Methods and compositions for predicting response to oncolytic virotherapy
By utilizing biomarkers to select patients and administer oncolytic adenoviruses like cretostimogene, the method addresses the challenge of selective cancer cell targeting, enhancing treatment efficacy for bladder cancer and reducing recurrence.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- CG ONCOLOGY INC
- Filing Date
- 2025-11-07
- Publication Date
- 2026-05-15
AI Technical Summary
Current oncolytic virus therapies face challenges in selectively targeting cancer cells while avoiding non-cancerous cells, and patient immune responses pose obstacles to effective treatment.
The use of biomarkers such as the coxsackie adenovirus receptor (CXADR) gene and Rb/E2F pathway gene levels or mutations to select and administer an oncolytic adenovirus, specifically cretostimogene, to treat solid or lymphatic tumors, particularly bladder cancer, by enhancing viral replication in cancer cells.
This approach allows for targeted therapy that effectively reduces tumor size and recurrence, even in cases ineligible for cisplatin-based chemotherapy, by ensuring the virus preferentially infects and replicates in cancer cells, thereby improving treatment efficacy.
Smart Images

Figure IMGF000076_0001 
Figure IMGF000077_0001 
Figure IMGF000144_0001
Abstract
Description
Attorney Docket No.: 74444-20008.40METHODS AND COMPOSITIONS FOR PREDICTING RESPONSE TO ONCOLYTIC VIROTHERAPYCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 718,431, filed on November 8, 2024, which is hereby incorporated by reference in its entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] The content of the electronic sequence listing (744442000840seqlist.xml; Size: 4,539 bytes; and Date of Creation: October 29, 2025) is herein incorporated by reference in its entirety.FIELD
[0003] The present disclosure relates generally to cancer immunotherapy, and more specifically to methods of predicting the efficacy of oncolytic virus therapy for the treatment of cancer.BACKGROUND
[0004] Oncolytic virus therapy is an approach for the treatment of cancer that utilizes viruses that preferentially infect and kill cancerous cells. Oncolytic viruses are thought to not only directly destroy cancer cells through lysis, but are also thought to stimulate the immune system. Harnessing oncolytic viruses for cancer therapy has long been a goal of medical research, but the method faces numerous obstacles. One obstacle is the patient’s immune system, which naturally will attempt to destroy any virus. Another obstacle is ensuring the virus preferentially infects and replicates in cancer cells, and not in non-cancerous cells. To this end, the identification of biomarkers is helpful to develop effective therapies and identify patients who are most likely to benefit from the therapy.BRIEF SUMMARY
[0005] The present application provides methods for treating a solid or lymphatic tumor in an individual using an oncolytic virus (such as cretostimogene) based on one or more biomarkers, such as a level of the coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, methods for selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus (such as cretostimogene) based on one or more biomarkers,1MF-363552698Attorney Docket No.: 74444-20008.40 such as a level of the coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, and a kit for treating a solid or lymphatic tumor in an individual using an oncolytic virus (such as cretostimogene) based on one or more biomarkers, such as a level of the coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual.
[0006] Accordingly, in one aspect, provided herein is a method of treating a solid or lymphatic tumor in an individual comprising determining a level of a coxsackie adenovirus receptor (CXADR) gene, and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and administering to the individual an effective amount of an oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the oncolytic virus is administered locally to the site of the tumor. In certain embodiments, the oncolytic virus is administered directly into the tumor. In certain embodiments, the oncolytic virus is administered to the tissue having the tumor. In some embodiments, the solid or lymphatic tumor is bladder cancer, and the oncolytic virus is administered intravesically.
[0007] In another aspect, provided herein is a method of treating a solid or lymphatic tumor in an individual comprising administering to the individual an effective amount of an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. In some embodiments, the oncolytic virus is administered locally to the site of the tumor. In certain embodiments, the oncolytic virus is administered directly into the tumor. In certain embodiments, the oncolytic virus is administered to the tissue having the tumor. In some embodiments, the solid or lymphatic tumor is bladder cancer, and the oncolytic virus is administered intravesically.
[0008] In another aspect, provided herein is a method of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus comprising determining a level of a coxsackie adenovirus receptor (CXADR) gene, and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the2MF-363552698Attorney Docket No.: 74444-20008.40 individual is selected for the treatment with the oncolytic virus based on the level of the CXADR gene, and / or the level and / or the mutation of each of the one or more Rb / E2F pathway genes; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of the CXADR gene exceeds a control level of the CXADR gene; and / or the level of each of the one or more Rb / E2F pathway genes exceeds or is lower than a control level of the same Rb / E2F pathway gene. In some embodiments, a) the level of free, active E2F1 exceeds a control level of free, active E2F1; and / or b) the level of functional Rb is lower than a control level of Rb; and / or c) the level of Cyclin D exceeds a control level of Cyclin D; and / or d) the level of CDK4 exceeds a control level of CDK4; and / or e) the level of CDK6 exceeds a control level of CDK6; and / or f) the level of CDKN2A (p!6 / INK4A) is lower than a control level of CDKN2A. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level. In some embodiments, the control level of the of the CXADR gene is a predetermined level of the CXADR gene, and / or the control level of each of the one or more Rb / E2F pathway genes is a pre-determined level of the same Rb / E2F pathway gene. In certain embodiments, the control level of the of the CXADR gene is the level of the CXADR gene in a healthy individual or a healthy population of individuals; and / or the control level of each of the one or more Rb / E2F pathway genes is the level of the same Rb / E2F pathway gene in a healthy individual or a healthy population of individuals. In certain embodiments, the control level of the CXADR gene is the level of the CXADR gene in non-cancerous sample from the individual; and / or the control level of each of the one or more Rb / E2F pathway genes is the level of the same Rb / E2F pathway gene in non-cancerous sample from the individual.3MF-363552698Attorney Docket No.: 74444-20008.40
[0009] In some embodiments according to any one of the methods described above, the sample is a solid or lymphatic tumor sample.
