Cas9 retroviral integrase and Cas9 recombinase systems for targeted incorporation of DNA sequences into the genome of cells or organisms

A modified Cas9-integrase system allows for precise insertion of DNA sequences into specific genomic locations, addressing the limitations of current genome editing methods by enhancing targeting specificity and reducing off-target cleavage.

JP7882491B2Inactive Publication Date: 2026-06-30SOHM INC
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
SOHM INC
Filing Date
2021-07-01
Publication Date
2026-06-30
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current genome editing technologies lack the ability to precisely insert full-length gene sequences into specific locations in a genome without causing off-target cleavage or disruption.

Method used

A system utilizing a modified Cas9 protein linked to a viral integrase or recombinase, such as HIV integrase, with a DNA-targeting ability, enables the specific insertion of DNA sequences into the genome using a guide RNA, avoiding DNA cleavage and enhancing targeting specificity.

Benefits of technology

Enables precise and targeted incorporation of DNA sequences into the genome, reducing off-target effects and improving the accuracy of genome editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007882491000143
    Figure 0007882491000143
  • Figure 0007882491000144
    Figure 0007882491000144
  • Figure 0007882491000145
    Figure 0007882491000145
Patent Text Reader

Abstract

To provide novel genome engineering technologies that will allow the incorporation of DNA sequences into a specific location in a genome.SOLUTION: Provided is a nucleic acid construct comprising: a) a first polynucleotide sequence encoding a Cas9, an inactive Cas9, or a Cpf1, or a part thereof; b) a second polynucleotide sequence encoding an integrase, a recombinase, or a transposase, or a part thereof; and c) a third polynucleotide sequence encoding a nucleic acid linker. The first polynucleotide sequence comprises 5' and 3' ends, the second polynucleotide sequence comprises 5' and 3' ends, and the 3' end of the first polynucleotide is connected to the 5' end of the second polynucleotide by the nucleic acid linker, and the first and second polynucleotides are expressed as a fusion protein in a cell or an organism.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62,140,454, filed Mar. 31, 2015; U.S. Provisional Patent Application No. 62,210,451, filed Aug. 27, 2015; and U.S. Provisional Patent Application No. 62,240,359, filed Oct. 12, 2015, the entire contents of each of which are incorporated herein by reference for all purposes.

[0002] This disclosure relates to the use of modified proteins having genome-specific DNA-binding proteins, such as Cas9 (CRISPR (clustered, regularly spaced, short palindromic repeats) protein), TALE, and zinc finger proteins), linked by a linker to a viral integrase (e.g., HIV or MMTV integrase) or recombinase, to deliver a DNA sequence (or gene of interest) of interest to a target site in the genome of a cell or organism. The use of Cas9, which is inactive in its function of DNA cleavage, allows for the use of the DNA-targeting ability of the Cas9 protein by the use of an RNA guide (gRNA) without causing DNA disruption as intended in other systems for homologous recombination. The use of zinc finger proteins or TALE (modified proteins that bind to specific sequences of DNA) linked to a viral integrase or recombinase is also disclosed. This system may be used for research and therapeutic purposes. For example, donor DNA containing a gene of interest can be easily introduced into the host genome without the possibility of off-target cleavage through conventional methods. Donor DNA may also be modified to facilitate "knockout" strategies. We also discuss a novel strategy for improving the specificity of Cas9 targeting. This strategy uses surface-bound dCas9 (Cas9 that is inactive in terms of its DNA cleavage ability) along with the guide RNA and genomic DNA in an assay to determine which guide RNA leads to specific targeting of Cas9. This is particularly important in the in vivo application of CRISPR / Cas9 and overcomes the limitations of current in silico predictive models, although it can also be used in combination with in silico predictive models, as it allows for knowledge-based determination of which gRNA to use in the assay. [Background technology]

[0003] Recent advances in genome sequencing technologies and analytical methods have significantly accelerated the ability to classify and map genetic / genomic factors associated with a wide range of biological functions and diseases. Precise genome targeting technologies are needed to enable the selective disruption of individual genetic elements and to allow for the systematic reverse modification of causative genetic mutations, thereby advancing synthetic biology, biotechnology, and medical applications. Genome editing technologies such as designer zinc fingers, activator-like effectors (TALEs), CRISPR / Cas9, or meganucleases are available to induce targeted genome disruption, and there is still a need for new genome modification technologies that enable the incorporation of DNA sequences (including full-length gene sequences) to specific locations in a given genome. This would enable the creation of cell lines or transgenic organisms that express modified genes, or the replacement of dysfunctional genes in subjects that require them.

[0004] Integrases are viral proteins that enable the insertion of viral nucleic acids into host genomes (mammals, humans, mice, rats, monkeys, frogs, fish, plants (including crops and experimental plants such as Arabidopsis), research or medical biological cell lines or primary cell cultures, C. elegans, flies (such as Drosophila). Integrases use host DNA-binding proteins to bind the integrase to the host genome in order to integrate the viral nucleic acid sequence into the host genome. Integrases are found in retroviruses such as HIV (human immunodeficiency virus). Integrases depend on the sequence on the viral gene for inserting their genome into host DNA. Leavitt et al (Journal of Biological Chemistry, 1993, volume 268, pages 2113-2119) investigated the function of HIV1 integrase using site-directed mutagenesis and in vitro studies. Leavitt also studied the insertion of HIV1 into the host genome by viral integrase. The sequences of the U5 and U3 HIV1 att sites, which are important for the incorporation of DNA (generated after reverse transcription), are also shown.

[0005] This disclosure improves current genome editing techniques by enabling the specific insertion of a desired nucleic acid (DNA) sequence into the genome at a specified location. A recombinant modified integrase (or recombinase) having DNA-binding ability binds to a given DNA sequence in the genome and recognizes the provided DNA sequence and / or homologous arm having an integrase-recognition domain (such as an HIV1 (or other retroviral) att site) to site-specifically insert the given nucleic acid sequence into the genome. Certain aspects of this disclosure include inserting a DNA sequence of a stop codon (UAA, UAG, and / or UGA) immediately after the transcription start site of a gene. This enables effective inhibition of gene transcription in the genome of a cell or organism. [Overview of the project]

[0006] This disclosure describes how to ligate a retroviral integrase with a DNA targeting technique, including zinc finger proteins, TALENs, and CRISPR / Cas9 or other CRISPR protein-like Cpf1, to form a DNA-targeting integrase. A gene of interest (GOI) can then be provided with the DNA-targeting integrase, which can be incorporated into the genome in a targeted manner. Homologous arms are used to design the GOI to provide an additional level of specificity for its insertion into the genome.

[0007] This disclosure relates, in particular, to the use of a DNA-insufficient variant of Cas9 for ligation with retroviral integrases.

[0008] This disclosure includes: A) a system comprising a viral integrase (or bacterial recombinase) covalently bound to, for example, a Cas protein that does not have DNA cleavage ability (e.g., Cas9); or the viral integrase (or recombinase) covalently bound to a TALE protein or zinc finger protein, in which case these proteins are designed to target specific sequences of DNA in the genome; which may be provided in an expression vector or as a purified protein; B) a gene (or DNA sequence of interest) with or without homologous arms to be integrated into the desired genome; the GOI or DNA sequence of interest may be modified to be recognized by the viral integrase as needed; other reagents required for polynucleotide translocation and / or protein delivery into cells; performing an assay for off-target integration of the DNA sequence; and, in one embodiment, using a modified marker sequence on the DNA sequence to be inserted.

[0009] A nucleic acid construct is provided herein, comprising, in an operable linkage, a) a first polynucleotide sequence encoding Cas9, inactive Cas9, or Cpf1 or a portion thereof; b) a second polynucleotide sequence encoding an integrase, recombinase, or transposase or a portion thereof; and c) a third polynucleotide sequence encoding a nucleic acid linker, wherein the first polynucleotide sequence comprises 5' and 3' ends, and the second polynucleotide sequence comprises 5' and 3' ends, and the 3' end of the first polynucleotide is linked to the 5' end of the second polynucleotide by the nucleic acid linker, and the first and second polynucleotides are expressible as a fusion protein in a cell or organism. In some embodiments, the first polynucleotide sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 27-46, 49, 56, or 68, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity thereto. In some embodiments, Cas9, inactive Cas9, or Cpf1 includes any one of sequence numbers 2, 4, 6, 8, 10, 12, 14, 50, 52, 69, 72-78, or 86-92, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with them. In some embodiments, the second polynucleotide sequence includes any one of sequence numbers 15, 17, 19, 21, 23, 47, 55, 62, 64, 66, 70, or 79, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with them. In some embodiments, the integrase, recombinase, or transposase comprises one of SEQ ID NOs: 16, 18, 20, 22, 24, 25, 26, 48, 63, 65, 67, 71, or 80, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity thereto. Organisms containing this nucleic acid construct are also described herein.Furthermore, organisms containing fusion proteins and possessing modified genomes are also described herein.

[0010] An organism is provided herein comprising a) a first polynucleotide sequence encoding Cas9, inactive Cas9, or Cpf1 or a portion thereof; b) a second polynucleotide sequence encoding an integrase, recombinase, or transposase or a portion thereof; and c) a third polynucleotide sequence encoding a nucleic acid linker, wherein the first polynucleotide sequence comprises 5' and 3' ends, and the second polynucleotide sequence comprises 5' and 3' ends, and the 3' end of the first polynucleotide is ligated to the 5' end of the second polynucleotide by a nucleic acid linker, and the first and second polynucleotides can be expressed as a fusion protein in a cell or organism.

[0011] Also provided herein are fusion proteins comprising: a) a first protein which is a non-catalytic Cas9, Cas9, TALE protein, zinc finger protein, or Cpf1 protein and targets a target DNA sequence; b) a second protein which is an integrase, recombinase, or transposase; and c) a linker which links the first protein to the second protein. In some embodiments, the second protein is an integrase, which is HIV1 integrase or lentiviral integrase, and the linker sequence has an amino acid length of 1 or more, or the first protein is a non-catalytic Cas9. In some embodiments, the linker sequence has an amino acid length of 4 to 8, and the first protein is a TALE protein, or the first protein is a zinc finger protein. In some embodiments, when the fusion protein includes a TALE or zinc finger protein, the target DNA sequence is about 16 to about 24 base pairs long. In some embodiments, the first protein is Cas9 or a non-catalytic Cas9, and one or more guide RNAs are used to target a target DNA sequence of about 16 to about 24 base pairs.

[0012] Also provided herein is a method for inserting a DNA sequence into genomic DNA, comprising: a) identifying a target sequence in genomic DNA; b) designing a fusion protein according to claim 1 to bind to the target sequence in genomic DNA; 3) designing a DNA sequence of interest for integration into genomic DNA; and d) providing the fusion protein and the DNA sequence of interest to a cell or organism by a technique that enables the transfer of the fusion protein and the DNA sequence of interest to the cell or organism, wherein the DNA sequence of interest is integrated into the target sequence in genomic DNA.

[0013] Also provided herein are nucleotide vectors comprising: a) a first coding sequence for a first protein which is Cas9, non-catalytic Cas9, TALE protein, zinc finger protein, or Cpf1 protein, modified to bind to a target DNA sequence; b) a second coding sequence for a second protein which is an integrase, recombinase, or transposase; c) a DNA sequence between the first and second coding sequences that forms an amino acid linker between the first and second proteins; and d) optionally an expressed DNA sequence of interest surrounded by att sites recognized by integrase, and optionally one or more guide RNAs, wherein the first protein targets a predetermined DNA sequence and the first protein is linked to the second protein by the amino acid linker sequence.

[0014] A method for inhibiting gene transcription in a cell or organism is provided herein, the method comprising: a) identifying an ATG start codon in a gene; b) designing a fusion protein system using the fusion protein described in claim 1 to bind to a target sequence immediately following the ATG start codon of the gene; c) designing a DNA sequence of interest which is one or more consecutive stop codons; and d) providing the fusion protein and the DNA sequence of interest to a cell or organism by a technique that enables the transfer of the fusion protein and the DNA sequence of interest to the cell or organism, so that the DNA sequence of interest is incorporated into the target sequence in the genomic DNA and gene transcription is inhibited. In some embodiments, the second protein is a recombinase, the recombinase is Cre recombinase or a modified form thereof, the modified Cre recombinase having constitutive recombinase activity. In some embodiments, the vector further comprises a reverse transcriptase gene expressed in a cell.

