material. Left panel: CR1, middle panel: CR2, and right panel: CR3. [Figure 6]Figures 6A-6F show photographs of BSR cells infected with VSV-eGFP preincubated with the indicated concentrations of GST-CR1, GST-CR2, GST-CR3 (A-C), CR1, CR2, or CR3 monovalent domains (D-F). Cells were fixed 4 hours postinfection. Only infected cells express eGFP. Neither the CR1 nor the GST-CR1 construct protects cells from infection. DAPI was used to stain nuclei. Scale bar is 100 μm. [Figure 7] FIG. 7 is a three-dimensional representation of the GthCR2 crystal structure in ribbon representation. [Figure 8] Figure 8 shows a three-dimensional representation of the GthCR3 crystal structure in ribbon format. In both complexes, the CR domains nest in the same cavity of G. The N- and C-termini of each CR are shown. The trimerization domain (TrD), pleckstrin homology domain (PHD), and fusion domain (FD) of Gth are shown. [Figure 9] Figure 9 shows a sequence alignment of LDL-R CR2 and CR3. Conserved residues are boxed in gray, and similar residues are boxed. Acidic residues involved in binding Ca ions are indicated by I, II, III, and IV. CR residues involved in polar contacts with G are labeled with gray symbols on the respective CR sequences (light gray for CR2 and black for CR3; dots if contact is established via the side chain and triangles if contact is established via the main chain). Aromatic residues that protrude from the CR module and establish hydrophobic interactions with G are indicated by arrows. [Figure 10]Figure 10A corresponds to a zoomed-in view of the Gth-CR interface, showing the docking of the G basic residues onto the acidic patch of CR2. G residues H8, K47, Y209, and R354 are involved in the interaction. Residue labels on each CR domain are shown in italics when contacts are established via the main chain; putative bonds are shown as light gray dashed lines. Figure 10B corresponds to a zoomed-in view of the Gth-CR interface, showing the docking of the G basic residues onto the acidic patch of CR3. G residues H8, K47, Y209, and R354 are involved in the interaction. Residue labels on each CR domain are shown in italics when contacts are established via the main chain; putative bonds are shown as light gray dashed lines. [Figure 11]Figures 11A-N show flow cytometry analysis of the expression of WT and mutant glycoproteins on the surface of HEK293T cells and the binding of fluorescent GST-CR2 (A-D and I-K) and GST-CR3 (E-H and L-M). Twenty-four hours after transfection, cell surface expression of WT and mutant G was assessed using the anti-G monoclonal antibody 8G5F11 directed against live cells for 1 hour at 4°C. Cells were then simultaneously incubated with anti-mouse Alexa fluor 488 and the indicated GST-CRATTO550 dye. Cells transfected with G constructs that were still able to bind to the GST-CR domain exhibited red fluorescence due to the ATTO550 dye. The percentage of ATTO550-positive cells is shown in each plot. Figure 11A shows an experiment of binding of fluorescent GST-CR2 to WT glycoprotein. Figure 11B shows an experiment of binding of fluorescent GST-CR2 to glycoprotein H8A mutant. Figure 11C shows a binding experiment of fluorescent GST-CR2 with the glycoprotein Y209A mutant. Figure 11D shows a binding experiment of fluorescent GST-CR2 with the glycoprotein K47A mutant. Figure 11E shows a binding experiment of fluorescent GST-CR3 with the WT glycoprotein. Figure 11F shows a binding experiment of fluorescent GST-CR3 with the glycoprotein H8A mutant. Figure 11G shows a binding experiment of fluorescent GST-CR3 with the glycoprotein Y209A mutant. Figure 11H shows a binding experiment of fluorescent GST-CR3 with the glycoprotein K47A mutant. Figure 11I shows a binding experiment of fluorescent GST-CR2 with the glycoprotein K47Q mutant. Figure 11J shows a binding experiment of fluorescent GST-CR2 with the glycoprotein R354A mutant. Figure 11K shows a binding experiment of fluorescent GST-CR2 with the glycoprotein R354Q mutant. Figure 11L shows an experiment of binding of fluorescent GST-CR3 to glycoprotein K47Q mutant, Figure 11M shows an experiment of binding of fluorescent GST-CR3 to glycoprotein R354A mutant, and Figure 11N shows an experiment of binding of fluorescent GST-CR3 to glycoprotein R354Q mutant. [Figure 12]Figure 12 is a schematic diagram of the cell-cell fusion assay. BSR cells are co-transfected with plasmids expressing VSV G (WT or mutant G) and P-GFP (a cytoplasmic marker). 