[0010] In some embodiments according to any one of the methods described above, the one or more Rb / E2F pathway genes are selected from the group consisting of E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the one or more Rb / E2F pathway genes comprise E2F1 and RBI.
[0011] In some embodiments according to any one of the methods described above, the method comprises determining a level of a coxsackie adenovirus receptor (CXADR) gene. In some embodiments, determining the level of the CXADR gene comprises determining the level of a CXADR gene polynucleotide. In some embodiments, the polynucleotide is RNA. In further embodiments, the level of the CXADR gene polynucleotide comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, nucleic acid-based microarray technology, or any combination thereof. In some embodiments, determining the level of the CXADR gene comprises determining the level of a CXADR gene polypeptide. In some embodiments, determining the level of the CXADR gene polypeptide comprises immunohistochemistry, enzyme-linked immunoassay (ELISA), high-throughput Luminex-multiplex based assays, flow-cytometry based assays, high-throughput-multiplexed Proximity Extension Assay (PEA) technology -based protein analysis, or a combination thereof.
[0012] In some embodiments according to any one of the methods described above, the method comprises determining a level and / or a mutation of each of one or more Rb / E2F pathway genes. In some embodiments, determining the level and / or mutation of each of the one or more Rb / E2F pathway genes comprises determining the level and / or a mutation of one or more Rb / E2F pathway gene polynucleotides. In some embodiments, the polynucleotide is DNA. In further embodiments, the level of the one or more Rb / E2F pathway gene polynucleotides is a copy number of the one or more Rb / E2F pathway gene. In some embodiments, determining the level and / or the mutation of the one or more Rb / E2F pathway gene polynucleotides comprises DNA sequencing including but not limited to nextgeneration sequencing (NGS) based technology, whole-genome sequencing (WGS), or targeted sequencing panel analysis, PCR, in-situ hybridization, or any combination thereof. In some embodiments, the method comprises determining a mutation of one or more Rb / E2F4MF-363552698Attorney Docket No.: 74444-20008.40 pathway genes. In some embodiments, the polynucleotide is RNA. In further embodiments, determining the level of the of one or more Rb / E2F pathway gene polynucleotides comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof. In certain embodiments, determining the level of each of the one or more Rb / E2F pathway genes comprises determining the level of one or more Rb / E2F pathway gene polypeptides. In some embodiments, determining the level of the one or more Rb / E2F pathway gene polypeptides comprises antibody-based immunoassays including but not limited to immunohistochemistry, enzyme-linked immunoassay (ELISA), high-throughput Luminex- multiplex based assays, flow-cytometry based assays, high-throughput-multiplexed Proximity Extension Assay (PEA) technology -based protein analysis, or a combination thereof.
[0013] In some embodiments according to any one of the methods described above, the solid or lymphatic tumor is bladder cancer. In some embodiments, the bladder cancer is nonmuscle invasive bladder cancer (NMIBC). In certain embodiments, the bladder cancer comprises carcinoma in situ (CIS). In certain embodiments wherein the bladder cancer comprises CIS, wherein the bladder cancer further comprises Ta stage bladder cancer, T1 stage bladder cancer, or a combination thereof. In other embodiments wherein the bladder cancer comprises CIS, the bladder cancer does not comprise concurrent Ta or T1 stage bladder cancer. In further embodiments, the bladder cancer further comprises Ta stage bladder cancer, T1 stage bladder cancer, or a combination thereof. In certain embodiments wherein the bladder cancer comprises Ta and / or T1 stage bladder cancer, the bladder cancer does not comprise concurrent CIS. In some embodiments, the bladder cancer is muscle invasive bladder cancer (MIBC). In some embodiments, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some embodiments, the individual has previously been treated with a Bacillus Calmette-Guerin (BCG). In further embodiments, the individual is BCG unresponsive. In further embodiments, the individual has bladder cancer recurrence subsequent to BCG treatment. In some embodiments, the individual has failed the BCG treatment within about 6 months. In some embodiments, the individual has not received a cystectomy. In further embodiments, the individual has refused or is ineligible for a cystectomy.
[0014] In some embodiments according to any one of the methods described above, the oncolytic adenovirus is an adenovirus serotype 5.5MF-363552698Attorney Docket No.: 74444-20008.40
[0015] In some embodiments according to any one of the methods described above, the viral gene essential for replication of the virus is selected from the group consisting of El A, E1B, and E4. In some embodiments, the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule. In some embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter. In some embodiments, the virus is an adenovirus, and the viral promoter is an E3 promoter. In some embodiments, the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa|3. In further embodiments, the immune-related molecule is human GM-CSF.
[0016] In some embodiments according to any one of the methods described above, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In some embodiments, the oncolytic virus is cretostimogene.
[0017] In some embodiments according to any one of the methods described above, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus. In some embodiments, the pretreatment composition is a transduction enhancing agent. In some embodiments, the transduction enhancing agent is N-Dodecyl-P-D-maltoside (DDM).
[0018] In some embodiments according to any one of the methods described above, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles.
[0019] In some embodiments according to any one of the methods described above, the oncolytic virus is administered weekly.
[0020] In some embodiments according to any one of the methods described above, the oncolytic virus is administered for about 1 week to about 6 weeks.
[0021] In some embodiments according to any one of the methods described above, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In some embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once.
[0022] In some embodiments according to any one of the methods described above, the oncolytic virus is administered as a single therapeutic agent.6MF-363552698Attorney Docket No.: 74444-20008.40
[0023] In some embodiments according to any one of the methods described above, the method further comprises administering to the individual an effective amount of an immunomodulator. In certain embodiments, the oncolytic virus and the immunomodulator are administered sequentially. In certain embodiments, the oncolytic virus and the immunomodulator are administered simultaneously. In some embodiments, the immunomodulator is administered locally to the site of the tumor. In some embodiments, the solid or lymphatic tumor is bladder cancer and the immunomodulator is administered intravesically. In some embodiments, the immunomodulator is administered systemically. In some embodiments, the immunomodulator is administered intravenously. In some embodiments, the immunomodulator is a modulator of an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In some embodiments, the immunomodulator is an inhibitor of PD-1. In further embodiments, the inhibitor of PD-1 is an anti-PD-1 antibody. In further embodiments, the anti-PD-1 antibody is nivolumab, cemiplimab, dostarlimab, or pembrolizumab. In some embodiments, the immunomodulator is administered once every four weeks.