[0015] Furthermore, compositions comprising a purified DNA-binding protein / integrase fusion and RNA of approximately 15 to 100 base pairs in length are also provided herein, in which case the DNA-binding protein is selected from Cas9, Cpf1, TALEN, and zinc finger proteins modified for a targeted DNA sequence in the genome, and the integrase is HIV integrase, lentiviral integrase, adenovirus integrase, retroviral integrase, or MMTV integrase. [Brief explanation of the drawing]

[0016] The following description, the attached claims, and the accompanying drawings will provide a more detailed understanding of these and other characteristics, aspects, and advantages of this disclosure.

[0017] [Figure 1]Figure 1 shows a) a typical Cas9 / HIV1 integrase fusion protein with no catalytic activity, b) a typical TALE / HIV1 integrase fusion protein, c) a typical zinc finger protein / HIV1 integrase fusion protein, and d) a typical Cas9 / HIV1 integrase fusion protein designed on the opposite side of the DNA at the targeting site. Each fusion protein binds to a specific target sequence on the DNA. "ZnFn" is a zinc finger protein. "Integrase" corresponds to one integrase unit or two integrase units linked by, for example, a short amino acid linker. In some embodiments, integrase can be replaced with a recombinase. Cas9 may or may not have catalytic activity. [Figure 2] Figure 2 shows a DNA plasmid system containing a vector with non-catalytic Cas9 / integrase fusion protein, a vector containing the DNA sequence of interest, and a vector containing reverse transcriptase. Guide RNA (gRNA) or RNA may be provided separately. Another vector may be used to express the gRNA. "1 or 2" refers to one integrase or two integrases linked by, for example, an amino acid linker. [Figure 3] Figure 3 shows a typical DNA plasmid containing a nucleiotide sequence, a non-catalyzative Cas9 / integrase fusion protein, guide RNA, the DNA (gene) sequence of interest, and reverse transcriptase. A viral att site may be provided for the DNA sequence of interest, thereby enabling the integration of integrase into the cell's genomic DNA. Guide RNA (gRNA) or RNA may be provided separately. A separate vector may be used to express the gRNA. "1 or 2" refers to one integrase or two integrases linked, for example, by an amino acid linker. [Figure 4]Figure 4 shows a flowchart. A representative method using the vectors shown in Figures 2 and 3 is shown in Figure 4, which is as follows: 1) Reverse transcriptase reverse transcribes the DNA sequence of interest that has an att site expressed from the vector (or uses linear DNA with an att site); 2) Fusion Cas9 / integrase targets a site on the genomic DNA based on guide RNA; 3) Integrase recognizes the att (LTR) site on the DNA sequence of interest and integrates the DNA into the genome at the target site; 4) Assays (e.g., PCR (polymerase chain reaction)) are performed to examine the precise insertion of the DNA sequence of interest. Assays may also be performed to examine nonspecific integration. [Figure 5] Figure 5 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide NrF2-sgRNA2 and sgRNA3. [Figure 6] Figure 6 shows theoretical data generated by Abbie1 gene editing. [Figure 7] Figure 7 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide Nrf2-sgRNA3. [Figure 8] Figure 8 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. [Figure 9] Figure 9 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. [Figure 10] Figure 10 shows Abbie1 gene editing targeting CXCR4 exon 2. [Figure 11] Figure 11 shows the detection of the ABBIE1 protein after isolation and purification from an Escherichia coli (E coli) Coomassie-stained gel. [Modes for carrying out the invention]

[0018] The following detailed description is provided to assist those skilled in the art in implementing the present disclosure. Nevertheless, since modifications and variations in the embodiments discussed herein may be made by those skilled in the art without departing from the spirit or scope of the present discovery, this detailed description should not be construed as unduly limiting the present disclosure.

[0019] As used in the present disclosure and the appended claims, the singular forms "a", "an", and "the" include references to the plural unless the context clearly dictates otherwise. As used in the present disclosure and the appended claims, the term "or" may be singular or inclusive. For example, A or B can be A and B.

[0020] Endogenous As described herein, an endogenous nucleic acid, nucleotide, polypeptide, or protein is defined in relation to a host organism. An endogenous nucleic acid, nucleotide, polypeptide, or protein is one that occurs naturally in the host organism.

[0021] Exogenous As described herein, an exogenous nucleic acid, nucleotide, polypeptide, or protein is defined in relation to a host organism. An exogenous nucleic acid, nucleotide, polypeptide, or protein is one that does not occur naturally in the host organism or is in a different location in the host organism.

[0022] Knockout When an exogenous nucleic acid is transformed into a host organism (e.g., by random insertion or homologous recombination), resulting in the disruption of a gene (e.g., by deletion, insertion), the gene is considered to be knocked out.

[0023] Knocking out a gene can reduce the activity of the corresponding protein. For example, compared to the activity of the same protein without the gene being knocked out, it may be at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%.

[0024] Knocking out a gene can reduce gene transcription by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or even 100% compared to when the gene is not knocked out.

[0025] qualification A modified organism is a different organism from an unmodified organism. For example, a modified organism may contain the fusion protein of this disclosure that causes knockout of a target gene sequence. A modified organism may have a modified genome.

[0026] A modified nucleic acid sequence or amino acid sequence differs from an unmodified nucleic acid sequence or amino acid sequence. For example, a nucleic acid sequence may have one or more nucleic acids inserted, deleted, or added. For example, an amino acid sequence may have one or more amino acids inserted, deleted, or added.

[0027] Operable linkage In some embodiments, the vector comprises a polynucleotide operably ligated to one or more regulatory elements, such as a promoter and / or a transcription termination factor. Nucleic acid sequences are operably ligated when they are placed in a functional relationship with another nucleic acid sequence. For example, when expressed as a pre-protein involved in polypeptide secretion, the DNA for the pre-sequence or secretion leader is operably ligated to the DNA for the polypeptide; when influencing the transcription of the sequence, the promoter is operably ligated to the coding sequence; or, when positioned to facilitate translation, the ribosome binding site is operably ligated to the coding sequence. The operably ligated sequences may be in close proximity, and in the case of a secretion leader, they may be in the reading phase.

[0028] Host cell or host organism The host cell may contain polynucleotides encoding the polypeptide of this disclosure. In some embodiments, the host cell is part of a multicellular organism. In other embodiments, the host cell is cultured as a unicellular organism.

[0029] The host organism may include some suitable host, such as a microorganism. Examples of microorganisms useful in the methods described herein include bacteria (e.g., Escherichia coli), yeast (e.g., Saccharomyces cerevisiae), and plants. The organism may be prokaryotic or eukaryotic. The organism may be unicellular or multicellular.

[0030] The host cell may be prokaryotic. Suitable prokaryotic cells include, but are not limited to, any various research strains of Escherichia coli, Lactobacillus sp., Salmonella sp., and Shigella sp. (e.g., as described in Carrier et al. (1992) J.Immunol. 148:1176-1181; U.S. Patent No. 6,447,784; and Sizemore et al. (1995) Science 270:299-302). Examples of Salmonella species that may be used in this disclosure include, but are not limited to, Salmonella typhi and S. typhimurium. Suitable Shigella species include, but are not limited to, Shigella flexneri, Shigella sonnei, and Shigella disenteriae. Generally, research species should be non-pathogenic. Other suitable bacteria, but are not limited to, Pseudomonas pudita, Pseudomonas aeruginosa, Pseudomonas mevalonii, Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodospirillum rubrum, and Rhodococcus sp.

[0031] In some embodiments, the host organism is eukaryotic. Suitable eukaryotic host cells include, but are not limited to, yeast cells, insect cells, plant cells, fungal cells, and algal cells.

[0032] Polynucleotides and polypeptides [nucleic acids and proteins] The proteins of this disclosure can be prepared by any method known in the art. The proteins may be synthesized either by solid-phase peptide synthesis or by classical solution peptide synthesis, also known as liquid-phase peptide synthesis. Using Val-Pro-Pro, enalapril and lysinopril as starting templates, several sets of peptide analogs, such as X-Pro-Pro, X-Ala-Pro, and X-Lys-Pro (where X corresponds to some amino acid residue), can be synthesized using solid-phase or liquid-phase peptide synthesis. Methods for liquid-phase synthesis of libraries of peptides and oligonucleotides coupled to soluble oligomeric supports have already been described. Bayer, Ernst and Mutter, Manfred, Nature 237:512-513 (1972); Bayer, Ernst, et al., J. Am. Chem. Soc. 96:7333-7336 (1974); Bonora, Gian Maria, et al., Nucleic Acids Res. 18:3155-3159 (1990). Liquid-phase synthesis has advantages over solid-phase synthesis in that it does not require a structure on the first reactant suitable for linking the reactants to the solid phase. Furthermore, liquid-phase synthesis does not need to avoid chemical conditions that could break the bond between the solid phase and the first reactant (or intermediate product). In addition, reactions in a homogeneous solution can yield better yields and complete reactions than those obtained in heterogeneous solid / liquid-phase systems, such as those present in solid-phase synthesis.

[0033] In oligomer-supported liquid-phase synthesis, the elongated product is linked to a large, soluble polymer group. Subsequently, the products from each step of this synthesis can be separated from the unreacted reactants based on the large size difference between the product linked to the relatively large polymer and the unreacted reactants. This allows the reaction to be carried out in a homogeneous solution, eliminating the redundant purification steps associated with conventional liquid-phase synthesis. Oligomer-supported liquid-phase synthesis has also been adapted for automated liquid-phase synthesis of peptides. (Bayer, Ernst, et al., Peptides: Chemistry, Structure, Biology, 426-432).

[0034] In solid-phase peptide synthesis, the procedure involves ligating the elongated peptide end to an insoluble support while simultaneously assembling the appropriate amino acids sequentially to form the desired peptide sequence. Typically, the carboxyl terminus of the peptide is ligated to a polymer, which can be released from the polymer upon treatment with a cleavage reagent. In a common method, amino acids are bound to resin particles, and the peptide is generated stepwise by the sequential addition of protected amino acids to form an amino acid chain. Modifications of the technique described by Merrifield are commonly used. See, for example, Merrifield, J. Am. Chem. Soc. 96:2989-93 (1964). In automated solid-phase methods, peptides are synthesized by loading carboxyl-terminal amino acids onto an organolinker (e.g., PAM, 4-oxymethylphenylacetamidomethyl) and covalently bonding this to an insoluble polystyrene resin crosslinked with divinylbenzene. The terminal amine can be protected by blocking with t-butyloxycarbonyl. Hydroxyl and carboxyl groups are generally protected by blocking with O-benzyl groups. Synthesis is carried out in automated peptide synthesizers, such as those available from Applied Biosystems (Foster City, Calif.). After synthesis, the product can be isolated from the resin. Blocking groups are removed by using hydrofluoric acid or trifluoromethylsulfonic acid according to established methods. A peptide resin of 0.5 mmol can be obtained in a typical synthesis. After cleavage and purification, a yield of approximately 60-70% is generally obtained. Purification of the product peptide is performed, for example, by crystallizing the peptide from an organic solvent such as methyl-butyl ether, then dissolving it in distilled water, and dialysis (if the molecular weight of the target peptide is greater than approximately 500 daltons) or, if the molecular weight of the peptide is less than 500 daltons, by reverse high-pressure liquid chromatography (e.g., using 0.1% trifluoroacetic acid and acetonitrile as solvents). 18This is carried out by using a column. The purified peptides can be lyophilized and stored dry until use. Analysis of the obtained peptides can be carried out using common methods of analytical high-pressure liquid chromatography (HPLC) and electrospray mass spectrometry (ES-MS).

[0035] In other cases, proteins, such as those described herein, are produced by recombinant methods. For the production of any of the proteins described herein, host cells transformed with an expression vector containing a polynucleotide encoding such a protein may be used. The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast, or the host may be a prokaryotic cell, such as a bacterial cell. The introduction of the expression vector into the host cell may be carried out by a variety of methods, including calcium phosphate transfusion, DEAE-dextran mediated transfusion, polyblen, protoplast fusion, liposome, direct microinjection into the nucleus, scrape loading, microparticle gun transformation, and electroporation. Large-scale production of proteins from recombinant organisms is a well-established process carried out on a commercial scale and is well within the capabilities of those skilled in the art.