24 hours after transfection, cells are exposed to medium adjusted to the indicated pH for 10 minutes, then replaced with DMEM at pH 7.4. Cells are then kept at 37°C for 1 hour before fixation. Upon fusion, P-GFP diffuses into the syncytium. [Figure 13]Figures 13A-13X are photographs corresponding to the results of the experiments described in Figure 20. Figure 13A shows the results of an experiment using an empty vector at pH 5.0. Figure 13B shows the results of an experiment using an empty vector at pH 5.5. Figure 13C shows the results of an experiment using an empty vector at pH 6.0. Figure 13D shows the results of an experiment using an empty vector at pH 6.5. Figure 13E shows the results of an experiment using an empty vector at pH 7.0. Figure 13F shows the results of an experiment using an empty vector at pH 7.5. Figure 13G shows the results of an experiment using a vector expressing the K47A mutant at pH 5.0. Figure 13H shows the results of an experiment using a vector expressing the GK47A mutant at pH 5.5. Figure 13I shows the results of an experiment using a vector expressing the K47A mutant at pH 6.0. Figure 13J shows the results of an experiment using a vector expressing the K47A mutant at pH 6.5. Figure 13K shows the results of an experiment using a vector expressing the K47A mutant at pH 7.0. Figure 13L shows the results of an experiment using a vector expressing the K47A mutant at pH 7.5. Figure 13M shows the results of an experiment using a vector expressing the R354A mutant at pH 5.0. Figure 13N shows the results of an experiment using a vector expressing the R354A mutant at pH 5.5. Figure 13O shows the results of an experiment using a vector expressing the R354A mutant at pH 6.0. Figure 13P shows the results of an experiment using a vector expressing the R354A mutant at pH 6.5. Figure 13Q shows the results of an experiment using a vector expressing the R354A mutant at pH 7.0. Figure 13R shows the results of an experiment using a vector expressing the R354A mutant at pH 7.5. Figure 13M shows the results of an experiment using a vector expressing the WT G protein at pH 5.0. Figure 13N shows the results of an experiment using a vector expressing the WT G protein at pH 5.5. Figure 13O shows the results of an experiment using a vector expressing the WT G protein at pH 6.0. Figure 13P shows the results of an experiment using a vector expressing the WT G protein at pH 6.5. Figure 13Q shows the results of an experiment using a vector expressing the WT G protein at pH 7.0. Figure 13R shows the results of an experiment using a vector expressing the WT G protein at pH 7.5. [Figure 14] Figure 14 shows the analysis of LDL-R expression in wild-type HAP-1 cells (A), LDL-RKO HAP-1 cells (B), and HEK293T cells (C). Immunoblots were performed on crude cell extracts and visualized using an anti-LDL-R antibody (EP1553Y-1). Tubulin (tub) was also immunoblotted as a loading control (2). [Figure 15] Figure 15 is a histogram showing the effect of RAP protein on the susceptibility of LDL-R-deficient HAP-1 cells to VSV-eGFP infection. VSV-eGFP was used to infect HAP-1 (A) and HAP-1 LDL-RKO (B) cells in the presence (gray columns) or absence (black columns) of RAP. Infectivity was determined by counting the number of cells expressing eGFP using a flow cytometer. Data represent the mean and standard error for experiments performed in triplicate. p-values ​​were determined using an unpaired Student's t-test (*p<0.01; ***non-significant). [Figure 16] Figure 16 is a schematic diagram of the generation of VSVΔG-GFP virus pseudotyped with a VSV G mutant. Transfected HEK-293T cells expressing mutant G on their surface were infected with VSVΔG-GFP pseudotyped with wild-type VSV G. Sixteen hours after infection, VSVΔG-GFP virions pseudotyped with mutant VSV G were harvested from the supernatant. [Figure 17] Figure 17 shows the incorporation of wild-type and mutant G into VSVΔG-GFP viral particles. VSVΔG-GFP pseudotyped with wild-type VSV G was used to infect HEK-293T cells transfected with the indicated mutants (MOI 1). 16 hours after infection, viral supernatants were collected, concentrated, and analyzed by Western blot (using anti-VSV G and anti-VSV M antibodies). [Figure 18]Figure 18 represents a histogram showing the infectivity of VSVΔG-GFP pseudotyped with WT and mutant glycoproteins. HEK-293T cells pre-transfected with the indicated mutant glycoproteins were infected (MOI 1) with VSVΔG-GFP pseudotyped with WT VSV G. HEK-293T, BSR, CHO, and S2 cells were infected for 6 hours with VSVΔG-GFP virus pseudotyped with WT or mutant glycoproteins; the percentage of infected cells was determined by counting the cells expressing GFP by flow cytometry. Data are presented as the mean and standard error for three independent experiments. Above each bar, the reduction factor of the titer (compared to VSVΔG-GFP pseudotyped with WT G normalized to 1) is shown. [Figure 19] Figure 19 is a photograph of HEK293T cells transfected with a pCAGGS plasmid encoding a VSV glycoprotein modified by insertion of the mCherry protein at the N-terminus (position 1 of the mature protein) and by insertion of the mCherry protein between positions 351 and 352 of the amino acids. Red fluorescence is present on the cell surface in both cases, indicating that the protein was correctly folded and transported through the Golgi apparatus. This suggests that these two positions on G are potentially interesting for inserting any peptide.