[0024] In another aspect, provided herein is a kit for treating a solid or lymphatic tumor in an individual comprising one or more agents for determining a level of a coxsackie adenovirus receptor (CXADR) gene, and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus; and a device for administering the oncolytic virus. The kit may be used to perform any of the methods described herein.DESCRIPTION OF THE FIGURES
[0025] The present application can be understood by reference to the following description taken in conjunction with the accompanying figures.
[0026] FIG. 1 is a schematic diagram of oncolytic adenovirus cretostimogene and wildtype (wt) adenovirus type 5. Cretostimogene grenadenorepvec (CG0070) was constructed by a) replacing the endogenous El a promoter of the wild-type genome with a human E2F-1 promoter, and b) replacing the endogenous E3 19kD coding region of the wild-type genome with a cDNA coding region of human GM-CSF.7MF-363552698Attorney Docket No.: 74444-20008.40
[0027] FIG. 2 shows production of cretostimogene and wild type Ad5 in human bladder tissue culture cells and normal human cells. The x-axis shows different cell types and further labels the cell types as control, tumor (RB pathway-defective), or non-tumor (Rb pathway normal). The y-axis shows virus yield in plaque-forming units (PFU) / cell. Samples treated with wild type adenovirus are labeled above as “WT” and are the bars on the left, cretostimogene treated samples are the bars to the right.
[0028] FIG. 3 shows comparative analysis of CXADR expression in tumor and corresponding normal tissues across 33 tissue types, based on RNA-seq data from TCGA and GTEx datasets. The x-axis above the figure refers to the tissue type as categorized by The Cancer Genome Atlas. Samples are arranged along the x-axis by CXADR expression, with highest expression on the left. The y-axis shows expression level, expressed in log2(Transcripts per Million (TPM)+1). Within each tissue type, the leftward column is the tumor tissue and the rightward column is normal tissue. Individual dots reflect expression level in a particular sample.
[0029] FIGs. 4A-4E show RNA expression profiles of Rb / E2F pathway genes, based on RNA-seq data from TCGA and GTEx datasets. In all figures, tissue types are sorted by CXADR expression (top panel in FIG. 4A); the x-axis is different cell types; the y-axis is expression level expressed in log2(Transcripts per Million (TPM)+1); and tumor samples are depicted by the darker gray box plots, normal samples are depicted by the lighter gray box plots. FIG. 4A shows the RNA expression profile of RBI. FIGs. 4B and 4C show the RNA expression profile of the E2F family members. FIGs. 4D and 4E show the RNA expression profile of the Cyclin D family, CDK 4, CDK6, and the CDKN2A family. Tissue types are abbreviated as shown in Table 3; “READ” stands for rectum adenocarcinoma.
[0030] FIG. 5 shows a heat map comparing expression of selected genes in cancer cell lines with the EC50 of cretostimogene in the corresponding cancer cell lines. The different cell lines used and the type of cancer for each cell line are shown along the y-axis; expression of the different genes of interest is shown along the x-axis. The log EC50 is shown as a separate column on the right. Red colors represent higher gene expression and green colors represent lower expression; for the log EC50, green colors represent a lower EC50, whereas red colors represent a higher EC50. EC50 represents the viral titer that induces a 50% reduction in cell viability compared with uninfected controls, as determined by CellTiter-Glo assays. This parameter reflects the relative permissiveness of each cell line to viral infection and oncolytic activity, with lower EC50 values indicating higher viral permissiveness.8MF-363552698Attorney Docket No.: 74444-20008.40
[0031] FIGs. 6A-6B show correlation between cretostimogene EC50 values and RNA expression levels. FIG. 6A shows an inverse correlation between cretostimogene EC50 values (logio scale, x-axis) and CXADR expression levels (log2-transformed fragments per kilobase of transcript per million mapped reads [FPKM], y-axis). Elevated CXADR expression correlates with reduced EC50 values, reflecting increased susceptibility or enhanced cellular permissiveness to oncolytic viral infection. FIG. 6B shows correlation between Log EC50 and Log2(FPKM) RBI in cells with high CXADR expression and high E2F1 expression (HEP3b, PLC / PRF / 5, AGS, RT4, HCC38, and LoVo cells).
[0032] FIG. 7 shows an exemplary method of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus. In the first step, a level of a CXADR gene is determined in a tumor sample of an individual. The individual is advanced to the second step if the level of CXADR in the tumor sample exceeds the baseline level of CXADR in anon-cancerous sample (i.e., normal cells) from the same individual. In the second step, the level of one or more of a panel of Rb / E2F pathway genes is determined in the tumor sample of the individual. The individual is selected for treatment with the oncolytic virus if the level of each of the Rb / E2F pathway genes is high or low according to FIG. 7, such that the overall expression portfolio indicates disruption of Rb-mediated repression and consequent activation of E2F transcriptional activity, which in turn drives expression of the viral El A gene and promotes replication of the oncolytic adenovirus like cretostimogene grenadenorepvec.
[0033] FIG. 8 shows the design of a Phase lb Study of CG0070 Combined with Nivolumab in Cisplatin Ineligible Patients with Muscle Invasive Bladder Cancer (MIBC).
[0034] FIG. 9 shows pathological complete response (pCR) rate of combination neoadjuvant treatment using cretostimogene + nivolumab.
[0035] FIGs. 10A-10B shows efficacy results. FIG. 10A shows overall survival rate, and FIG. 10B shows recurrence free survival rate.