[0036] Codon optimization One or more codons in a coding polynucleotide may be “biased” or “optimized” to reflect the codon use of the host organism. For example, one or more codons in a coding polynucleotide may be “biased” or “optimized” to reflect chloroplast codon use or nuclear codon use. Most amino acids are encoded by two or more different (degenerate) codons, and it is well recognized that various organisms utilize certain codons in preference to others. The “biased” or “optimized” codons may be used interchangeably throughout this application. Codon bias can be varied in various plants, including algae, for example, compared to tobacco. Generally, the selected codon bias reflects the codon use of the plant (or organelles within it) transformed with the nucleic acid of this disclosure.

[0037] Polynucleotides that are biased towards specific codon use can be de novo synthesized, or they can be genetically modified using conventional recombinant DNA techniques, such as site-directed mutagenesis, to alter one or more codons to be biased towards chloroplast codon use.

[0038] Percentage sequence identity One example of a suitable algorithm for determining percent sequence identity or sequence similarity between nucleic acid or polypeptide sequences is the BLAST algorithm, which is described, for example, Altschul et al., J.Mol.Biol.215:403-410 (1990). Software for performing BLAST analysis is available through the National Center for Biotechnology Information. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of alignment. The BLASTN program (for nucleotide sequences) uses word length (W) 11, expected value (E) 10, cutoff 100, M=5, N=4, and comparison of both strands as initial settings. For amino acid sequences, the BLASTP program uses word length (W) 3, expected value (E) 10, and the BLOSUM62 scoring matrix (as described, for example, Henikoff & Henikoff (1989) Proc.Natl.Acad.Sci.USA, 89:10915) as initial settings. In addition to calculating percent sequence identity, the BLAST algorithm can also perform a statistical analysis of the similarity between two sequences (as described, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA, 90:5873-5787 (1993)). The similarity metric provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indicator of the probability that the match between two nucleotide or amino acid sequences occurs by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in the comparison between the test nucleic acid and the reference nucleic acid is less than approximately 0.1, less than approximately 0.01, and less than approximately 0.001.

[0039] This disclosure includes a system comprising A) a viral integrase (or recombinase) covalently bound to a Cas protein (e.g., Cas9) that is inactive with respect to DNA cleavage, for example. Alternatively, if a TALE protein or zinc finger protein is designed to target a specific sequence of DNA in a genome, a viral integrase (or bacterial or phage recombinase) is covalently bound to the TALE protein or zinc finger protein.

[0040] This may be provided in an expression vector or as a purified protein. B) A gene (or DNA sequence of interest) with or without homologous arms to be incorporated into the desired genome. The GOI or DNA sequence of interest may be modified as needed to be recognized by viral integrase. For example, viral att sites may be added to the ends of the DNA sequence. C) Other reagents required for polynucleotide translocation and / or protein delivery into cells.

[0041] nucleic acid The terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” are used interchangeably in this disclosure. They refer to polymeric forms of any nucleotide of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have some three-dimensional structure and may perform some known or unknown function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, loci (multiple loci) determined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may include one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure may be given before or after the assembly of the polymer, where present. Non-nucleotide components may be interspersed in the sequence of nucleotides. Polynucleotides can be further modified after polymerization, such as through conjugation reactions with labeled components.

[0042] Guide RNA In aspects of this disclosure, the terms “chimeric RNA,” “chimeric guide RNA,” “guide RNA,” “single guide RNA,” and “synthetic guide RNA” are interchangeable and refer to polynucleotide sequences comprising a guide sequence, a tracr sequence, and a tracr mate sequence. The term “guide sequence” refers to a sequence of approximately 20 bp (12–30 bp) within the guide RNA that defines a target site and may be used interchangeably with the terms “guide” or “spacer.” The term “tracr mate sequence” may also be used interchangeably with the term “direct repeat.”

[0043] Wild type As used herein, the term “wild type” is a term of the art as understood by those skilled in the art, and, when distinguished from mutant or variant forms, means a typical form of an organism, strain, gene or feature as it occurs in nature.

[0044] mutant Where used herein, the terms “mutant” or “mutant” should be interpreted as meaning a presentation of quality having a pattern that deviates from naturally occurring ones. In relation to genes, these terms refer to many of the changes in a gene that make it different from the wild-type gene, including, among other things, single nucleotide polymorphisms (SNPs), insertions, deletions, and gene shifts.

[0045] Modification The terms “unnatural” or “modified” are used interchangeably and refer to the involvement of artificial technology. When these terms refer to nucleic acid molecules or polypeptides, they mean that the nucleic acid molecules or polypeptides do not contain at least one other component that would naturally combine and be found in nature.

[0046] Complementarity "Complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence, either through classical Watson-Crick or other non-classical types. Percent complementarity refers to the percentage of residues in a nucleic acid molecule that can form hydrogen bonds with a second nucleic acid sequence (e.g., Watson-Crick base pairs) (for example, 5, 6, 7, 8, 9, and 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). "Perfect complementarity" means that all adjacent residues in a nucleic acid sequence can form hydrogen bonds with the same number of adjacent residues in the second nucleic acid sequence. "Substantially complementary," as used herein, means a degree of complementarity that is at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% or a percentage across a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or two nucleic acids that hybridize under stringent conditions.

[0047] amino acid Official name, 3-letter code, 1-letter code Aspartic acid (Asp D) Glutamic acid (Glu E) Lysine K Arginine Arg R Histidine His H Tyrosine (Tyr Y) Cysteine ​​(Cys C) Asparagine Asn N Glutamine (Gln Q) SerinCell S Threonine Thr T Glycine (Gly G) Alanine Ala A Valin Val V Leucine Leu L Isoleucine Ile I Methionine Met M Proline Pro P Phenylanine Phe F Tryptophan Trp W

[0048] Where used herein, the term “amino acid” includes both natural and synthetic amino acids, and both D and L amino acids. “Standard amino acid” means any of the 20 standard L-amino acids commonly found in natural proteins / peptides. “Non-standard amino acid residue” means any amino acid other than a standard amino acid, whether synthetically prepared or of natural origin. Where used herein, “synthetic amino acid” includes, but is not limited to, salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides of this disclosure, and particularly those at the carboxyl or amino terminus, may be modified by methylation, amidation, acetylation, or substitution with other chemical groups that can alter the cyclic half-life of the peptide without adversely affecting its activity. Furthermore, disulfide bonds may or may not be present in the peptides.

[0049] Amino acids can be classified into seven groups based on their side chain R: (1) aliphatic side chains; (2) side chains containing a hydroxyl (OH) group; (3) side chains containing a sulfur atom; (4) side chains containing an acidic or amide group; (5) side chains containing a basic group; (6) side chains containing an aromatic ring; and (7) proline, an imino acid in which the side chain is fused to an amino group.

[0050] As used herein, the term “conservative amino acid substitution” is defined herein as an substitution within one of the following five groups: I. Small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, Gly; II. Polarity, Loaded Residues, and Their Amides: Asp, Asn, Glu, Gin; III. Polarity, positively charged residues: His, Arg, Lys; IV. Large aliphatic, nonpolar residues: Met, Leu, He, Val, Cys (Ile; autocorrect is not literate) V. Large aromatic residues: Phe, Tyr, Tip (and similarly, Trp)

[0051] This disclosure utilizes prior art in immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, unless otherwise provided, and this is within the scope of the art. Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FMAusubel, et al. eds. (1987)); Series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL See APPROACH (MJ MacPherson, BD Hames and GRTaylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (RIFreshney, ed. (1987)).

[0052] vector A gene expression vector (DNA-based or viral) is used to express a fusion integrase in a cell or tissue and to provide a DNA sequence (or gene) of interest that contains the appropriate site required by the integrase or recombinase for integrating the DNA (or gene) of interest into the host species or cell genome. Many gene expression vectors are known in the art. The vector is used for the gene (or DNA sequence) of interest. The vector can be cleaved using many restriction enzymes known in the art.

[0053] CRISPR / CAS9 CRISPR / Cas9 is described in U.S. Patent No. 8,697,359, 8,889,356, and Ran et al. (Nature Protocols, 2013, volume 8, pages 2281-2308). The Cas9 protein utilizes an RNA guide to bind to a specific sequence of DNA in the genome. The RNA guide (guide RNA) can be designed to be 10-40, 12-35, 15-30, or, for example, 18-22 or 20 nucleotides long. See Hsu et al., Nature Biotechnology, September 2013, volume 31, pages 827-832, for Cas9 from Streptococcus pyogenes. Another important Cas9 is from Staphylococcus aureus (a smaller Cas9 than that from S. pyogenes). The Cas9 protein utilizes guide RNA to bind to specific regions of the DNA sequence.

[0054] The non-catalyzed form of Cas9 is described in Guilinger et al, "Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification," Nature Biotechnology, April 25, 2014, volume 32, pages 577-582. Guilinger et al. achieved greater specificity in cleaving genomic DNA by ligating non-catalyzed Cas9 to the Fok1 enzyme. This non-catalyzed Cas9 allows Cas9 to use an RNA guide for binding to genomic DNA, while simultaneously being unable to cleave this DNA.

[0055] Cas9 is available in its native wt form and also in human optimized codon form for better expression of the Cas9 construct in cells (see Mali et al, Science, 2013, volume 339, pages 823-826). Codon optimization of Cas9 can be performed in a species-dependent manner for its expression. Optimized or unoptimized (wt) form may be used depending on whether the protein form of the integrase / Cas9 fusion protein (also known as ABBIE1) or the nucleotide expression vector form is to be generated.

[0056] RNA guides for specific DNA sequences can be designed using various computer-based tools.

[0057] CRISPR / CPF1 Cpf1 is another protein that uses guide RNA to bind to specific sequences in genomic DNA. Cpf1 also cleaves DNA, creating twist-type cleavage. Cpf1 can be catalytically inactivated in terms of its cleavage ability.

[0058] Other CRISPR Proteins These are proteins that utilize guide RNA to target specific DNA sequences, regardless of whether or not they possess DNA cleavage capabilities. Some of these proteins may naturally possess other enzymatic / catalytic functions.

[0059] TALEN Transcription activator-like effector nucleases (TALENs) are fusion proteins with restriction enzymes, created by fusing a TAL effector DNA-binding domain to a DNA-cleaving domain. These reagents are efficient, programmable, and enable specific DNA cleavage, making them a powerful tool for in-situ genome editing. Transcription activator-like effectors (TALEs) can be rapidly modified to actually bind to any DNA sequence. As used herein, the term TALEN broadly includes monomeric TALENs capable of cleaving double-stranded DNA without the assistance of another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are modified to act together to cleave DNA at the same site. TALENs acting together may be called left-TALENs and right-TALENs, referring to the stiffness of the DNA. See U.S. Patent No. 8,440,432.

[0060] TAL effectors are proteins secreted by the bacterium Xanthomonas. The DNA-binding domain contains a highly conserved 33-34 amino acid sequence, with the exception of the 12th and 13th amino acids. These two positions are highly variable (Repeat Variable Diresidues (RVDs)) and show a strong correlation with specific nucleotide recognition. This simple relationship between amino acid sequence and DNA recognition allows for the modification of the specific DNA-binding domain by selecting a combination of repeat segments containing appropriate RVDs.

[0061] Integrases or recombinases can be used to construct active hybrid integrases or recombinases in yeast or cell assays. These reagents are also active in plant and animal cells. While TALEN studies have used wild-type Fok1 cleavage domains, some subsequent TALEN studies have also used Fok1 cleavage domain mutants with mutations designed to improve cleavage specificity and activity. Both the number of amino acid residues between the TALEN DNA-binding domain and the integrase or recombinase domain, and the number of bases between the two individual TALEN binding sites, are parameters for achieving high levels of activity. The number of amino acid residues between the TALEN DNA-binding domain and the integrase or recombinase domain can be modified by introducing a spacer (separate from the spacer sequence) between multiple TAL effector repeat sequences and the integrase or recombinase domain. The spacer sequence can be 6–102 or 9–30 nucleotides or 15–21 nucleotides. These spacers typically provide no other activity to hybrid proteins other than ligation between DNA-targeting proteins (Cas9, TALE, or zinc finger proteins) and integrases or recombinases. The amino acids used as spacers and for other uses in this disclosure are as follows.

[0062] The relationship between the amino acid sequence of the TALEN-binding domain and DNA recognition takes into account the proteins that can be explicitly identified. In this case, artificial gene synthesis is problematic due to the improper annealing of the repetitive sequences found in the TALEN-binding domain. One solution to this is to use a publicly available software program called DNAWorks to find suitable oligonucleotides for assembly in two-step PCR; oligonucleotide assembly and subsequent whole-gene amplification. Many modular assembly methods for creating modified TALEN constructs have also been reported in the art.