Example

[0037] (Example 1) <Structural Basis of Low-Density Lipoprotein Receptor Recognition by the VSV Glycoprotein> The inventors have identified that VSV G can independently bind to two different CR (cysteine-rich) domains (CR2 and CR3) of LDL-R, and report the crystal structure of VSV G forming a complex with these domains. The structure shows that the binding sites for CR2 and CR3 on G are identical. The inventors show that HAP-1 cells with the LDL-R gene knocked out are still susceptible to VSV infection, confirming that VSV G can use receptors other than LDL-R for entry. However, mutations in basic residues important for interaction with the LDL-R CR domain abolish VSV infectivity in mammalian as well as insect cells. This indicates that the receptors for VSV in mammalian and insect cells are only members of the LDL-R family, and that VSV G has specifically evolved to interact with its CR domain.

[0038] <The LDL-R CR2 and CR3 domains bind to VSV G and neutralize viral infectivity> The inventors individually expressed each LDL-R CR domain in a fusion with glutathione S-transferase (GST) in Escherichia coli. Each fusion protein was incubated at pH 8 with glutathione-coated magnetic beads, and then the soluble form of the extracellular domain of G was added (VSV Gth, amino acids (AA) residues 1 - 422 (Figure 2), generated by thermolysin-limited proteolysis of virus particles). After incubation for 20 minutes at 4 °C, the beads were washed and the bound proteins were analyzed by SDS / PAGE and then Coomassie blue staining. This showed that only the CR2 and CR3 domains were able to bind directly to VSV G at pH 8 (Figure 2). Furthermore, GST-CR2 and GST-CR3 (not GST-CR1) fluorescently labeled with ATTO550 (Figures 3 and 4) specifically recognized VSV G expressed on the surface of infected cells. The inventors also used isothermal titration calorimetry (ITC) to investigate the binding parameters of CR1, CR2, and CR3 to Gth in solution (Figure 5). Again, no interaction between G and CR1 was detected. On the other hand, for both CR2 and CR3, binding reactions that were considered exothermic showed a 1:1 stoichiometry and similar Kd values (4.3 ± 1 μM for CR3 and 7.3 ± 1.5 μM for CR2). Furthermore, recombinant soluble CR2 and CR3 domains can also neutralize virus infectivity when incubated alone or in a fusion with GST with the pre-infection virus inoculum. <Crystal structure of the VSV G extracellular domain complexed with the LDL-R CR domain> The inventors crystallized Gth complexed with either CR2 or CR3. The binding site of the CR domain on G is the same in both crystal forms (Figures 7 and 8).

[0039] Two basic residues of G (H8 derived from TrD and K47 derived from PHD) are oriented towards two acidic residues (D69 and D73 on CR2; D108 and D112 on CR3-labeled I and II - Figure 9) belonging to the octahedral calcium cage of the CR domain. Together with Y209 and R354, they are thought to be important for the interaction (Figures 10A and B).

[0040] <K47 and R354 are important residues of G required for LDL-R CR domain binding> To investigate their contribution to LDL-R CR domain binding, the inventors mutated the residues H8, K47, Y209, and R354 of G to alanine or glutamine. HEK293T cells were transfected with plasmids encoding wild-type or mutant VSV G glycoproteins (WT, H8A, K47A, K47Q, Y209A, R354A, and R354Q). Twenty-four hours after transfection, the cells were incubated with MAb against the G extracellular domain. Subsequently, a green fluorescent anti-IgG secondary antibody and a GST-CR fusion protein fluorescently labeled with ATTO550 were added simultaneously. Immunofluorescent labeling showed that WT and all G variants were efficiently transported to the cell surface (Figure 11). The H8A and Y209A variants bind to the GST-CR domain as WT G, while the other variants are affected in their binding ability (Figure 11). The K47Q, R354A, and R354Q variants do not bind to either GST-CR2 or GST-CR3. Finally, no interaction is detected between the K47A variant and CR3, but residual binding activity is observed between this variant and CR2 (Figure 11).

[0041] The inventors also checked the fusion properties of the K47A and R354A mutants. For this, BSR cells were transfected with pCAGGS plasmids encoding wild-type or mutant VSV G glycoproteins (WT, K47A, and R354A). Cells expressing the mutant G proteins have a fusion phenotype similar to that of WT G (Figure 13). This confirms that the mutant glycoproteins are correctly folded and demonstrates that G fusion activity and receptor recognition can be separated. <Other LDL-R family members are alternative receptors for VSV> HAP-1 cells with the LDL-R gene knocked out (HAP-1 LDL-RKO) (Figure 14) are as susceptible to VSV infection as WT HAP-1 cells (Figure 15). This demonstrates that VSV receptors other than LDL-R are present on the surface of HAP-1 cells.

[0042] To evaluate the role of other LDL-R family members as VSV receptors, the inventors utilized the properties of receptor-associated protein (RAP), a common ligand for all LDL-R family members that blocks ligand binding to all LDL-R family members except LDL-R itself (Finkelshtein et al., 2013). RAP significantly inhibits VSV infection in HAP-1 LDL-RKO but not in WT HAP-1 cells (Figure 15). These results are consistent with previous data (Finkelshtein et al., 2013) suggesting that VSV can use other LDL-R family members as alternative receptors.