[0036] FIG. 11 shows spatial gene expression profiling performed on 12 baseline FFPE bladder tumor tissues from the BOND-003 (NCT04452591) Cohort C study (carcinoma in situ [CIS] -containing cohort). The bubble plot displays the expression profiles of CXADR and selected Rb / E2F pathway genes (E2F1-3, RBI, CCND1, CDK4, CDK6, CDKN2A) across 13 spatially defined Visium cell clusters representing tumor-associated, stroma- associated, and tumor-stroma interface populations. The circle size indicates the percentage of cells within each cluster expressing the target gene, whereas the grayscale intensity9MF-363552698Attorney Docket No.: 74444-20008.40(ranging from -1 to +1) reflects the relative expression level. Circles outlined in black denote negative values, corresponding to down-regulated gene expression. Consistent with epithelial localization, CXADR, CCND1, E2F1-3, RBI, and CDK4 / 6 were highly expressed in tumor- associated epithelial clusters across all patient samples.
[0037] FIG. 12 shows quantitative PCR (qPCR) analysis performed to assess cretostimogene replication in patients from the BOND-003 Cohort C study who had corresponding Visium spatial expression profdes. Urine samples collected at baseline (predose) and Day 4 post-first dosing were analyzed for cretostimogene DNA copy number. Predose urine samples were below the limit of quantification (BLOQ), whereas Day 4 samples showed a geometric mean viral titer of 1.18 x 107vp / mL, with detection limits ranging from 4.28 x io4(lower limit) to 3.24 x 109vp / mL (upper limit). Boxplot analysis demonstrated a consistent increase in urinary viral DNA concentrations on Day 4 across all patients (p = 0.0072, Lognormal Welch’s t-test), confirming active viral replication and shedding following intravesical administration at a dose of 1 x 1012viral particles. These findings align with spatial trans criptomic data showing high expression of CXADR, CCND1, E2F1, E2F3, RBI, and CDK4 / 6 within tumor- associated epithelial clusters, indicating E2F pathway activation and enhanced permissiveness to viral replication. Consistent with the known cretostimogene infection kinetics, in which viral progeny release and cell lysis occur approximately 24-48 hours post-infection, the detection of a viral DNA peak at Day 4 supports the occurrence of at least 1-2 complete replication cycles within the tumor epithelium.DETAILED DESCRIPTION OF THE INVENTION
[0038] The present application provides methods for treating a solid or lymphatic tumor in an individual using an oncolytic virus (such as cretostimogene) based on one or more biomarkers, such as a level of the coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. The biomarkers described herein are useful for guiding selection of patients that would benefit from treatment with the oncolytic virus. By determining a level of these biomarkers, the oncolytic virus therapy can more effectively target cancerous cells over non- cancerous cells.
[0039] Accordingly, in some embodiments, there is provided a method of treating a solid or lymphatic tumor in an individual comprising determining a level of a coxsackie adenovirus10MF-363552698Attorney Docket No.: 74444-20008.40 receptor (CXADR) gene, and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual and administering to the individual an effective amount of an oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes. In other aspects, there is provided a method of treating a solid or lymphatic tumor in an individual by administering an effective amount of an oncolytic virus, wherein the individual is selected based on a level of a CXADR gene and / or a level or mutation of each of one or more RB / E2F pathway genes in a biological sample of the individual. In other aspects, there is provided a method of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, comprising determining a level of a CXADR gene, and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. In some embodiments, the Rb / E2F pathway gene is E2F1. In certain embodiments, response to the oncolytic virus is correlated with free, active E2F1.
[0040] Also provided are kits useful for the methods described herein. In one aspect, there is provided a kit for treating a solid or lymphatic tumor in an individual, comprising one or more agents for determining a level of a CXADR gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; an oncolytic virus; and a device for administering the oncolytic virus.Definitions
[0041] As used herein, “Rb / E2F pathway” or “Rb pathway” refers to the retinoblastoma (Rb) protein family, the Rb-E2F complex, E2F family of transcription factors, and any upstream regulators, which includes, but is not limited to, cyclins, cyclin-dependent kinases (CDKs) and CDK inhibitors. The Rb family includes Rbl / pl05, p!07, and Rb2 / pl30. The E2F family of transcription factors includes E2F1, E2F2, E2F3A, E2F3B, E2F4, E2F5, E2F6, E2F7, and E2F8. Examples of cyclins include cyclin DI, cyclin D2, and Cyclin D3.Examples of CDKs include CDK2, CDK4, CDK5, and CDK6. Examples of CDK inhibitors include p!6 / INK4A / CDKN2A, CDKN2B, CDKN2C, and CDKN2D.
[0042] As used herein, “individual” may refer to refers to a mammal, including, but not limited to, human, bovine, horse, feline, canine, rodent, or primate. In some embodiments, the individual is a human.
[0043] As used herein, “gene” includes all possible gene products encoded by a gene, including polynucleotides (e.g. RNA) and polypeptides (e.g. proteins).11MF-363552698Attorney Docket No.: 74444-20008.40
[0044] As used herein, “determining the level of a gene” refers to determining the expression level of any gene product of the gene in a biological sample. For example, determining the level of a gene may include determining the level of a messenger RNA encoded by the gene or a protein by the gene in a biological sample.
[0045] As used herein, “treatment” or “treating” is an approach for obtaining beneficial or desired results including clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms resulting from the disease, diminishing the extent of the disease, stabilizing the disease (e.g, preventing or delaying the worsening of the disease), preventing or delaying the spread (e.g, metastasis) of the disease, preventing or delaying the recurrence of the disease, reducing recurrence rate of the disease, delay or slowing the progression of the disease, ameliorating the disease state, providing a remission (partial or total) of the disease, decreasing the dose of one or more other medications required to treat the disease, delaying the progression of the disease, increasing the quality of life, and / or prolonging survival. Also encompassed by "treatment" is a reduction of pathological consequence of cancer. The methods of the invention contemplate any one or more of these aspects of treatment.
[0046] “Adjuvant setting” refers to a clinical setting in which an individual has had a history of cancer, and generally (but not necessarily) been responsive to therapy, which includes, but is not limited to, surgery (e.g, surgery resection), radiotherapy, and chemotherapy. Treatment or administration in the “adjuvant setting” refers to a subsequent mode of treatment.