[0063] Once the TALEN genes are assembled together, they are inserted into a plasmid, which is then used to translocate the gene product into target cells expressing the gene, allowing it to translocate to the nucleus and reach the genome. TALENs can be used to edit the genome by inducing double-strand breaks (DSBs), which the cells respond to DNA repair; however, this disclosure seeks to use the power of viral integrases or bacterial or phage recombinases to insert the DNA sequence of interest into a targeted site in the genome. See International Publication No. 2014134412 and U.S. Patent No. 8748134 for further details.

[0064] Zinc finger protein Zinc finger proteins for DNA binding and their designs are described in U.S. Patent No. 7928195, U.S. Patent Application Publication No. 2009 / 0111188, and U.S. Patent No. 7951925. Zinc finger proteins utilize several linked zinc finger domains in a specified order to bind to a specific sequence of DNA. Zinc finger protein endonucleases are well established.

[0065] Zinc finger proteins (ZFPs) are proteins capable of sequence-specific binding to DNA. Zinc fingers were first identified in the transcription factor TFIIIA from the oocytes of the African clawed frog, Xenopus laevis. The single zinc finger domain of this class of ZFPs is approximately 30 amino acids long and, from several structural studies, has been shown to contain a beta turn (containing two conserved cysteine ​​residues) and an alpha helix (containing two conserved histidine residues), which are maintained in a specific higher-order structure through the coordination of the zinc atom by these two cysteine ​​and two histidine residues. This class of ZFPs is also known as C2H2 ZFP. Further classes of ZFPs have also been suggested. See, for example, Jiang et al. (1996) J. Biol. Chem. 271:10723-10730 for a discussion of Cys-Cys-His-Cys(C3H)ZFP. To date, over 10,000 zinc finger sequences have been identified in thousands of known or putative transcription factors. Zinc finger domains are involved not only in DNA recognition but also in RNA binding and protein-protein binding. It is currently estimated that this class of molecules accounts for approximately 2% of all human genes.

[0066] Many zinc finger proteins have conserved cysteine ​​and histidine residues that tetraconform one zinc atom in each finger domain. In particular, most ZFPs feature finger components of the common sequence:-Cys-(X)2-4-Cys-(X)12-His-(X)3-5-His-(SEQ ID NO: 49, where X corresponds to any amino acid (C2H2 ZFP)). This most broadly representative zinc-coordination sequence contains two cysteine ​​and two histidine with specific spacing. The folded structure of each finger contains an antiparallel β-turn, a fingertip region, and a short amphiphilic α-helix. The metal coordination ligand binds to the zinc ion, and in the case of the zif268 type zinc finger, the short amphiphilic α-helix binds to the major groove of DNA. Furthermore, the structure of the zinc finger is stabilized by certain conserved hydrophobic amino acid residues (e.g., the residue immediately preceding the first conserved Cys and the residue at position +4 of the finger's helix segment), and by zinc coordination via conserved cysteine ​​and histidine residues.

[0067] Other DNA-binding proteins that can bind to specific target sequences in genomic DNA These proteins include zinc finger proteins, TALENs, and CRISPR proteins that can bind to specific sequences in the genomic DNA of various organisms, and are independent of these proteins. These may include transcription factors, transcriptional repressors, meganucleases, and endonuclease DNA-binding domains.

[0068] Integrase The integrase and its endonuclease fusion proteins are described in U.S. Patent Application Publication No. 2009 / 0011509. The integrases introduced are lentiviral integrase and HIV1 (human immunodeficiency virus 1) integrase. This disclosure describes fusing a non-catalyzable (or catalytically active) Cas9, TALE, or zinc finger protein to the integrase to target a specific region of DNA in the genome selected by the user.

[0069] Like other retroviral integrases, HIV-1 integrase is able to recognize specific characteristics of viral DNA ends located in the U3 and U5 regions of long terminal repeats (LTRs) (Brown, 1997). The LTR ends are simply viral sequences that appear to be required in cis for recognition by retroviral integration mechanisms. Short, incomplete reverse repeats are present at the outer edge of LTRs in both mouse and avian retroviruses (reviewed by Reicin et al., 1995). The subterminal CA located at the outermost positions 3 and 4 at the end of the retroviral DNA (positions 1 and 2 are 3' terminal processing nucleotides), along with the CA dinucleotides, are necessary and sufficient for accurate proviral incorporation in vitro and in vivo. The sequences located internal to the CA dinucleotide appear to be important for optimal integrase activity (Brin & Leis, 2002a; Brin & Leis, 2002b; Brown, 1997). The terminal 15 bp of the HIV-1 LTR has been shown to be critical for accurate 3' terminal processing and chain transfer reactions in vitro (Reicin et al., 1995; Brown, 1997). Longer substrates are used more efficiently than shorter ones by HIV-1 IN, which shows that the binding interaction extends at least 14–21 bp inward from the viral DNA end. Brin & Leis (2002a) analyzed the specific properties of the HIV-1 LTR and U5 Despite LTRs being more efficient substrates for IN processing in vitro, we concluded that both U3 and U5 LTR recognition sequences are required for coordinated IN-catalyzed DNA integration (Bushman & Craigie, 1991; Sherman et al., 1992). Positions 17–20 of the IN recognition sequence are required for the coordinated DNA integration mechanism, but HIV-1 IN allows considerable variation in both the U3 and U5 ends, which are extended from the immutable subterminal CA dinucleotide (Brin & Leis, 2002b).This disclosure includes DNA vectors containing viral (retroviral or HIV) LTR regions at the 5' and 3' ends of a position to accommodate a DNA sequence or gene of interest to be incorporated into the genome. The LTR regions do not need to be full-length LTRs, insofar as they function to interact with integrases for accurate incorporation. The LTR regions may be modified to contain detectable (e.g., fluorescent) PCR detection or selectable markers (e.g., antibiotic resistance). The vectors are designed to be cleaved and linearized (via designed restriction sites for restriction endonucleases) so that the LTR regions become the 5' and 3' ends of the DNA fragment.

[0070] Integrases consist of three domains linked by a mobile linker. These domains are the N-terminal HH-CC zinc-binding domain, the catalytic core domain, and the C-terminal DNA-binding domain (Lodi et al, Biochemistry, 1995, volume 34, pages 9826-9833). In some aspects of this disclosure, the integrase bound to Cas9 (or other DNA-binding molecule) does not have a C-terminal binding domain. In some aspects of this disclosure, two different fusion proteins are constructed, one having a non-catalyzable Cas9 (or TALE or zinc finger protein) fused to the N-terminal zinc-binding domain of the integrase, and the other having a non-catalyzable Cas9 (or TALE or zinc finger protein) fused to the catalytic core domain of the integrase. These two different fusion proteins are designed to bind to the opposite strand of genomic DNA, as seen in the TALE-Fok1 or zinc finger-Fok1 systems. Thus, when the N-terminal domain and catalytic core come into contact at a site on the genomic DNA, this exhibits integrase activity. Since the full activity of integrase has been observed to include an integrase tetramer, fusion proteins can be designed with 1, 2, 3, or 4 integrase proteins linked by a mobile linker that may be 1-20 amino acid lengths or 4-12 amino acid lengths.

[0071] Recombinase Recombinases, including Cre, Flp, R, Dre, Kw, and Gin recombinases, are described in U.S. Patent No. 8,816,153 and U.S. Patent Application Publication No. 2004 / 0003420. Recombinases, such as Cre recombinase, use LoxP sites to excise sequences from the genome. Recombinases can be modified to be constitutively active for their recombination activity and also to have low site specificity. Therefore, by incorporating them into the fusion proteins of this disclosure, it is possible to target such constitutively active recombinase proteins that lack sequence specificity to specific sequences of DNA in the genome. Thus, the CRISPR / Cas9, TALE, or zinc finger protein domain specifies the DNA sequence to which the recombinase contributes its recombination activity. Such recombinase proteins may be wild-type, constitutively active, or inactive for recombinase activity. Cas9-recombinases such as Cas9-Gin or Cas9-Cre can be prepared by using linker sequences or by direct fusion.

[0072] Nuclear localization signaling sequences (NLS) for fusion proteins The signal peptide domain (also known as "NLS") is derived from, for example, yeast GAL4, SKI3, L29 or histone H2B protein, polyomavirus large T protein, VP1 or VP2 capsid protein, SV40 VP1 or VP2 capsid protein, adenovirus E1a or DBP protein, influenza virus NS1 protein, hepatitis virus core antigen or mammalian lamin, c-myc, max, c-myb, p53, c-erbA, jun, Tax, steroid receptor or Mx protein (see Boulikas, Crit. Rev. Eucar. Gene Expression, 3, 193-227 (1993)), simian virus 40 ("SV40") T-antigen (Kalderon et al, Cell, 39, 499-509 (1984)) or other proteins with known nuclear localization. The NLS may be derived from, for example, the SV40T-antigen, but could be any other NLS sequence known in the art. Tandem NLS sequences may be used.

[0073] Linker domain The various linkers used between synthesized fusion proteins / peptides are composed of amino acids. At the DNA level, these are represented by 3-base pair (bp) codons, as known in the genetic code. Linkers can be 1 to 1000 amino acid long and any integer in between. For example, a linker may be 1 to 200 amino acid long, or 1 to 20 amino acid long.

[0074] Expression vector Numerous nucleic acids can be introduced into cells to induce gene expression. As used herein, the term nucleic acid includes DNA, RNA, and nucleic acid analogs, as well as nucleic acids that are double-stranded or single-stranded (i.e., sense or antisense single-stranded). For example, nucleic acid analogs may be modified with base moieties, sugar moieties, or phosphate backbone to improve the stability, hybridization, or solubility of nucleic acids. Modifications at the base moiety include deoxyuridine for deoxythymidine and 5-methyl-2'-deoxycytidine and 5-bromo-2'-doxycytidine for deoxycytidine. Modifications at the sugar moiety include modification of the 2'-hydroxyl group of ribose sugars to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone may be modified to produce morpholino nucleic acids in which each base moiety is linked to a six-membered morpholino ring, or peptide nucleic acids in which the deoxyribose phosphate backbone is replaced with a pseudopeptide backbone, retaining four bases. See Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7(3):187; and Hyrup et al. (1996) Bioorgan. Med. Chem. 4:5. Furthermore, the deoxyphosphate skeleton may be substituted with, for example, a phosphorothioate or phosphorodithioate skeleton, a phosphoramidite or alkylphosphotryster skeleton. Nucleic acid sequences may be operably ligated to regulatory regions such as promoters. Regulatory regions may be of any species origin. As used herein, operably ligated means the placement of a regulatory region on a nucleic acid sequence such that it enables or promotes the transcription of the target nucleic acid. Any type of promoter may be operably ligated to a nucleic acid sequence. Examples of promoters include, but are not limited to, tissue-specific promoters, constitutive promoters, and promoters that are responsive or unresponsive to specific stimuli (e.g., inductive promoters).

[0075] Further regions that may be useful in nucleic acid constructs include, but are not limited to, polyadenylated sequences, translational regulatory sequences (e.g., intra-sequence ribosome entry segments, IRESs), enhancers, inducible elements, or introns. While such regulatory regions may not be necessary, they can increase expression by influencing mRNA transcription, stability, and translation efficiency. Such regulatory regions may be included in the nucleic acid construct as needed to achieve optimal nucleic acid expression in the cell. However, sufficient expression may be achieved without such additional elements.

[0076] Nucleic acid constructs encoding signal peptides or selectable markers may be used. Signaling (marker) peptides may be used so that the encoded polypeptide is directed to a specific cellular location (e.g., the cell surface). Non-limiting examples of such selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase, thymidine kinase (TK), and xanthine-guanine phosphoribosyltransferase (XGPRT). These markers are useful for selecting stable transformants in culture. Other selectable markers include fluorescent polypeptides, such as green fluorescent protein, red fluorescent protein, or yellow fluorescent protein.

[0077] Nucleic acid constructs can be introduced into any type of cell using various biological techniques known in the art. Non-limiting examples of these techniques include the use of transposon systems, recombinant viruses capable of infecting cells, or other non-viral methods capable of delivering liposomes or nucleic acids to cells, such as electroporation, microinjection, or calcium phosphate precipitation. A system called Nucleofection™ may also be used.