[0043] <G mutants affected in the CR domain binding site cannot rescue recombinant VSV lacking the G gene> We then tested whether the mutant glycoproteins could sustain viral infection. We used a recombinant VSV (VSVΔG-GFP) in which the G envelope gene was replaced with the green fluorescent protein (GFP) gene and pseudotyped with the VSV G glycoprotein. This pseudotyped recombinant was used to infect HEK cells transfected with or without a plasmid encoding the WT or mutant glycoprotein (Ferlin et al., 2014). After 8 hours, the infected cell supernatant was collected (Figure 16). Incorporation of the mutant glycoprotein into the envelope of particles present in the supernatant was verified by Western blot (Figure 17). The infectivity of the pseudotyped particles was analyzed in different cell lines (mammalian HEK, BSR, CHO, and Drosophila S2 cells) by counting GFP-expressing cells by flow cytometry at 4 hours postinfection (pi) (Figure 18). The K47A, K47Q, R354A, and R354Q mutants did not rescue the infectivity of VSVΔG-GFP. Compared to WT G, the infectivity was reduced by 10- to 120-fold (Figure 18). This reduction was more significant in the HEK and S2 cell lines than in the two hamster cell lines. In mammalian cell lines, the H8A and Y209A mutants were able to rescue the infectivity of VSVΔG-GFP, but at a lower level than that of WT. In the S2 cell line, their infectivity was significantly reduced (15-fold for the H8A mutant and approximately 6-fold for the Y209A mutant) (Figure 18).

[0044] Because the fusion activity of the mutants is unaffected, the loss of infectivity of pseudotypes carrying the mutant glycoproteins can safely be attributed to their inability to recognize cellular receptors. These results indicate that the K47A, K47Q, R354A, and R354Q mutants, which are unable to bind to the LDL-R CR domain, also have significantly impaired ability to bind to other VSV receptors.

[0045] <Consideration> The LDL-R has been shown to be the primary entry site for VSV and lentiviruses pseudotyped with VSV-G (Finkelshtein et al., 2013). Here, we demonstrate that VSV-G can bind to the two CR domains of LDL-R with similar affinity. The biological relevance of this interaction was demonstrated by the ability of both CR2 and CR3 to inhibit VSV infection. Crystal structures of VSV G complexed with CR2 and CR3 show that they both occupy the same site on the surface of the glycoprotein in its prefusion conformation, and that the same G residues ensure the correct anchoring of the CR domains. This binding site is split apart when G is in its postfusion conformation, explaining why G cannot bind to the CR domains at low pH. This may disrupt the interaction between G and LDL-R in the endosomal lumen and support virion transport to the appropriate fusion site.

[0046] VSV G recognizes the CR domain through the basic residues K47 and R354, which are directed toward the acidic residues that coordinate calcium. This binding mode is very similar to that observed for endogenous ligand recognition by the CR domain of LDL-R family members. Indeed, mutant glycoproteins in which either K47 or R354 is replaced with alanine or glutamine are unable to bind to the CR domain. It is noteworthy that these key residues are not conserved among vesiculoviruses. Therefore, the use of LDL-R as a viral receptor cannot be generalized to other members of the genus. Indeed, we have shown that CHAV G, which lacks basic residues at positions corresponding to VSV residues 47 and 354, does not bind to the CR domain.

[0047] Our functional analysis confirms that LDL-R is not the only receptor for VSV, as HAP-1 LDL-RKO cells can be infected as efficiently as HAP-1 cells. However, mutant glycoproteins unable to bind to the CR domain are unable to restore VSVΔG-GFP infectivity in either mammalian or insect cells. The most parsimonious interpretation of this result is that the only receptor for VSV in HEK cells is a member of the LDL-R family. The molecular basis for the interaction is the same for all these receptors and involves the ability of G to bind to their CR domain. This is consistent with the reduced infectivity observed in the presence of RAP proteins, which are antagonists of other members of the LDL-R family. Overall, this study demonstrates that VSV G has specifically evolved to interact with the CR domain of members of the LDL-R family. The ubiquity of this receptor family (which is also widespread among invertebrates) explains the broad tropism of VSV.

[0048] The demonstration that VSV receptors are all members of the LDL-R family, together with the characterization of the molecular basis for CR domain recognition by G, paves the way for the development of recombinant VSV with altered tropism. Indeed, glycoproteins with (i) point mutations that eliminate the tropism of the native receptor and (ii) insertions of protein domains or peptides that specifically target tumor cells (Ammayappan et al., 2013) should enable the design of fully retargeted oncolytic VSV. Such viruses should be able to eliminate cancerous cells while sparing normal cells.

[0049] <Cells and viruses> BSR, a clone of BHK-21 (baby hamster kidney cells; ATCC CCL-10), and HEK-293T (human embryonic kidney cells expressing simian virus 40 T antigen; ATCC-CRL-3216) cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). HAP-1 wt and HAP-1 LDL-R-deficient cells (HAP-1 LDL-RKO), purchased from Horizon Discovery, were grown in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% FCS. CHO (a cell line derived from Chinese hamster ovary) cells were grown in Ham's F12 medium supplemented with 2 mM glutamine and 10% FCS. All mammalian cell lines were maintained at 37°C in a humidified incubator containing 5% CO2. Drosophila S2 cells were grown at 28°C in Schneider's medium supplemented with 10% FCS. Wild-type VSV (Mudd-Summer strain, Indiana serotype), VSVΔG-GCHAV ( Rose et al., 2000 ), and VSV-eGFP were propagated in BSR cells. VSVΔG-GFP is a recombinant VSV derived from a full-length cDNA clone of the VSV genome (Indiana serotype) pseudotyped with the VSV G protein, in which the G protein coding region was replaced with a modified GFP gene (Ferlin et al., 2014). VSVΔG-GFP was propagated in HEK-293T cells pretransfected with pCAGGS-VSVG.