[0047] “Neoadjuvant setting” refers to a clinical setting in which the method is carried out before the primary / definitive therapy. Neoadjuvant setting herein also refers to any “tumor site preparation” therapy modality that is used in conjunction with, in a sequential manner, with the therapeutic components (e.g, oncolytic virus and immunomodulator(s); or oncolytic virus, immunomodulator(s) and inactivated tumor cells) as described in this invention.
[0048] The term “effective amount” used herein refers to an amount of a compound or composition sufficient to treat a specified disorder, condition or disease such as ameliorate, palliate, lessen, and / or delay one or more of its symptoms. In reference to cancer, an effective amount comprises an amount sufficient to cause a tumor to shrink and / or to decrease the growth rate of the tumor (such as to suppress tumor growth) or to prevent or delay other12MF-363552698Attorney Docket No.: 74444-20008.40 unwanted cell proliferation in cancer. In some embodiments, an effective amount is an amount sufficient to delay development of cancer. In some embodiments, an effective amount is an amount sufficient to prevent or delay recurrence. In some embodiments, an effective amount is an amount sufficient to reduce recurrence rate in the individual. An effective amount can be administered in one or more administrations. The effective amount of the drug or composition may: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, retard, slow to some extent and preferably stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent occurrence and / or recurrence of tumor; (vii) delay occurrence and / or recurrence of tumor; (viii) reduce recurrence rate of tumor, and / or (ix) relieve to some extent one or more of the symptoms associated with the cancer. As is understood in the art, an “effective amount” may be in one or more doses, i.e., a single dose or multiple doses may be required to achieve the desired treatment endpoint.
[0049] In conjunction with" or “in combination with” refers to administration of one treatment modality in addition to another treatment modality, such as administration of an oncolytic virus described herein in addition to administration of the other agent (such as immunomodulator(s), inactivated tumor cells, etc.) to the same individual under the same treatment plan. As such, "in conjunction with" or “in combination with” refers to administration of one treatment modality before, during or after delivery of the other treatment modality to the individual.
[0050] The term “simultaneous administration,” as used herein, means that a first therapy and second therapy in a combination therapy are administered at the same time. When the first and second therapies are administered simultaneously, the first and second therapies may be contained in the same composition (e.g., a composition comprising both a first and second therapy) or in separate compositions (e.g., a first therapy is contained in one composition and a second therapy is contained in another composition).
[0051] As used herein, the term “sequential administration” or “in sequence” means that the first therapy and second therapy in a combination therapy are administered with a time separation, for example, of more than about 1 minute, such as more than about any of 5, 10, 15, 20, 30, 40, 50, 60, or more minutes. In some cases, the term “sequential administration” means that the first therapy and second therapy in a combination therapy are administered with a time separation of more than about 1 day, such as more than about any of 1 day to 1 week, 2 weeks, 3 weeks, 4 weeks, 8 weeks, 12 weeks, or more weeks. Either the first therapy13MF-363552698Attorney Docket No.: 74444-20008.40 or the second therapy may be administered first. The first and second therapies are contained in separate compositions, which may be contained in the same or different packages or kits.
[0052] The term “administered immediately prior to” means that the first therapy is administered no more than about 15 minutes, such as no more than about any of 10, 5 or 1 minutes before administration of the second therapy. The term “administered immediately after” means that the first therapy is administered no more than about 15 minutes, such as no more than about any of 15, 10 or 1 minutes after administration of the second therapy.
[0053] As used herein, "specific", "specificity", or "selective" or "selectivity" as used when describing a compound as an inhibitor, means that the compound preferably interacts with (e.g, binds to, modulates, and inhibits) a particular target (e.g, a protein and an enzyme) than a non-target.
[0054] The term “transduction” and “transfection” as used herein include all methods known in the art using an infectious agent (such as a virus) or other means to introduce DNA into cells for expression of a protein or molecule of interest. Besides a virus or virus-like agent, there are chemical-based transfection methods, such as those using calcium phosphate, dendrimers, liposomes, or cationic polymers (e.g, DEAE-dextran or polyethylenimine); nonchemical methods, such as electroporation, cell squeezing, sonoporation, optical transfection, impalefection, protoplast fusion, delivery of plasmids, or transposons; particle-based methods, such as using a gene gun, magnectofection or magnet assisted transfection, particle bombardment; and hybrid methods, such as nucleofection.
[0055] The term “tumor site preparation” as used herein, describes single treatment modality or combination of more than one treatment modalities to be used in conjunction with the therapeutic components (e.g, oncolytic virus and immunomodulator(s); or oncolytic virus, immunomodulator(s) and inactivated tumor cells) in a sequential manner, and in which the treatment modality or modalities are being applied directly or indirectly (e.g, through an IV therapy) to the tumor site (such as cancer cells or the tissue containing the cancer cells). Exemplary treatment modalities for tumor site preparations include, but are not limited to, administration of immune-related molecules, irradiation, and administration of therapeutic agents. All tumor site preparations described herein may include administration of a single molecule or agent, or a combination of more than one molecules and / or agents.
[0056] It is understood that embodiments of the invention described herein include “consisting” and / or “consisting essentially of’ embodiments.14MF-363552698Attorney Docket No.: 74444-20008.40
[0057] Reference to "about" a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to "about X" includes description of "X".
[0058] As used herein, reference to "not" a value or parameter generally means and describes "other than" a value or parameter. For example, the method is not used to treat cancer of type X means the method is used to treat cancer of types other than X.
[0059] The term “about X-Y” used herein has the same meaning as “about X to about Y.”
[0060] As used herein and in the appended claims, the singular forms "a," "an," or "the" include plural referents unless the context clearly dictates otherwise.Methods of Selecting Individuals for Oncolytic Therapy
[0061] In some aspects, provided herein are methods of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, the method comprising determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on (1) the level of the CXADR gene, and / or (2) the level of each of the one or more Rb / E2F pathway genes; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the level of the CXADR gene or one or more Rb / E2F pathway genes is a level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions. In some embodiments, the method comprises determining a level of one gene in the biological sample (e.g, a level of a CXADR gene, or the level of a Rb / E2F pathway gene). In certain embodiments, the method comprises determining a level of a CXADR gene in a biological sample of the individual, and does not comprise determining a level and / or a mutation of each of one or more Rb / E2F pathway genes in the biological sample of the individual. In certain other embodiments, the method comprises determining a level and / or a mutation of each of one or more Rb / E2F pathway genes in the biological sample of the individual, and does not comprise determining a level of a CXADR gene in the biological sample of the individual. In some embodiments, the one or more Rb / E2F pathway genes are selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4,15MF-363552698Attorney Docket No.: 74444-20008.40CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1.