[0078] Nucleic acids can be incorporated into vectors. A vector is a broad term encompassing any specific DNA segment designed to move from a carrier to a target DNA. A vector may also be called an expression vector or vector system, which is a set of components required to perform DNA insertion into a genome or other targeted DNA sequence, such as an episome, plasmid, or even a viral / phage DNA segment. A vector most often contains one or more expression cassettes, each containing one or more regulatory sequences, where each regulatory sequence is a DNA sequence that modulates and controls the transcription and / or translation of a different DNA sequence or mRNA.

[0079] Many different types of vectors are known in the art. For example, viral vectors, including plasmids and retroviral vectors, are known. Mammalian expression plasmids generally have an origin of replication, a suitable promoter and any enhancer, as well as any necessary ribosome binding sites, polyadenylation sites, splice donor and receptor sites, a transcription termination sequence and a 5' flanking nontranscription sequence. Such vectors include plasmids (which may also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAVs), lentiviruses (e.g., modified HIV-1, SIV, or FIV), retroviruses (e.g., ASV, ALV, or MoMLV), and transposons (P-element, Tol-2, Frog Prince, piggyBac, etc.).

[0080] The bacterial and viral genes and proteins for use in this disclosure are listed below in the section titled “Sequences of this Disclosure.” Other viral integrases, such as those derived from mouse mammary cancer virus (MMTV) and adenovirus, may also be used in the methods and compositions disclosed herein.

[0081] The edited cell pool can be thought of as a mixture of cells that have undergone gene editing and those that have not.

[0082] Typical ABBIE1 in vitro assay 1) Warm the ABBIE1 protein together with the guide RNA; 2) Incubate ABBIE1 / guide RNA with donor DNA having a partial LTR to form a pre-initiation complex; 3) Warm the pre-initiation complex with the plasmid containing the gene to be edited (e.g., CXCR4); and 4) Confirm the integration of donor DNA by PCR and DNA sequencing.

[0083] The Cas9 protocol is described, for example, in Gagnon et al., 2014, http: / / labs.mcb.harvard.edu / schier / VertEmbryo / Cas9_Protocols.pdf.

[0084] Assays on integrase activity are described, for example, in Merkel et al., Methods, 2009, volume 47, pages 243-248. [Examples]

[0085] The following examples are intended to illustrate the application of the Disclosure. These examples are not intended to define or limit the scope of the Disclosure. As will be obvious to those skilled in the art, many other methods known in the art may be substituted for those specifically described or referenced herein.

[0086] Example 1: DNA vector for expressing Cas9-integrase fusion protein The non-catalyzed Cas9 DNA sequence is incorporated into the expression vector using 12, 15, 18, 21, 24, 27, or 30 bp spacers (encoding 4, 5, 6, 7, 8, 9, or 10 amino acids as linkers between Cas9 and integrase) and HIV1 integrase. In other experiments, bacterial or phage-derived recombinases are used instead of integrases. These include Hin recombinases (SEQ ID NO: 25) and Cre recombinases (SEQ ID NO: 26) with or without mutations that allow DNA recombination at any other site. His or cMyc tags (or other sequences useful for protein purification) may be included to isolate the fusion protein. The expression vector uses a promoter that is activated in cells provided with the vector. CMV (cytomegalovirus promoter) is commonly used for expression vectors for mammalian cells. The U6 promoter is also commonly used. The T7 promoter may be used for in vitro transcription in certain embodiments.

[0087] Example 2: DNA vector for the expression of a DNA sequence of interest (gene of interest) The DNA sequence of interest is inserted into a suitable expression vector, and a site is appropriately attached to the DNA sequence of interest so that HIV1 integrase recognizes the sequence for integration into the genome. These sites are called att sites (U5 and U3 att sites) (see Masuda et al, Journal of Virology, 1998, volume 72, pages 8396-8402). Homologous arms to the target site in the genome may be located in regions adjacent to the 5' and 3' ends of the DNA (gene) sequence of interest (see Ishii et al, PLOS ONE, September 24, 2014, DOI:10.1371 / journal.pone.0108236). When using recombinase, the integrase recognition site may not be included. Markers such as drug resistance markers (e.g., blastocydin or puromycin) are included to investigate insertions of the DNA sequence of interest and to aid in assays for random insertions in the genome. These resistance markers can be modified to remove them from the targeted genomic landing pad. For example, by flanking a puromycin resistance gene containing a LoxP site and introducing exogenously expressed CRE, the scar-forming internal sequence containing the LoxP site is removed.

[0088] Example 3: DNA vector for reverse transcriptase expression Reverse transcriptase can also be co-expressed in systems where the designed DNA sequence (gene) of interest in the vector is expressed as RNA and must be converted back to DNA for integration by an integrase enzyme. The reverse transcriptase may be of viral origin (e.g., a retrovirus such as HIV1). This can be integrated into the same vector as the DNA sequence of interest.

[0089] Example 4: Co-expression of DNA-targeted integrase (or recombinase) with a DNA sequence of interest Cells were electroporated with the above vectors along with the Cas9 RNA guide required for target sites in the genome. In some experiments, vectors were constructed expressing all components (the fused Cas9 / integrase (or recombinase), Cas9 RNA guide, and the DNA sequence of interest with or without homologous arms). Reverse transcriptase may also be co-expressed in systems where the designed DNA sequence (gene) of interest in the vector is expressed as RNA and must be converted back to DNA for integration by the integrase enzyme. The reverse transcriptase may be of viral origin (e.g., retrovirus such as HIV1). In other experiments, the DNA sequence of interest is linearized before introduction into cells. Before use according to standard molecular biology protocols, the Cas9 RNA guide sequence and the DNA sequence of interest must be designed and inserted into the vector.

[0090] Example 5: Experimental experiments and assays for off-target insertion Transfusion or electroporation is performed into cells in which the expression of a specific gene is lost, such as mouse embryonic fibroblasts from a knockout mouse model or cells genetically engineered to cause knockout of a particular gene. The initial pool of edited cells is screened using a set of chimeric primers designed to contain the inserted gene and adjacent genomic sequences. Limiting dilution cloning (LDC) and / or FACS analysis are then performed to ensure monoclonality. Next-generation sequencing (NGS) or single nucleotide polymorphism (SNP) analysis is performed as a final quality control step to ensure that isolated clones are homogeneous with respect to the edits designed. Other mechanisms for screening may include, but are not limited to, qRT-PCR and Western blotting with appropriate antibodies. If the protein is associated with a certain phenotype of the cell, the cell can be examined for rescue of that phenotype. The genome of the cell is assayed to determine the specificity of the DNA insertion and, if present, the relative number of off-target insertions.

[0091] Example 6: Expression and isolation of Cas9-linked integrase protein A vector designed for gene expression in E. coli or insect cells is incorporated into E. coli or insect cells and expressed for a given time. Several designs are utilized to produce a Cas9 (or inactive Cas9)-linked integrase protein. The vector also incorporates a tag, not limited to His or cMyc tags, for final isolation of the protein in high purity and high yield. Preparation of the chimeric protein includes, but is not limited to, standard chromatography techniques. The protein may also be designed using one or more NLS (nuclear localization signal sequences) and / or TAT sequences. The nuclear localization signal allows the protein to translocate to the nucleus. The TAT sequence allows the protein to translocate more easily into cells (it is a cell-permeable peptide). Other cell-permeable peptides in the art may also be considered. After sufficient time for expression, the protein lysate is collected from the cells and purified on an appropriate column, depending on the tag used. The purified protein is then placed in an appropriate buffer solution and stored at either -20 or -80°C.

[0092] Example 7: Use of Cas9-integrase to insert a stop codon directly upstream of the transcription start site This disclosure includes a method for producing a knockout cell line or organism. The above system is used with a DNA sequence of interest in which 1, 3, 6, 10, 15, or 20 consecutive stop codons are placed immediately after the ATG start site for the target gene. This produces an effective gene knockout because transcription / translation is stopped when the stop codon immediately after the ATG start site is reached. Further stop codons facilitate the prevention of possible bypass by the transcriptionase (if the transcriptionase bypasses the first stop codon).

[0093] Example 8: Use of ABBIE1 (or other variants with specific DNA-binding domains) as a purified protein for editing the cell genome. Incubate the Abbie1 isolated protein (another specific DNA sequence binding protein linked to retroviral integrase) with insertable / integrable DNA containing the viral LTR region in a suitable buffer (for the formation of tetramers or other multimers, depending on the case). Alternatively, a pre-constructed composition of the isolated Abbie1 protein with guide RNA can be combined with the insertable DNA sequence. Incubate the mixture containing the guide RNA to incorporate the guide RNA. Transplant or electroporate (or use other techniques to deliver the protein to the cells) the Abbie1 / DNA preparation into the cells. Take into account the time required for genome / DNA editing. Examine the insertion of the designed insertable DNA sequence into specific sites in the cell's genomic DNA. Examine nonspecific insertions by PCR and DNA sequencing.

[0094] The current plan is to use pMAL-c5e as the bacterial expression vector, which is a discontinued product from NEB and one of the in-house cloning options for Genscript. Codon-optimized Spy Cas9 will be cloned with a maltose-binding protein (MBP) tag and in-frame his tag and TEV protease cleavage site. The ORF is under an inducible Tac promoter, and the vector also encodes a lac repressor (LacI) for tighter control. Since amylose resin is very expensive, MBP will be used only as a stabilization tag and not a purification tag. The soluble expression material will be purified on Ni-affinity chromatography, then Cas9 will be released by TEV protease from MBP, purified by cation exchange chromatography, and further purified by gel filtration.

[0095] Example 9: Design of a construct for a fusion protein Design sequence-specific zinc finger domains, TALEs, or guide RNAs for CRISPR-based approaches to target DNA sequences. Use optimal online design software.

[0096] To form site-specific fusion integrase proteins, construct DNA constructs containing an integrase, transposase, or recombinase; a suitable amino acid linker; a suitable zinc finger, TALE, or CRISPR protein (e.g., Cas9, Cpf1); and a coding sequence for a nuclear localization signal (or mitochondrial localization signal). These are assumed to be in multiple configurations. If necessary, a suitable tag may be included for protein isolation and purification (e.g., maltose-binding protein (MBP) or His tag).

[0097] The DNA construct can utilize mammalian cell promoters or bacterial promoters that are common in this art (e.g., CMV, T7, etc.).

[0098] Recombinant fusion proteins can be prepared using Escherichia coli (E. coli) as the source. The proteins are isolated using standard methods in the art (e.g., MBP columns, nickel-Sepharose columns, etc.).

[0099] Assembling the donor-RNP complex (double-stranding the RNA oligo and mixing it with the fusion protein of the present invention (if the fusion protein has an endonuclease-inactive CRISPR-related protein for its DNA binding ability, e.g., ABBIE1)) - these steps of RNP formation are not necessary in the case of zinc finger domains and TALEs. 1. Mix the donor DNA with the appropriate LTR domain, insertable sequence, and fusion protein, and allow to stand for 10 minutes (or add the donor DNA after RNP complex formation). 2. Suspend each RNA oligo (crRNA and tracrRNA) in nuclease-free IDTE buffer. For example, use a final concentration of 100 μM. 3. Mix these two RNA oligos at equimolar concentrations in a sterile microcentrifuge tube. For example, use the following table to achieve a final double-stranded concentration of 3 μM: 3 μL of 100 μM crRNA, 3 μL of 100 μM tracrRNA, 94 μL of nuclease-free double-stranded buffer, and a final volume of 100 μL. Heat at 4.95°C for 5 minutes. 5. Remove from heat and allow to cool to room temperature (15-25°C) on a tabletop. 6. If necessary, dilute the double-stranded RNA in nuclease-free double-stranded buffer to a working concentration (e.g., 3 μM). 7. Dilute the fusion protein to a working concentration (e.g., 5 μM) in a working buffer (20 mM HEPES, 150 mM KCl, 5% glycerol, 1 mM DTT, pH 7.5). 8. For each translocation, combine 1.5 pmol of double-stranded RNA oligo (step A5) with 1.5 pmol of fusion protein (step A6) in Opti-MEM medium to a final volume of 12.5 μL. 9. Allow the RNP complex to rise at room temperature for 5 minutes to assemble.