[0050] Plasmids and cloning Point mutations were created in the pCAGGS plasmid starting from the cloned VSV G gene (Indiana Mudd-Summer strain). Briefly, forward and reverse primers containing the desired mutations were combined separately with one of the primers flanking the G gene to generate two PCR products. These two G gene fragments overlapped in the region containing the mutations and were assembled in the pCAGGS linearized vector using a Gibson assembly reaction kit (New England Biolabs). Protein expression, purification, and labeling VSV Gth was obtained by limited proteolysis of virus particles and purified as previously described ( Albertini et al., 2012a ).

[0051] DNA sequences encoding the seven CR domains of human LDL-R (NM_000527, GenBank) were synthesized (MWG biotech) and subcloned into the pGEX-6P1 bacterial expression vector (Invitrogen). Each protein construct contained a GST tag and a preScission protease cleavage site at its N-terminus. Each CR domain was purified using the following protocol derived from (Harper and Speicher, 2011). C41 bacteria transformed with the CR constructs were grown in LB-ampicillin medium at 37°C until the OD reached 0.6 AU. Protein expression was then induced with 1 mM IPTG for 5 hours at 37°C. Cells were sonicated in lysis buffer (500 mM NaCl, 20 mM Tris-HCl pH 8, 2 mM CaCl2, 2% w / v sarkosyl, and 1 mM DTT). The clarified supernatant was incubated with glutathione agarose beads (Thermo Fisher Scientific) in the presence of 0.2% Triton X100 for 2 hours. After incubation, the beads were then thoroughly washed with equilibration buffer (200 mM NaCl, 50 mM Tris HCl pH 8, 2 mM CaCl2, 1 mM PMSF). The GST-CR constructs were then eluted with the same buffer supplemented with 20 mM GSH. Purification of each GST-CR was achieved using a gel filtration step using a Superdex 200 column (Ge Healthcare). To isolate the CR domain, the purified GST-CR was incubated with preScission protease and injected onto a gel filtration column, Superdex 75 (Ge Healthcare). Fractions containing the pure CR domain were then pooled, concentrated to 1 mM, and stored at -80°C until use. One milligram of purified GST-CR2 (or GST-CR3) was labeled with the fluorescent dye ATTO550 NHS ester (Sigma-Aldrich) using the manufacturer's instructions. The labeled protein was then diluted to a concentration of 50 μM and stored at -80°C until use. The labeling ratio was estimated to be approximately two dyes per molecule.

[0052] <Characterization of the binding between G and the CR domain> The purified GST-CR domain was incubated with magnetic beads coated with GSH (Eurogentec) under stirring at 4 °C for 20 minutes. Subsequently, the slurry was washed with an equilibration buffer of appropriate pH (200 mM NaCl, 2 mM CaCl2, 50 mM Tris-HCl pH 8 or 50 mM MES-NaOH pH 6). The purified Gth or virus particles were pre-incubated in this same buffer for 20 minutes and added to the magnetic beads bound to the GST-CR construct or GST only. After incubation for 20 minutes under gentle stirring, the slurry was washed twice with an equilibration buffer of appropriate pH (either 8 or 6). The beads were resuspended in gel loading buffer and analyzed directly on SDS PAGE.

[0053] <Binding of the CR domain to cells expressing G (WT or mutants)> For microscopic observation, BSR cells were infected for 4 hours and then incubated with GST-CR2ATTO550 or GST-CR3ATTO550 at 4 °C for 30 minutes. The cells were fixed with 4% paraformaldehyde and then permeabilized using 0.5% Triton X-100. Nuclear proteins were detected by using a mouse anti-VSV N monoclonal antibody. Goat anti-mouse Alexa fluor 488 (Invitrogen) was used as the secondary antibody. Images were captured using a Leica SP8 confocal microscope (63x oil immersion objective lens).

[0054] For flow cytometry experiments, HEK-293T cells were transfected with pCAGGS plasmids encoding WT or mutant G using polyethyleneimine (PEI, Sigma-Aldrich). Twenty-four hours after transfection, cells were harvested and incubated with a mouse anti-G monoclonal antibody (8G5F11, KeraFast) that recognizes the G extracellular domain. Subsequently, goat anti-mouse Alexa fluor 488 antibody and GST-CR2ATTO550 (or GST-CR3ATTO550) were added to the cells simultaneously. Cellular fluorescence was determined using a BD Accuri C6 flow cytometer.