[0062] In some embodiments, the method comprises determining a level of two or more (e.g, one, two, three, four, five, or more) genes in the biological sample. For example, in some embodiments, the method comprises determining (1) a level of a CXADR gene, and (2) a level and / or a mutation of each of one or more (e.g, one, two, three, four, five, or more) Rb / E2F pathway genes in a biological sample of the individual. In other embodiments, the method comprises determining (1) a level of a CXADR gene, and (2) a level and / or a mutation of each of two or more (e.g, two, three, four, five, or more) Rb / E2F pathway genes in a biological sample of the individual. In some embodiments, the method comprises determining a level and / or a mutation of each of two or more (e.g, two, three, four, five, or more) Rb / E2F pathway genes in a biological sample of the individual. In certain embodiments, the method comprises determining a level and / or a mutation of each of two or more (e.g, two, three, four, five, or more) Rb / E2F pathway genes in a biological sample of the individual, and does not comprise determining a level of a CXADR gene in the biological sample of the individual. In some embodiments, the one or more Rb / E2F pathway genes are selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D. In some embodiments, the method comprises determining a level of E2F1.
[0063] In some aspects, provided herein are methods of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, the method comprising determining a level of a coxsackie adenovirus receptor (CXADR) gene in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of the CXADR gene, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of the CXADR gene exceeds a control level of the CXADR gene. In certain embodiments, the control level of the CXADR gene is a pre-determined level of the CXADR gene. In other embodiments, the control level of the CXADR gene is the level of the CXADR gene in a healthy individual or a healthy population of individuals. In some embodiments, the sample is a solid or lymphatic tumor sample. In certain embodiments wherein the sample is a solid or lymphatic tumor16MF-363552698Attorney Docket No.: 74444-20008.40 sample, the control level of the CXADR gene is the level of the CXADR gene in non- cancerous sample from the individual. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. As used herein, “CXADR gene” may refer to any gene product of a CXADR gene, including, but not limited to, RNA (e.g., messenger RNA) and polypeptides (e.g, proteins). In some embodiments, determining the level of the CXADR gene comprises determining the level of a CXADR gene polynucleotide. In certain embodiments, the CXADR gene polynucleotide is RNA. In some embodiments, determining the level of the CXADR gene polynucleotide comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof. In some embodiments, determining the level of the CXADR gene comprises determining the level of a CXADR gene polypeptide. In certain embodiments, determining the level of the CXADR gene polypeptide comprises immunohistochemistry, enzyme-linked immunoassay (ELISA), high-throughput Luminex-multiplex based assays, flow-cytometry based assays, high-throughput-multiplexed-Proximity Extension Assay (PEA) technology-based protein analysis, or a combination thereof.
[0064] In some aspects, provided herein are methods of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, the method comprising determining a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of each of the one or more Rb / E2F pathway genes, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F- 1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the one or more Rb / E2F pathway genes are selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds or is lower than a control level of the same Rb / E2F pathway gene. In certain embodiments, the control level of each of the one or more Rb / E2F pathway genes is a pre-determined level of the same Rb / E2F pathway gene. In other embodiments, the17MF-363552698Attorney Docket No.: 74444-20008.40 control level of each of the one or more Rb / E2F pathway genes is the level of the same Rb / E2F pathway gene in a healthy individual or a healthy population of individuals. In some embodiments, the sample is a solid or lymphatic tumor sample. In certain embodiments wherein the sample is a solid or lymphatic tumor sample, the control level of each of the one or more Rb / E2F pathway genes is the level of the same Rb / E2F pathway gene in non- cancerous sample from the individual. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. As used herein, “Rb / E2F pathway gene” may refer to any gene product of any Rb / E2F pathway gene, including, but not limited to, RNA (e.g, messenger RNA) and polypeptides (e.g, proteins). In some embodiments, determining the level and / or the mutation of each of the one or more Rb / E2F pathway genes comprises determining the level and / or a mutation of one or more Rb / E2F pathway gene polynucleotides. In certain embodiments, the one or more Rb / E2F pathway gene polynucleotides are DNA. In some embodiments, determining the level and / or the mutation of the one or more Rb / E2F pathway gene polynucleotides comprises DNA sequencing including but not limited to next-generation sequencing (NGS) based technology, whole-genome sequencing (WGS), or targeted sequencing panel analysis, PCR, in-situ hybridization, or any combination thereof. In certain embodiments, the one or more Rb / E2F pathway gene polynucleotides are RNA. In some embodiments, determining the level of the one or more Rb / E2F pathway gene polynucleotides comprises RNA sequencing, whole- exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof. In some embodiments, determining the level of the one or more Rb / E2F pathway genes comprises determining the level of one or more Rb / E2F pathway gene polypeptides. In certain embodiments, determining the level of one or more Rb / E2F pathway gene polypeptides comprises immunohistochemistry, enzyme- linked immunoassay (ELISA), high-throughput Luminex-multiplex based assays, flowcytometry based assays, high-throughput-multiplexed-Proximity Extension Assay (PEA) technology -based protein analysis, or a combination thereof. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or18MF-363552698Attorney Docket No.: 74444-20008.40 population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (pl6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g., a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non- cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steadystate gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions.