[0100] Example 10: GRNA-fusion protein is reverse-transferred into a 96-well plate. 1. Allow the following to form a translocation complex by incubating at room temperature for 20 minutes: Component amounts: RNP (stage A8) 12.5 μL, Lipofectamine® RNAiMAX translocation reagent 1.2 μL, Opti-MEM® medium 11.3 μL. Total volume 25.0 μL. 2. During incubation (stage B1), dilute the cultured cells to 400,000 cells / mL using complete medium without antibiotics. 3. Once the incubation period is complete, add 25 μL of the plasma transfer complex (from step B1) to the 96-well tissue culture plate. Add 4.125 μL of diluted cells (from step B2) to a 96-well tissue culture plate (50,000 cells / well, final RNP concentration will be 10 nM). 5. Incubate the plate containing the translocation complex and cells in a tissue culture incubator (37°C, 5% CO2) for 48 hours. Use PCR with appropriate primers (primers within the donor sequence and primers surrounding the target insertion site) to detect on-target mutations.

[0101] Example 11: Protocol for testing the specificity of CRISPR / CAS9 We will create dCas9 (DNA-cleaving inactive Cas9) that is linked to biotin (dCas9-biotin). Cas9 (e.g., S. pyogenes, S. aureus). The biotinylation method is described below.

[0102] Biotinylation Method #1: Manipulate the avi tag (approximately 15 residues) at the N- or C-terminus, express it as a WT (untagged) protein, and purify it. Biotinylate the avi-tagged Cas9 using E. coli biotin ligase (BirA) and biotin. The inventors use this scheme to biotinylate chemokines. The inventors believe that the IP on avi-tagging technology expired several years ago.

[0103] Biotinylation Method #2.1: Biotinylation of succinimidyl esters can be incorporated at surface-exposed lysine residues (no enzymatic reaction required). This may be a viable option for proteins of a similar size to Cas9.

[0104] Biotinylation method #2.2: Similarly, biotin-maleimide is commercially available and can be complexed with surface-exposed cysteine ​​(without enzymes).

[0105] Tests will be performed to characterize biotinylated Cas9 does with respect to DNA binding and cleavage.

[0106] Streptoavidin-coated 96-well plates are commercially available, but they can also be prepared in-house.

[0107] dCas9-biotin is bound to plastic plates (96-well, 24-well, 384-well, etc.).

[0108] Provide a designed guide RNA in each well. Consider the time required for the guide RNA to interact with the Cas9 protein.

[0109] Each well is provided with genomic DNA or DNA containing the targeted sequence. Time is taken into consideration for Cas9 binding to the DNA.

[0110] Wash the wells with an appropriate buffer solution.

[0111] Provide an adapter (DNA oligomer). Consider the time required for binding.

[0112] The genomic DNA is restricted and digested to make it easier to handle and connect to adapters.

[0113] Well cleaning DNA sequencing is performed to identify the binding site (on-target vs. off-target).

[0114] Example 12: NRF2 editing via ABBIE1 Figure 5 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide NrF2-sgRNA2 and sgRNA3. PCR is used to screen for exon 2-targeted Nrf2 loci for Abbie1 editing-mediated knockout. Abbie1 translocation targeting exon 2 of Nrf2 using guide NrF2-sgRNA2 and 3 showed donor integration in the targeted region. Specific bands are labeled 1-8.

[0115] Figure 6 shows theoretical data generated by Abbie1 gene editing. It is a representative example of DNA gel electrophoresis visualizing donor DNA insertions via the Abbie1 system for targeting genomic material using sgRNA1-3. The black bands correspond to background products resulting from the PCR method. The red bands correspond to specific products generated by growing the insertion and the gene material adjacent to the insertion region. Multiple bands correspond to multiple possible insertions in the target region.

[0116] Figure 7 shows Abbie1 gene editing targeting exon 2 of Nrf2 using guide Nrf2-sgRNA3. PCR screens the exon 2-targeted Nrf2 locus for Abbie1 editing-mediated knockout. Exon 2 targeting of Nrf2 using guide Nrf2-sgRNA3 suggested donor insertion, as indicated by PCR primers designed for the donor sequence and the proximal site of the expected insertion. Specific bands are denoted as 1-4.

[0117] Figure 8 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. (A) Western blot analysis using a polyclonal antibody (Santa Cruz Bio) against the 55kD isoform showing Nrf2 knockout in a pooled HEK293T population. (B) GAPDH (Santa Cruz Bio) loading control.

[0118] Figure 9 shows Abbie1 knockout of Nrf2 in pooled Hek293T-cells. (A) Western blot analysis using a monoclonal antibody against Nrf2 (Abcam) showing knockout of the Nrf2 pool population in HEK293T-cells. (B) GAPDH loading control. (C) Average of concentration measurement analysis showing the decrease in expression ratio compared to the control.

[0119] Abbie1-treated cells produce a distinctive PCR band indicating donor DNA integration. Phenotypic confirmation of knockout in the HEK293T pooled cell line was confirmed via Western blot analysis exploring two isoforms using specific and distinct antibodies. Approximately 80% knockout due to integration was observed in the pooled population within two weeks.

[0120] Example 13: CXCR4 editing via ABBIE1 Figure 10 shows Abbie1 gene editing targeting CXCR4 exon 2. PCR screens for targeting of exon 2 of CXCR4 edited via Abbie1. Four sets of primers were designed for the region of interest. Sets 2 and 4 appeared to produce distinctive bands suggesting donor DNA integration in the region of interest.

[0121] Example 14: Transfusion for knock-in experiments at the NRF2 gene locus using ABBIE1 Note: Use 500 ng of protein and 120 ng of sgRNA per reaction. The amount of DNA depends on the size of the donor construct. Donor DNA (DNA with LTR sequences) can be incubated with ABBIE1 before, during, or after donation / transfer / electroporation to cells. Prepare the entire reaction in a sterile biosafety cabinet.

[0122] Day 1: Human fetal kidney (HEK293T) cells were seeded in 500 μL DMEM (Gibco) supplemented with 10% fetal sheep serum (Omega Scientific) at a rate of 200,000 HEK293T-cells (ATCC) per well in 24-well culture plates (Corning). The cells were allowed to recover for 24 hours.

[0123] Day 2: ABBIE1 preparation: Tube 1: Purified ABBIE1 protein (SEQ ID NO: 58) and donor DNA (SEQ ID NO: 101) were incubated in a 1:1 molar ratio serum-depleted transfusion medium (OptiMEM, Life Technologies) at room temperature for 10 minutes. sgRNA was added to the protein / DNA complex in a 1.3-fold molar excess (approximately 120 ng), and incubation was continued at room temperature for another 10 minutes. The volume of this mixture was 25 μL.

[0124] Tube 2: 2 μL of translocation reagent (RNAiMAX, Life Technologies) was added to 23 μL of OptiMEM. The mixture was left to stand at room temperature for 10 minutes.

[0125] Tube 1 and Test Tube 2 (final volume 50 mL) were combined and left to stand at room temperature for 15 minutes.

[0126] The entire 50 μL of transfusion mixture was added to the wells.

[0127] To validate genomic DNA editing in a pooled population, half of the pooled edited cells were harvested 48 hours after translocation. Validation of the edited genome was performed by polymerase chain reaction (PCR). The inventors performed PCR on the target region as described below (see PCR protocol), and seeded the remainder on a 6 cm culture dish (Corning) and allowed to recover for 48 hours.

[0128] Day 5: Screening of phenotypic changes via Western blotting Standard Western blot analysis was performed on NrF2 isoforms using primary antibodies targeting the 55kD and 98kD isoforms (Santa Cruz Biotechnology, sc-722 for the 55kD isoform) and Abcam, ab-62352 for the 98kD isoform. GAPDH (Santa Cruz Biotechnology, sc-51907).

[0129] Example 15: PCR conditions for detecting gene editing using Abbie1 against NRF2 and CXCR4 loci Acceptance number for human Nrf2 Uniprot:Q16236 Ensembl gene ID: ENSG00000116044

[0130] Editing of target sequences and PAMs for Nrf2 (exon 2): Designs 1-3 were used for sgRNA. GCGACGGAAAGAGTATGAGC TGG TATTTGACTTCAGTCAGCGA CGG TGGAGGCAAGATATAGATCT TGG

[0131] Primer key for embedded detection of Nrf2 target Primer set 1: Primer 1: 5'-GTGTTAATTTCAAACATCAGCAGC-3', Primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 2: Primer 1: 5'-GAGGTTGACTGTGTAAATG-3', Primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer set 3: Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', Primer 2: 5'-GATACCAGAGTCACACAACAG-3'

[0132] Acceptance number for human CXCR4 Uniprot P61073 Ensembl gene ID: ENSG00000121966

[0133] Editing of the target sequence and PAM for CXCR4 (exon 2): Design 1 was used for sgRNA. GGGCAATGGATTGGTCATCC TGG

[0134] Primer key for embedded detection in CXCR4 target Primer set 1: Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', Primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 2: Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', Primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer Set 3: Primer 1: 5'-GAGGTTGACTGTGTAAATG-3', Primer 2: 5'-GACAAGACATCCTTGATTTG-3' Primer set 4: Primer 1: 5'-GAGGTTGACTGTGTAAATG-3', Primer 2: 5'-GATACCAGAGTCACACAACAG-3' TIFF0007882491000001.tif81170

[0135] Cas9 for adding AVI tags for biotinylation The sequence of the AVI tag used for Cas9 biotinylation. Amino acid sequence: TIFF0007882491000002.tif9170

[0136] Nucleic acid sequence: TIFF0007882491000003.tif17170

[0137] First underlined section = Cas9C-terminus Italicized section = restriction area / linker The second underlined section = avi tag (highlighting the biotinylated site)

[0138] Example 16: Expression protocol for ABBIE1 fusion protein Transformation of an expression construct containing a full-length fusion protein (SEQ ID NO: 57). Remove competent E. coli cells from a -80°C freezer. Turn on the water bath and set the temperature to 42°C. Place competent cells in a 1.5 mL tube (Eppendorf or similar). Use 50 μL of competent cells to perform DNA construct transformation. Keep the tube on the ice. 50 ng of circular DNA is added to E. coli cells. Competent cells are frozen and thawed by keeping them on ice for 10 minutes. Place the tube containing DNA and E. coli cells in a 42°C water bath for 45 seconds. Return the tube to ice for 2 minutes to reduce damage to the E. coli cells. Add 1 mL of LB (without antibiotic). Incubate the tube at 37°C for 1 hour (the tube can be incubated for 30 minutes). Spread approximately 100 μL of the obtained culture onto an LB plate containing the appropriate antibiotic. You will find the colony in about 12-16 hours.

[0139] Inoculation and proliferation Inoculate into a 1L flask containing LB and antibiotics. The bacterial culture was grown until it reached 0.6 OD, and then induced with isopropyl β-D-1-thiogalactopyranoside (IPTG) at a final concentration of 1 mM. The culture is allowed to grow for 6-8 hours, and the suspended bacterial culture is centrifuged for 10 minutes at a minimum force of 2000G. The pellets are frozen at -80°C for further processing.

[0140] Protein preparation and purification All steps should be performed at room temperature.

[0141] Lysozyme cells are lysed by two freeze-thaw cycles in 20 mM Tris pH 8.0, 300 mM NaCl, and 0.1 mg / ml chicken egg white lysozyme. The mixture is centrifuged at 6,000 g for 15 minutes, and the supernatant is retained.

[0142] The supernatant is placed on a Ni-IDA agarose column equilibrated in 20 mM Tris pH 8.0 and 300 mM sodium chloride. Proteins are eluted using an imidazole gradient from 0 to 200 mM. The fraction containing the fusion protein is identified by 7% SDS-PAGE.

[0143] The fractions are pooled and diluted with 20 mM Tris pH 8.0 to a final NaCl concentration of 50 mM. The fractions are placed on a Q-Sepharose column and eluted with a sodium chloride gradient from 0 to 500 mM. The fractions containing the fusion protein are identified by 7% SDS-PAGE.

[0144] The fractions are pooled and diluted with 20 mM Tris pH 8.0 to a final NaCl concentration of 100 mM. The fractions are placed on an SP-Sepharose column and eluted with a sodium chloride gradient from 0 to 500 mM. The fractions containing the fusion protein are identified by 7% SDS-PAGE.

[0145] The fractions are pooled, their concentration is measured by UV absorption at 280 nm, and the mixture is concentrated by centrifugal filtration to a final concentration of 400 μg / ml. Glycerol is added to bring the final concentration to 50%. Store at -20°C.