[0055] <Pseudotype> HEK-293T cells at 80% confluence density were transfected with pCAGGS encoding WT or mutant VSV G using PEI. Twenty-four hours after transfection, the cells were infected with VSVΔG-GFP at an MOI of 1. Two hours after infection, the cells were washed to remove residual virus from the inoculum. The cell supernatant containing pseudotyped virus particles was collected 16 hours after infection. The infectivity titer of the pseudotyped virus was determined on non-transfected cells by counting the cells expressing GFP using a BD Accuri C6 flow cytometer 4 hours after infection. Incorporation of WT and mutant G into the pseudotyped particles was evaluated by SDS PAGE and Western blot analysis using anti-VSV G antibody and anti-VSV M antibody after supernatant concentration.

[0056] <Infection of HAP-1 cells> HAP-1 cells were seeded at 70% confluence density and incubated with 50 nM RAP for 15 minutes or not incubated. Subsequently, the cells were infected with VSV-eGFP at an MOI of 1. RAP was maintained for all infection times. The percentage of infected cells (GFP positive) was determined using a BD Accuri C6 flow cytometer 4 hours after infection.

[0057] <itc> ITC experiments were performed at 293 K using a MicroCal iTC200 instrument (GE Healthcare) in a buffer consisting of 150 mM NaCl, 20 mM Tris-HCl pH 8.0, and 2 mM CaCl. Gth at a concentration of 50 μM was titrated by sequential injections of the CR domain at a concentration of 600 μM. The titration sequence included an initial 1 μL injection, followed by 19 injections of 2 μL each, with an interval of 180 or 240 seconds between injections. Raw data were analyzed using OriginLab software (GE Healthcare). Binding parameters were extracted from curve-fitting analysis using a single-site binding model.

[0058] <Cell-cell fusion assay> Cell-cell fusion assays were performed as previously described (Ferlin et al., 2014). Briefly, BSR cells plated on glass coverslips at 70% confluence were co-transfected with the pCAGGS plasmid encoding wild-type G or mutant G and the P-GFP plasmid encoding the rabies virus phosphoprotein fused to GFP. 24 h after transfection, cells were incubated with fusion buffer (DMEM-10 mM MES) at various pHs (5.0–7.5) for 10 min at 37°C. Cells were then washed once and incubated with DMEM-10 mM HEPES-NaOH, 1% BSA, pH 7.4 for 1 h at 37°C. Cells were fixed with 4% paraformaldehyde in 1x PBS for 15 min. Cell nuclei were stained with DAPI, and syncytium formation was analyzed using a Zeiss Axiovert 200 fluorescence microscope equipped with a 10x magnification lens. <Literature> Albertini, AAV, Baquero, E., Ferlin, A., and Gaudin, Y. (2012b). Molecular and Cellular Aspects of Rhabdovirus Entry. Viruses 4, 117-139. Amirache, F., Levy, C., Costa, C., Mangeot, P.E., Torbett, B.E., Wang, C.X., Negre, D., Cosset, F.L., and Verhoeyen, E. (2014). Mystery solved: VSV-G-LVs do not allow efficient gene transfer into unstimulated T cells, B cells, and HSCs because they lack the LDL receptor. Blood 123, 1422-1424. Ammayappan, A., Peng, K.W., and Russell, S.J. (2013). Characteristics of oncolytic vesicular stomatitis virus displaying tumor-targeting ligands. J Virol 87, 13543-13555. Barber, G.N. (2005). VSV-tumor selective replication and protein translation. Oncogene 24, 7710-7719. Ferlin, A., Raux, H., Baquero, E., Lepault, J., and Gaudin, Y. (2014). Characterization of pH-sensitive molecular switches that trigger the structural transition of vesicular stomatitis virus glycoprotein from the postfusion state toward the prefusion state. J Virol 88, 13396-13409. Finkelshtein, D., Werman, A., Novick, D., Barak, S., and Rubinstein, M. (2013). LDL receptor and its family members serve as the cellular receptors for vesicular stomatitis virus. Proceedings of the National Academy of Sciences of the United States of America 110, 7306-7311. Roche, S., Bressanelli, S., Rey, FA, and Gaudin, Y. (2006). Crystal structure of the low-pH form of the vesicular stomatitis virus glycoprotein G. Science 313, 187-191. Roche, S., Rey, FA, Gaudin, Y., and Bressanelli, S. (2007). Structure of the prefusion form of the vesicular stomatitis virus glycoprotein g. Science 315, 843-848.

[0059] Example 2 <Preparation of a plasmid encoding modified G> Constructs of pCAGGS plasmids containing the desired coding G sequence with mCherry inserted at various positions were generated using a Gibson assembly reaction. The empty vector pCAGGS was linearized using EcoRI restriction enzyme. Three overlapping PCR products were then generated. Product I is the fragment of G preceding the insertion site; it is amplified using primers Ia and Ib1 to insert mCherry at position 1 and primers Ia and Ib2 to insert mCherry at position 351. 351 PCR is performed on the VSV G gene using the primers IIa1 and IIb1 to insert mCherry at position 1 and primer IIa1 to insert mCherry at position 351. Product II is the mCherry gene (primers IIa1 and IIb1 to insert mCherry at position 1 and primer IIa 351 and IIb 351 (Product III is the fragment of G after the insertion site; it is prepared using primers IIIa1 and IIIb to insert mCherry at position 1 and primer IIIa to insert mCherry at position 351.) 351 and IIIb.