[0065] In some aspects, provided herein are methods of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, the method comprising determining (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and (2) the level of each of the one or more Rb / E2F pathway genes; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the one or more Rb / E2F pathway genes are selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3,19MF-363552698Attorney Docket No.: 74444-20008.40E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if (1) the level of the CXADR gene exceeds a control level of the CXADR gene, and / or (2) the level of each of the one or more Rb / E2F pathway genes exceeds or is lower than a control level of the same Rb / E2F pathway gene. In certain embodiments, (1) the control level of the CXADR gene is a pre-determined level of the CXADR gene; and / or (2) the control level of each of the one or more Rb / E2F pathway genes is a pre-determined level of the same Rb / E2F pathway gene. In other embodiments, (1) the control level of the CXADR gene is the level of the CXADR gene in a healthy individual or a healthy population of individuals; and / or (2) the control level of each of the one or more Rb / E2F pathway genes is the level of the same Rb / E2F pathway gene in a healthy individual or a healthy population of individuals. In some embodiments, the sample is a solid or lymphatic tumor sample. In certain embodiments wherein the sample is a solid or lymphatic tumor sample, (1) the control level of the CXADR gene is the level of the CXADR gene in non-cancerous sample from the individual; and / or (2) the control level of each of the one or more Rb / E2F pathway genes is the level of the same Rb / E2F pathway gene in non-cancerous sample from the individual. As used herein, “CXADR gene” and “Rb / E2F pathway gene” may refer to any gene products of the respective genes, including, but not limited to, RNA (e.g., messenger RNA) and polypeptides (e.g, proteins). In some embodiments, (1) determining the level of the CXADR gene comprises determining the level of a CXADR gene polynucleotide; and / or (2) determining the level of each of the one or more Rb / E2F pathway genes comprises determining the level of one or more Rb / E2F pathway gene polynucleotides. In certain embodiments, the CXADR gene polynucleotide and / or the one or more Rb / E2F pathway gene polynucleotides are RNA. In some embodiments, determining the level of the CXADR gene polynucleotide and / or the one or more Rb / E2F pathway gene polynucleotides comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof. In some embodiments, (1) determining the level of the CXADR gene comprises determining the level of a CXADR gene polypeptide; and / or (2) determining the level of the one or more Rb / E2F pathway genes comprises determining the level of one or more Rb / E2F pathway gene polypeptides. In certain embodiments, determining the level of the CXADR gene polypeptide and / or the one20MF-363552698Attorney Docket No.: 74444-20008.40 or more Rb / E2F pathway gene polynucleotides comprises immunohistochemistry, enzyme- linked immunoassay (ELISA), high-throughput Luminex-multiplex based assays, flowcytometry based assays, high-throughput-multiplexed-Proximity Extension Assay (PEA) technology-based protein analysis, or a combination thereof. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non- cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steadystate gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions.21MF-363552698Attorney Docket No.: 74444-20008.40
[0066] In some aspects, provided herein is a method of identifying one or more treatment options for an individual having a solid or lymphatic tumor, the method comprising: (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and (b) generating a report comprising one or more treatment options identified for the individual based at least in part on (1) the level of a CXADR gene, and / or (2) the level of each of the one or more Rb / E2F pathway genes in a biological sample of the individual; wherein the one or more treatment options comprise treatment with an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F- 1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the report further comprises a score that associates the one or more treatment options with a predicted outcome and / or response. In certain embodiments, the score correlates (e.g, positively correlates) with (1) the level of the CXADR gene in the biological sample, and / or (2) the level and / or mutation of the one or more Rb / E2F pathway genes in the biological sample.
[0067] Adenovirus entry into cells generally involves attachment to a primary receptor, followed by interaction with a secondary receptor responsible for internalization. The coxsackievirus and adenovirus receptor (CAR) is the primary receptor for a wide range of adenoviruses and is encoded by the CXADR gene. CAR is a type I membrane receptor that functions as a hemophilic and heterophilic cell adhesion molecule through interactions with extracellular matrix glycoproteins. CAR is also thought to regulate the cytoskeleton and its cytoplasmic domain is thought to have a scaffolding role.
[0068] Exemplary sequences for CXADR can be found, for example, at ENSG00000154639, UniProt P78310, NM_001207063.2, NM_001207064.2, NM_001207065.2, NM_001207066.2, and NM_001338.5
[0069] Retinoblastoma protein (Rb) is a tumor suppressor protein that plays a pivotal role in cell cycle control and in tumor progression. In most human neoplasms, Rb is functionally inactivated, either by direct mutation or deletion, or indirectly through altered expression / activity of upstream regulators. RB plays in important role in the cell cycle by preventing progression from G1 to S phase by binding transcription factors of the E2F family and preventing transcription of genes required for cell cycle progression. Rb is regulated through changes in its phosphorylation status. When hypophosphorylated, Rb is active and22MF-363552698Attorney Docket No.: 74444-20008.40E2F-mediated transcription is repressed. In contrast, when Rb is phosphorylated by Cyclin D- CDK4 / 6, Rb dissociates from E2F, allowing the cell cycle to progress.
[0070] The E2F family of transcription factors plays a pivotal role in progression of the cell cycle by directing the synthesis of genes involved in DNA replication and cell cycle regulation. E2F directs the synthesis of Cyclin E and CDK2, which activates DNA replication and further the process of Rb inactivation through phosphorylation.