[0146] While certain embodiments have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided merely as examples. Many variations, alterations, and substitutions will be conceivable to those skilled in the art without departure from this disclosure. It should be understood that in the practice of this disclosure, various substitutes may be used for the embodiments of disclosure described herein. The following claims define the scope of this disclosure, thereby encompassing the methods and structures within those claims and their equivalents.

[0147] The array of the present disclosure For each sequence provided below, the following information is provided: sequence type (nucleic acid or amino acid), origin (e.g., Escherichia coli (E. coli)), length, and identification number (if available).

[0148] The first polynucleotide of this disclosure may encode, for example, Cas9, Cpf1, TALE, or ZnFn proteins. The second polynucleotide of this disclosure may encode, for example, integrases, transposases, or recombinases. Representative first and second polynucleotide sequences and protein sequences that may be used in the compositions (constructs, fusion proteins) and methods described herein are listed below along with representative linker sequences. Other polynucleotide sequences, protein sequences, or linker sequences not listed in Table 1 below may be provided in this disclosure and may be used in the compositions (constructs, fusion proteins) and methods described herein. For example, SEQ ID NO: 49, SEQ ID NO: 57, SEQ ID NO: 58, and / or parts thereof.

[0149] The linker can be of any length, e.g., 3 to 300 nucleotides, 6 to 60 nucleotides, or any length to which the first and second polynucleotides can be fused. Polypeptides can be produced by organisms, such as Escherichia coli, or synthesized, or a combination of both.

[0150] Representative nucleic acid sequences: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 27-47, 49, 55, 56, 57, 62, 64, 66, 68, 70, 79, 82, and 83.

[0151] Typical amino acid sequences: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 26, 48, 50, 52, 58, 63, 65, 67, 69, 71, 72-78 and 80. TIFF0007882491000004.tif69170TIFF0007882491000005.tif181170

[0152] Further arrangement Sequence ID 1 Name: S. thermophilus Csn1 cds HQ712120.1 array: TIFF0007882491000006.tif151170 TIFF0007882491000007.tif233170 TIFF0007882491000008.tif216170

[0153] Sequence ID 2 array: TIFF0007882491000009.tif195170

[0154] Sequence ID 3 Name: P. multocida Cas9 array: TIFF0007882491000010.tif20170 TIFF0007882491000011.tif234170 TIFF0007882491000012.tif211170

[0155] Sequence ID 4 array: TIFF0007882491000013.tif149170

[0156] Sequence ID 5 Name: S. mutans (Cas9) array: TIFF0007882491000014.tif64170 TIFF0007882491000015.tif234170 TIFF0007882491000016.tif234170 TIFF0007882491000017.tif60170

[0157] Sequence ID 6 array: TIFF0007882491000018.tif190170

[0158] Sequence ID 7 Name: N. meningitides (Cas9) array: TIFF0007882491000019.tif179170 TIFF0007882491000020.tif234170 TIFF0007882491000021.tif60170

[0159] Sequence ID 8 array: TIFF0007882491000022.tif147170

[0160] Sequence ID 9 array: TIFF0007882491000023.tif223170 TIFF0007882491000024.tif237170 TIFF0007882491000025.tif142170

[0161] Sequence ID 10 Name: gi|777888062|gb|KJQ69483.1|CRISPR-related endonuclease Cas9 [Streptococcus mitis] array: TIFF0007882491000026.tif195170

[0162] Sequence ID 11 array: TIFF0007882491000027.tif84170 TIFF0007882491000028.tif235170 TIFF0007882491000029.tif237170 TIFF0007882491000030.tif33170

[0163] Sequence ID 12 Name: gi|357584860|gb|EHJ52063.1|CRISPR-related protein Cas9 / Csn1, subtype II / NMEMI [Streptococcus macacae NCTC11558] array: TIFF0007882491000031.tif188170

[0164] Sequence ID 13 array: TIFF0007882491000032.tif201170 TIFF0007882491000033.tif234170 TIFF0007882491000034.tif157170

[0165] Sequence ID 14 Name: gi|409693032|gb|AFV37892.1|CRISPR-related protein, Csn1 family [Streptococcus pyogenes A20] array: TIFF0007882491000035.tif187170

[0166] Sequence ID 15 Name: gi|150381361|gb|EF472760.1|USA HIV-1 clone 39B from the integrase (pol) gene, partial cds array: TIFF0007882491000036.tif128170

[0167] Sequence ID 16 Name: gi|150381362|gb|ABR68182.1|Integrase, partial [Human Immunodeficiency Virus 1] array: TIFF0007882491000037.tif46170

[0168] Sequence ID 17 Name: gi|459980|gb|L20651.1|STLKIAPOL Monkey T-cell lymphotropic virus type I integrase (pol) gene, partial cds array: TIFF0007882491000038.tif30170

[0169] Sequence ID 18 Name: gi|459981|gb|AAA47841.1|Integrase, partially [Monkey T-lymphotropic virus 1] array: LVERSNGILKTLLYKYFTDKPDLPMDNALSIALWTINHLNVLTHCH

[0170] Sequence ID 19 Name: gi|321156784:1-1509 Streptococcus pneumoniae embedded and bonding element ICESpn11930, stock 11930 array: TIFF0007882491000039.tif194170 TIFF0007882491000040.tif127170

[0171] Sequence ID 20 Name: gi|321156785|emb|CBW38769.1|Integrase [Streptococcus pneumoniae] array: TIFF0007882491000041.tif113170

[0172] Sequence ID 21 Name: gi|43090: 1-436 Escherichia coli (Tn5086) dhfr VII gene and sul I gene, 5' end (integrase) against type VII dihydrofolate reductase array: TIFF0007882491000042.tif95170

[0173] Sequence ID 22 Name: gi|43091|emb|CAA41325.1|Integrase, partial (plasmid) [Escherichia coli] array: TIFF0007882491000043.tif38170

[0174] Sequence ID 23 >gi|397912605:40372-41898 Thermoanaerobacterium phage THSA-485A, complete genome-recombinase TIFF0007882491000044.tif210170 TIFF0007882491000045.tif120170

[0175] Sequence ID 24 >gi|397912662|ref|YP_006546326.1|Recombinase [Thermoanaerobacterium phage THSA-485A] TIFF0007882491000046.tif115170

[0176] Sequence ID 25 Gin Recombinase >gi|657193240|sp|Q38199.2|GIN_BPD10 RecName:Full=Serine recombinase gin;Alternate name:Full=G-segment invertase;Abbreviation=Gin TIFF0007882491000047.tif46170

[0177] Sequence ID 26 Cre recombinase >gi|375331813|dbj|BAL61207.1|Cre recombinase [Cre-expression vector pHVX2-cre] TIFF0007882491000048.tif75170

[0178] Sequence IDs 27-46 These are representative sequences of polynucleotides encoding TALE repeat modules for use in ligation to integrases or recombinases, as described in the present invention.

[0179] Sequence ID 27 Name:NI array: TIFF0007882491000049.tif23170

[0180] Sequence ID 28 Name:NG array: TIFF0007882491000050.tif23170

[0181] Sequence ID 29 Name: HD array: TIFF0007882491000051.tif23170

[0182] Sequence ID 30 Name:NN array: TIFF0007882491000052.tif23170

[0183] Sequence ID 31 Name: NI-NI array: TIFF0007882491000053.tif37170

[0184] Sequence ID 32 Name:NI-NG array: TIFF0007882491000054.tif38170

[0185] Sequence ID 33 Name:NI-HD array: TIFF0007882491000055.tif37170

[0186] Sequence ID 34 Name:NI-NN array: TIFF0007882491000056.tif37170

[0187] Sequence ID 35 Name:NG-NI array: TIFF0007882491000057.tif42170

[0188] Sequence ID 36 Name: NG-NG array: TIFF0007882491000058.tif37170

[0189] Sequence ID 37 Name: NG-HD Array: TIFF0007882491000059.tif31170

[0190] Array number 38 Name: NG-NN Array: TIFF0007882491000060.tif38170

[0191] Array number 39 Name: HD-NI Array: TIFF0007882491000061.tif40170

[0192] Array number 40 Name: HD-NG Array: TIFF0007882491000062.tif30170

[0193] Array number 41 Name: HD-HD Array: TIFF0007882491000063.tif38170

[0194] Array number 42 Name: HD-NN Array: TIFF0007882491000064.tif39170

[0195] Array number 43 Name: NN-NI Array: TIFF0007882491000065.tif39170

[0196] Array number 44 Name: NN-NG Array: TIFF0007882491000066.tif38170

[0197] Array number 45 Name: NN-HD Array: TIFF0007882491000067.tif38170

[0198] Array number 46 Name: NN-NN Array: TIFF0007882491000068.tif30170

[0199] Array number 47 Name: gi|71796612|gb|DQ084353.1|Ovine lentivirus isolate Ov10 integrase (pol) gene, partial cds Array: TIFF0007882491000069.tif55170

[0200] Array number 48 Name: gi|71796613|gb|AAZ41325.1|Integrase, partial [Ovine lentivirus] Array: TIFF0007882491000070.tif24170

[0201] [[ID=5Q]]Array number 49 >gb|AYLT01000127.1|:11804-12046 Staphylococcus aureus subsp. aureus SK1585 contig, whole genome shotgun sequence TIFF0007882491000071.tif53170

[0202] Array number 50 >gi|669035130|gb|KFD30483.1|Hypothetical protein D484_02234[Staphylococcus aureus subspecies aureus SK1585]-S. aureus cas9 TIFF0007882491000072.tif23170

[0203] Sequence ID 51 Name: Linker 2 DNA array: agcggcagcgaaaccccgggcaccagcgaaagcgcgaccccggaaagc

[0204] Sequence ID 52 Name: dCas9 protein array: TIFF0007882491000073.tif220170 TIFF0007882491000074.tif90170

[0205] Sequence ID 53 Name: NLS nucleotides with ATG array: TIFF0007882491000075.tif31170

[0206] Sequence ID 54 Name: GGS Linker Nucleotide array: GGGGGAAGT

[0207] Sequence ID 55 Name: Synthetic integrase array: TIFF0007882491000076.tif187170

[0208] Sequence ID 56 Name: dCas9 nucleotide with ATG array: TIFF0007882491000077.tif58170 TIFF0007882491000078.tif233170 TIFF0007882491000079.tif233170 TIFF0007882491000080.tif232170 TIFF0007882491000081.tif234170 TIFF0007882491000082.tif37170

[0209] Sequence ID 57 Name: ABBIE1 (NLS-linker 1-integrase-linker 2-dCas9)-DNA sequence array: TIFF0007882491000083.tif170170 TIFF0007882491000084.tif235170 TIFF0007882491000085.tif233170 TIFF0007882491000086.tif234170 TIFF0007882491000087.tif233170 TIFF0007882491000088.tif134170

[0210] Sequence ID 58 Name: Translation of ABBIE1 (integrase editor based on binding) array: TIFF0007882491000089.tif76170 TIFF0007882491000090.tif235170 TIFF0007882491000091.tif25170 stopped (att site in the LTR region for integrase recognition) relative to donor DNA.