[0060] Primer sequences were synthesized by Eurofins Genomics: Ia: TCTCATCATTTTGGCAAAGATGAAGTGCCTTTTGTACTTAG (SEQ ID NO: 332) Ib1: TTGCTCACCATGCAATTCACCCCAATGAATAAAAAG (SEQ ID NO: 333) Ib 351 : GCTCACCATAGTTCCACTGATCATTCCGACC (SEQ ID NO: 334) IIa1: CATTGGGGTGAATTGCATGGTGAGCAAGGGC (SEQ ID NO: 335) IIa 351 : AATGATCAGTGGAACTATGGTGAGCAAGGGC (SEQ ID NO: 336) IIb1: AAAIIb1CTATGGTGAACTTCTTGTACAGCTCGTCC (SEQ ID NO: 337) IIb 351 :GTTCCCTTTCTGTGGTCTTGTACAGCTCGTCC (SEQ ID NO: 338) IIIa1: GAGCTGTACAAGAAGTTCACCATAGTTTTTCCACACA (SEQ ID NO: 339) IIIa 351 :CTGTACAAGACCACAGAAAGGGAACTGT (SEQ ID NO: 340) IIIb: CCGCCCGGGAGCTCGTTACTTTCCAAGTCGGTTC (SEQ ID NO: 341) After purifying each fragment on an agarose gel, the three fragments plus the purified, digested pCAGGS vector were combined in equimolar concentrations and assembled via a Gibson assembly reaction. The DNA was then transformed into bacteria, and the correct plasmid product was amplified after identification by restriction digestion and / or sequencing.

[0061] Example 3 <Transient expression of modified VSV glycoproteins> The transfection protocol will depend on the type of cells to be transduced. For HEK cells, we use a polyethyleneimine (PEI) transfection protocol. For BHK, we use a calcium phosphate transfection protocol or PEI.

[0062] Cells grown on coverslips were transfected with the pCAGGS plasmid encoding the VSV modified glycoprotein. 20 hours after transfection, cells were fixed with 4% paraformaldehyde in PBS. After washing (three times with PBS), cover slides were mounted with immu-mount DAPI (Thermofisher) and examined using a Zeiss microscope. Red fluorescence was present at the cell surface in both cases, indicating that the protein had passed through the Golgi apparatus and was correctly folded (Figure 19). The present invention is not limited to the above embodiments. Preferred embodiments of the present invention are as follows. [1] An isolated non-naturally occurring protein comprising the amino acid sequence set forth in SEQ ID NO: 1, which is the amino acid sequence of the extracellular domain of VSV Indiana strain, at least one amino acid at positions 8, 47, 209 and 354, numbered from the position of the first amino acid in the sequence of SEQ ID NO: 1, is substituted by an amino acid different from the amino acid shown at that position in said sequence of SEQ ID NO: 1, the substitution at position 8 is with any amino acid different from the amino acid shown at that position in SEQ ID NO: 1, except Y; and the isolated non-naturally occurring protein, wherein the substitution at position 209 is with any amino acid other than H that is different from the amino acid shown at that position in the sequence of SEQ ID NO: 1; or Any homologous protein derived from the protein set forth in SEQ ID NO: 1 by substitution, addition or deletion of at least one amino acid, provided that the derived protein retains at least 70% identity with the amino acid sequence set forth in SEQ ID NO: 1, and that the derived protein retains the ability to induce membrane fusion and to interact with the LDL membrane receptor; at least one amino acid of said homologous protein located at a position equivalent to positions 8, 47, 209 and 354 of said sequence of SEQ ID NO: 1 is replaced by an amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1, the substitution of the amino acid located at the position equivalent to position 8 is with any amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1, except Y; and The homologous protein, wherein the substitution of the amino acid located at the position equivalent to 209 is with any amino acid other than the amino acid shown at that position in the sequence of SEQ ID NO: 1, except H, The isolated non-native protein retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor. The isolated non-naturally occurring protein or homologous protein. [2] the following amino acid sequence: - SEQ ID NOs: 15-20; - SEQ ID NOs: 21-26; - SEQ ID NOs: 27-32; - SEQ ID NOs: 33 to 38; - SEQ ID NOs: 39-44; SEQ ID NOs: 45 to 50; and - SEQ ID NO: 51 to 56 The isolated non-naturally occurring protein according to [1], comprising one of the following: [3] The isolated non-naturally occurring protein according to [1] or [2], wherein the amino acid at positions 47 or 354, or both 47 and 354, is substituted with any amino acid except K or R, particularly A, G, F, or Q, preferably A or Q. [4] The isolated non-naturally occurring protein of [3], further comprising a substitution of the amino acid at position 8 and / or 209 with any amino acid different from the amino acid shown at that position in the sequence of SEQ ID NO: 1 or the amino acid shown at the equivalent position in the homologous protein. [5] The isolated non-naturally occurring protein according to any one of [1] to [4] above, wherein the amino acid at position 8 is substituted with any amino acid except H, Q, or Y. [6] The isolated non-naturally occurring protein according to any one of [1] to [5] above, wherein the amino acid at position 209 is substituted with any amino acid except Y or H. [7] The isolated non-naturally occurring protein according to any one of [1] to [6] above, which comprises one of the amino acid sequences of SEQ ID NOs: 57 to 154. [8] Ranks 192-202, or Ranks 240-257, or Ranks 347-353, or Ranks 364-366, or 376~379th place further comprising a peptide insertion between the amino acids of The isolated non-naturally occurring protein according to any one of [1] to [7] above, wherein the peptide is derived from a peptide other than the protein set forth in SEQ ID NO:1. [9] The isolated non-naturally occurring protein according to any one of [1] to [7] above, further comprising a peptide insertion between the amino acids at positions 1 or 351 and 352, wherein the peptide is derived from a protein other than the protein set forth in SEQ ID NO: 1.