[0211] Sequence ID 59 Name:U3att array: ACTGGAAGGGCTAATTCACTCCCAAAGAA

[0212] Sequence ID 60 Name: U5att array: GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT NLS-linker1-integrase-linker2-dCas9 or integrase-linker1-NLS-linker2-dCas9 or integrase-linker2-dCas9-linker1-NLS or integrase-linker2-dCas9-NLS Linker 1 = GGS

[0213] Sequence ID 61 Name: Linker 2 array: SGSETPGTSESATPES

[0214] Sequence ID 62 Name: MMTV Integrase cDNA, gb|AF071010.1|:16-1113 Mouse Breast Cancer Virus Presumptive Integrase, env Polyprotein and Superantigen mRNA, Complete CDS array: TIFF0007882491000092.tif230170

[0215] Sequence ID 63 Name: gi|3273866|gb|AAC24859.1|Presumed integrase [mouse mammary cancer virus] array: TIFF0007882491000093.tif85170

[0216] Sequence ID 64 Name: gb|AXUN02000059.1|:5116-8850 Youngiibacter fragilis 232.1 contig_151, whole genome shotgun sequence-recombinase array: TIFF0007882491000094.tif137170 TIFF0007882491000095.tif227170 TIFF0007882491000096.tif228170 TIFF0007882491000097.tif216170

[0217] Sequence ID 65 Name: gi|564135645|gb|ETA81829.1|Recombinase [Youngiibacter fragilis 232.1] array: TIFF0007882491000098.tif222170 TIFF0007882491000099.tif38170

[0218] Sequence ID 66 Name: gi|571264543:16423-16770 Clostridium difficile transposon Tn6218, strain Ox42 transposase array: TIFF0007882491000100.tif75170

[0219] Sequence ID 67 Name: gi|571264559|emb|CDF47133.1|Transposase [Peptoclostridium difficile] array: TIFF0007882491000101.tif23170

[0220] Sequence ID 68 Name: gb|CP009444.1|:1317724-1320543 Francisella philomiragia strain GA01-2801, complete genome Cpf1 array: TIFF0007882491000102.tif19170TIFF0007882491000103.tif229170 TIFF0007882491000104.tif228170 TIFF0007882491000105.tif144170

[0221] Sequence ID 69 Name: gi|754264888|gb|AJI57252.1|CRISPR-related protein Cpf1, subtype PREFRAN [Francisella philomiragia] array: TIFF0007882491000106.tif86170

[0222] Sequence ID 70 Name: gi|438609|gb|L21188.1|HIV1NY5A Human Immunodeficiency Virus Type 1 Integrase Gene, 3' End array: TIFF0007882491000107.tif187170

[0223] Sequence ID 71 Name: gi|438610|gb|AAC37875.1|Integrase, partial [Human Immunodeficiency Virus 1] array: TIFF0007882491000108.tif67170

[0224] Sequence ID 72 Name: gi|545612232|ref|WP_021736722.1|Type V CRISPR-related protein Cpf1 [Acidaminococcus sp. BV3L6] array: TIFF0007882491000109.tif105170TIFF0007882491000110.tif172170

[0225] Sequence ID 73 Name: gi|769142322|ref|WP_044919442.1|Type V CRISPR-related protein Cpf1 [Lachnospiraceae bacterium MA2020] array: TIFF0007882491000111.tif33170TIFF0007882491000112.tif234170

[0226] Sequence ID 74 Name: gi|489130501|ref|WP_003040289.1|Type V CRISPR-related protein Cpf1 [Francisella tularensis] array: TIFF0007882491000113.tif194170TIFF0007882491000114.tif83170

[0227] Sequence ID 75 Name: gi|502240446|ref|WP_012739647.1|Type V CRISPR-related protein Cpf1[[Eubacterium]eligens] array: TIFF0007882491000115.tif119170 TIFF0007882491000116.tif157170

[0228] Sequence ID 76 Name: gi|537834683|ref|WP_020988726.1|V-type CRISPR-related protein Cpf1 [Leptospira inadai] array: TIFF0007882491000117.tif49170 TIFF0007882491000118.tif230170

[0229] Sequence ID 77 Name: gi|739008549|ref|WP_036890108.1|Type V CRISPR-related protein Cpf1 [Porphyromonas crevioricanis] array: TIFF0007882491000119.tif194170 TIFF0007882491000120.tif77170

[0230] Sequence ID 78 Name: gi|517171043|ref|WP_018359861.1|Type V CRISPR-related protein Cpf1 [Porphyromonas macacae] array: TIFF0007882491000121.tif120170 TIFF0007882491000122.tif149170

[0231] Sequence ID 79 Name: Integrase protein sequence found in the Uniprot region. DNA sequence obtained from GenBank. array: TIFF0007882491000123.tif128170

[0232] Sequence ID 80 Name:sp|P04585|1148-1435 array: TIFF0007882491000124.tif45170

[0233] Sequence ID 81 Protein domains that characterize zinc finger proteins CX(2-4)CX(12)HX(3-5)H (X(2-4) means, for example, XX, XXX, or XXXX)

[0234] Sequence ID 82 >gi|1616606|emb|X97044.1|Mouse mammary cancer virus 5'LTR DNA TIFF0007882491000125.tif48170 TIFF0007882491000126.tif241170

[0235] Sequence ID 83 >gi|1403387|emb|X98457.1|Mouse mammary cancer virus 3'LTR TIFF0007882491000127.tif192170 TIFF0007882491000128.tif40170

[0236] Sequence ID 84 >gi|119662099|emb|AM076881.1|Human Immunodeficiency Virus 1 Provirus 5' LTR, TAR element and U3, U5 and R repeat regions, clone PG232.14 TIFF0007882491000129.tif171170

[0237] Sequence ID 85 >gi|1072081|gb|U37267.1|HIV1U37267 Human Immunodeficiency Virus type 1 3' LTR region TIFF0007882491000130.tif110170

[0238] Sequence numbers 86-99 do not exist.

[0239] Sequence ID 100 Oligosaccharides for neo insertion into the cell genome (using the complete sequences of the 5' and 3' HIV LTRs) TIFF0007882491000131.tif63170 TIFF0007882491000132.tif186170 The first 5'LTR is underlined, the standard font is neo, and the 3'LTR is bold (1179bp).

[0240] Sequence ID 101 (224bp) neo sequences in shortened 5'LTR and 3'LTR The first 5'LTR is underlined, the standard font is neo, and the 3'LTR is bold. TIFF0007882491000133.tif49170

[0241] Regarding Sequence ID 72 Genbank Protein ID: WP_021736722.1 NCBI protein GI from NR database or local GI (relative to protein from WGS database): 545612232 Contig ID in the WGS database: AWUR01000016.1 Contig description: Acidaminococcus sp. BV3L6 contig 00028, whole genome shotgun sequence Protein integrity: complete Proteins analyzed experimentally: 8 Non-duplicate set: nr Organism: Acidaminococcus sp. (BV3L6) Classification: Bacteria, Firmicutes, Negativicutes, Selenomonadales, Acidaminococcaceae family, Acidaminococcus, Acidaminococcus sp. BV3L6

[0242] Regarding Sequence ID 73 Genbank Protein ID: WP_044919442.1 NCBI proteins from NR database or local GI (compared to proteins from WGS database): 769142322 Contig ID in the WGS database: JQKK01000008.1 Contig description: Lachnospiraceae bacterium MA2020 T348DRAFT_scaffold00007.7_C, whole genome shotgun sequence Protein integrity: complete Proteins analyzed experimentally: 9 Non-duplicate set: nr Organism: Lachnospiraceae_Bacteria_MA2020 Classification: Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Unclassified Lachnospiraceae, Lachnospiraceae bacteria MA2020

[0243] Further nucleic acid and protein sequences that may be used in the disclosed compositions and methods - CPF1 alignment. Sequence IDs 86-92; in top-to-bottom order in the chart. TIFF0007882491000134.tif193170 TIFF0007882491000135.tif192170 TIFF0007882491000136.tif192170 TIFF0007882491000137.tif98170

[0244] Further nucleic acid sequences and protein sequences that may be used in the disclosed compositions and methods - Cfp1 human cleavage protein alignments. SEQ ID NO: 86 (1st column) and SEQ ID NO: 90 (2nd column). TIFF0007882491000138.tif203170 TIFF0007882491000139.tif80170

[0245] Further nucleic acid and protein sequences that may be used in the disclosed compositions and methods. Table taken from Haft, D., et al. PLoS Computational Biology, November 2005, Vol.1, Issue 6, pp.474-483. Sequence IDs 200-253; in the order from top to bottom of the chart. TIFF0007882491000140.tif157170TIFF0007882491000141.tif60170

[0246] Editing of target sequences and PAMs for Nrf2 (exon 2): Designs 1-3 were used for sgRNA. Sequence ID 254 GCGACGGAAAGAGTATGAGC TGG Sequence ID 255 TATTTGACTTCAGTCAGCGA CGG Sequence ID 256 TGGAGGCAAGATATAGATCT TGG

[0247] Primer key for embedded detection of Nrf2 target Primer Set 1: Sequence ID 257 Primer 1: 5'-GTGTTAATTTCAAACATCAGCAGC-3', Sequence ID 258 Primer 2:5'-GACAAGACATCCTTGATTTG-3' Primer Set 2: Sequence ID 259 Primer 1:5'-GAGGTTGACTGTGTAAATG-3', Sequence ID 260 Primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer Set 3: Sequence ID 261 Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', Sequence ID 262 Primer 2: 5'-GATACCAGAGTCACACAACAG-3'

[0248] Acceptance number for human CXCR4 Uniprot P61073 Ensembl gene ID: ENSG00000121966

[0249] Editing of the target sequence and PAM for CXCR4 (exon 2): Design 1 was used for sgRNA. Sequence ID 263 GGGCAATGGATTGGTCATCC TGG

[0250] Primer key for embedded detection in CXCR4 target Primer Set 1: Sequence ID 264 Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', Sequence ID 265 Primer 2:5'-GACAAGACATCCTTGATTTG-3' Primer Set 2: Sequence ID 266 Primer 1: 5'-TCTACATTAATTCTCTTGTGC-3', Sequence ID 267 Primer 2: 5'-GATACCAGAGTCACACAACAG-3' Primer Set 3: Sequence ID 268 Primer 1:5'-GAGGTTGACTGTGTAAATG-3', Sequence ID 269 Primer 2:5'-GACAAGACATCCTTGATTTG-3' Primer Set 4: Sequence ID 270 Primer 1:5'-GAGGTTGACTGTGTAAATG-3', Sequence ID 271 Primer 2: 5'-GATACCAGAGTCACACAACAG-3'

[0251] Cas9 tagging for biotinylation The sequence of avi-tags used for Cas9 biotinylation. Amino acid sequence: Sequence ID 272 GGDLEGSGLNDIFEAQKIEWHE * Nucleic acid sequence: Sequence ID 273 TIFF0007882491000142.tif17170

Claims

1. A system for inserting donor nucleic acids into the genome, (a) A fusion protein comprising the following, (i) A first protein domain comprising a nuclease-inactive Cas9 protein, wherein the Cas9 protein is capable of specifically binding to a target DNA sequence in the presence of guide RNA (gRNA); (ii) a second protein domain containing viral integrase; and (iii) A linker that connects the first protein domain to the second protein domain; (b) gRNA and, (c) A polynucleotide comprising a donor nucleic acid, a first long terminal repeat (LTR), and a second LTR, wherein the donor nucleic acid is located between the first LTR and the second LTR, A system that includes this.

2. The system according to claim 1, characterized in that the first protein domain has at least 90% sequence identity with the amino acid sequence of SEQ ID NO:

52.

3. The system according to claim 1 or 2, characterized in that the first protein domain contains the amino acid sequence of SEQ ID NO:

52.

4. The system according to any one of claims 1 to 3, characterized in that the second protein domain is HIV1 integrase.

5. The system according to any one of claims 1 to 3, characterized in that the second protein domain is a lentiviral integrase.

6. The system according to any one of claims 1 to 5, characterized in that the second protein domain has at least 90% sequence identity with the amino acid sequence of any one of SEQ ID NO: 16, SEQ ID NO: 71, and SEQ ID NO:

80.

7. The system according to claim 6, characterized in that the second protein domain contains the amino acid sequence of SEQ ID NO:

71.

8. The system according to any one of claims 1 to 7, characterized in that the linker has a length of 1 or more amino acids.

9. The system according to claim 8, characterized in that the linker has a length of 4 to 8 amino acids.

10. The system according to any one of claims 1 to 9, characterized in that the fusion protein further comprises a nuclear localization signal.

11. The system according to any one of claims 1 to 10, characterized in that the guide RNA has a continuous base pair length of 12 to 30.

12. The system according to any one of claims 1 to 11, characterized in that the first or second LTR includes a nucleotide sequence selected from sequence numbers 59 and 60.

13. An in vitro method for genetically modifying a cell by inserting a DNA sequence into the cell's target genomic DNA, comprising transtransferring the system described in any one of claims 1 to 12 into the cell, wherein the gRNA binds to the target genomic DNA.

14. An in vitro method for reducing the expression of a target gene within a cell, comprising carrying out the method according to claim 13, wherein the target genomic DNA is the coding region of the first exon of the target gene, and the donor nucleic acid comprises one or more consecutive stop codons.

Citation Information

Patent Citations

  • Integrase fusion proteins and their use with integrative gene therapy

    JP2007535308A

  • Development of a transposon system for site-specific DNA integration in mammalian cells

    US20060252140A1

  • Compositions and methods for custom site-specific DNA recombinases

    US20140193915A1

  • Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

    WO2013176772A1

  • Compositions and methods of nucleic acid-targeting nucleic acids

    WO2014150624A1