[10] The isolated non-naturally occurring protein according to [8] or [9], wherein the peptide is at least a portion of a ligand for a cell receptor, preferably a nanobody, such as an anti-HER2 nanobody, an anti-MUC18 nanobody, or an anti-PD-1 nanobody.

[11] A nucleic acid molecule encoding the isolated non-naturally occurring protein according to any one of [1] to

[10] above.

[12] A recombinant virus that expresses the isolated non-naturally occurring protein according to any one of [1] to

[10] above.

[13] A recombinant virus comprising the nucleic acid molecule described in

[11] .

[14] A eukaryotic cell containing or expressing the non-naturally occurring protein described in any one of [1] to

[10] , or containing the nucleic acid molecule described in

[11] , or infected with the virus described in

[12] or

[13] .

[15] For use as a drug, the following: The protein according to any one of [1] to

[10] above; or The nucleic acid molecule according to

[11] above; The virus according to

[12] or

[13] ; or The eukaryotic cell according to

[14] . A composition comprising at least one of:

[16] The composition described in

[15] above, for use in treating cancer.

[17] In vitro use of the protein according to any one of [1] to

[10] above for targeting a lipid membrane to a specific target, for example, a cell, particularly a cell to be killed, such as a cancer cell, wherein the protein is immobilized on the lipid membrane.

[18] A protein according to any one of [1] to

[10] above, for targeting a lipid membrane to a specific target, for example, a cell, particularly a cell to be killed, such as a cancer cell, wherein the protein is fixed to the lipid membrane. < / itc>

Claims

1. An isolated mutant protein having an amino acid substitution of a protein comprising the amino acid sequence set forth in SEQ ID NO: 1 or a homologous protein comprising an amino acid sequence having at least 95% identity to SEQ ID NO: 1, The substitution is - substitution of the amino acid at position 47 of SEQ ID NO: 1 or at the equivalent position in a homologous protein with glutamine (Q), or - substitution of the amino acid at position 354 of SEQ ID NO: 1 or the equivalent position in a homologous protein with alanine (A) or glutamine (Q), or - substitution of the amino acids at both positions 47 and 354 of SEQ ID NO: 1 or the equivalent positions of a homologous protein with alanine (A) or glutamine (Q), and the isolated mutant protein retains the ability to induce membrane fusion and is unable to interact with the LDL membrane receptor. The isolated mutant protein.

2. 2. The isolated mutant protein of claim 1, wherein the amino acid at position 47 of SEQ ID NO: 1 is substituted with Q, or the amino acids at positions 354 or both 47 and 354 are substituted with A or Q.

3. 3. The isolated mutant protein of claim 2, wherein both amino acids at positions 47 and 354 of SEQ ID NO: 1 are substituted with A or Q.

4. Ranks 192-202, or Ranks 240-257, or 347th to 353rd place, or 364th to 366th place, or 376th to 379th further comprising a peptide insertion between the amino acids of The isolated mutant protein according to any one of claims 1 to 3, wherein the peptide is derived from a peptide different from the protein set forth in SEQ ID NO:

1.

5. 4. The isolated mutant protein of any one of claims 1 to 3, further comprising a peptide insertion between amino acids 1 or 351 and 352, wherein said peptide is derived from a protein other than the protein set forth in SEQ ID NO:

1.

6. The isolated mutant protein of claim 4 or 5, wherein the peptide is a nanobody.

7. A nucleic acid molecule encoding the isolated mutant protein according to any one of claims 1 to 6.

8. A recombinant virus expressing the isolated mutant protein of any one of claims 1 to 6.

9. A recombinant virus comprising the nucleic acid molecule of claim 7.

10. A eukaryotic cell containing or expressing an isolated mutant protein according to any one of claims 1 to 6, or containing a nucleic acid molecule according to claim 7, or infected by a virus according to claim 8 or 9.

11. below: An isolated mutant protein according to any one of claims 1 to 6; or A nucleic acid molecule according to claim 7; or A virus according to claim 8 or 9; or The eukaryotic cell of claim 10 A pharmaceutical composition for use in treating cancer, comprising at least one of:

12. 10. In vitro use of a protein according to any one of claims 1 to 6 for targeting a lipid membrane to a cell, wherein said protein is anchored to said lipid membrane.

13. A pharmaceutical composition for use in targeting a lipid membrane to a cell, comprising the protein of any one of claims 1 to 6, wherein the protein is immobilized in the lipid membrane.

Images