[0071] Exemplary Rb / E2F pathway genes include, but are not limited to RBI, RB2, RB3, E2F1, E2F2, E2F3, E2F4, E2F5, E2F6, E2F7, E2F8, CCDN1, CCDN2, CCDN3, CCNE1, CCNE2, CDK2, CDK4, CDK6, pl6 / INK4A / CDKN2A , CDKN2B, CDKN2C, and CDKN2D. RBI is also known as “RB transcriptional corepressor 1 / Retinoblastoma- associated protein.” Exemplary sequences of RBI can be found for example, at UniProt P06400, NCBI Gene ID 5925, NG_009009.1, and NM_000321.3. RB2 is also known as "Retinoblastoma-like protein 2 / pl30." Exemplary sequences of RB2 can be found, for example, at UniProt Q08999, NCBI Gene ID 5934, Ensembl ID ENSG00000103479, and NM 005611.4. RB3, is also known as "RBL1 / RB Transcriptional Corepressor Like 1 / Retinoblastoma-like l / p!07" Exemplary sequences of RB3 can be found, for example, at UniProt P28749, NCBI Gene ID 5933, Ensembl ID ENSG00000080839, and NM_002895.5. E2F1 is also known as “E2F transcription factor 1 / Transcription factor E2F1.” Exemplary sequences of E2F1 can be found, for example, at UniProt Q01094, NCBI Gene ID 1869, NG_046988.1, and NM_005225.3. E2F2 is also known as “E2F transcription factor 2 / Transcription factor E2F2.” Exemplary sequences of E2F2 can be found, for example, at UniProt Q14209, NCBI Gene ID 1870, NC_000001.11, and NM_004091.4. E2F3 is also known as “E2F transcription factor 3 / Transcription factor E2F3.” Exemplary sequences of E2F3 can be found, for example, at UniProt 000716, NCBI Gene ID 1871, NG_029591.1, NM_001243076.3, and NM_001949.5. E2F4 is also known as “E2F transcription factor 4 / Transcription factor E2F4.” Exemplary sequences of E2F4 can be found, for example, at UniProt Q16254, NCBI Gene ID 1874, NC_000016.10, and NM_001950.4. E2F5 is also known as “E2F transcription factor 5 / Transcription factor E2F5.” Exemplary sequences of E2F5 can be found, for example, at UniProt Q15329, NCBI Gene ID 1875, NC_000008.11, NM_001083588.2, NM_001083589.2, and NM_001951.4. E2F6 is also known as “E2F transcription factor 6 / Transcription factor E2F6.” Exemplary sequences of E2F6 can be found, for example, at UniProt 075461, NCBI Gene ID 1876, NC_000002.12,NM_001278275.2, NM_001278276.2, NM_001278277.2, NM_001278278.2, NM_198256.4,23MF-363552698Attorney Docket No.: 74444-20008.40 and NM_212540.3. E2F7 is also known as “E2F transcription factor 7 / Transcription factor E2F7.” Exemplary sequences of E2F7 can be found, for example, at UniProt Q96AV8, NCBI Gene ID 144455, NC_000012.12, and NM_203394.3. E2F8 is also known as “E2F transcription factor 8 / Transcription factor E2F8.” Exemplary sequences of E2F8 can be found, for example, at UniProt A0AVK6, NCBI Gene ID 79733, NC_000011.10, NM_001256371.2, NM_001256372.1, and NM_024680.4. CCND1 is also known as “cyclin DI.” Exemplary sequences of CCND1 can be found, for example, at UniProt P24385, NCBI Gene ID 595, NG_007375.1, and NM_053056.3. CCND2 is also known as “cyclin D2.” Exemplary sequences of CCND2 can be found, for example, at UniProt P30279, NCBI Gene ID 894, NG_034254.1, and NM_001759.4. CCND3 is also known as “cyclin D3.” Exemplary sequences of CCND3 can be found, for example, at UniProt P30281, NCBI Gene ID 896, NG_041939.1, NM_001136017.3, NM_001136125.3, NM_001136126.3, NM_001287427.2, NM_001287434.2, and NM_001760.5. CCNE1 is also known as "Cyclin El / Gl / S-specific cyclin-El." Exemplary sequences of CCNE1 can be found, for example, at UniProt P24864, NCBI Gene ID 898, Ensembl ID ENSG00000105173, and NM_001238.4. CCNE2 is also known as "Cyclin E2Z Gl / S-specific cyclin-E2". Exemplary sequences of CCNE2 can be found, for example, at UniProt 096020, NCBI Gene ID 9134, Ensembl ID ENSG00000175305, and NM_057749.3. CDK2 is also known as "Cyclin-dependent kinase 2". Exemplary sequences of CDK2 can be found, for example, at UniProt P24941, NCBI Gene ID 1017, Ensembl ID ENSG00000123374, and NM_001798.5. CDK4 is also known as “cyclin-dependent kinase 4.” Exemplary sequences of CDK4 can be found, for example, at UniProt Pl 1802, NCBI Gene ID 1019, NG_007484.2, and NM_000075.4. CDK6 is also known as cyclin-dependent kinase 6.” Exemplary sequences of CDK6 can be found, for example, at UniProt Q00534, NCBI Gene ID 1021, NG_015888.1, NM_001145306.2, and NM_001259.8. p!6 / INK4A / CDKN2A is also known as “cyclin-dependent kinase inhibitor 2A.” Exemplary sequences of p!6 / INK4A / CDKN2A can be found, for example, at UniProt P42771, NCBI Gene ID 1029, NG_007485.1, NM_000077.5, NM_001195132.2, NM_001363763.2, NM_058195.4, and NM_058197.5. CDKN2B is also known as “cyclin- dependent kinase inhibitor 2B / Cyclin-dependent kinase 4 inhibitor B.” Exemplary sequences of CDKN2B can be found, for example, at UniProt P42772, NCBI Gene ID 1030, NG_023297.1, NM_004936.4, and NM_078487.2. CDKN2C is also known as “cyclin- dependent kinase inhibitor 2C / Cyclin-dependent kinase 4 inhibitor C.” Exemplary sequences of CDKN2C can be found, for example, at UniProt P42773, NCBI Gene ID 1031,24MF-363552698Attorney Docket No.: 74444-20008.40NC_000001.11, NM_001262.3, and NM_078626.3.” CDKN2D is also known as “cyclin- dependent kinase inhibitor 2D / Cyclin-dependent kinase 4 inhibitor D.” UniProt P55273, NCBI Gene ID 1032, NC_000019.10, NM_001800.4, and NM_079421.3.
[0072] In some embodiments, the method comprises determining a level of a Rb / E2F pathway gene. In some embodiments, the level of a Rb / E2F pathway gene is DNA level (e.g, genomic DNA copy number). In some embodiments, the level of a Rb / E2F pathway gene is RNA level. In some embodiments, the level of a Rb / E2F pathway gene is protein level. In some embodiments, the method comprises determining a mutation of a Rb / E2F pathway gene. In some embodiments, the mutation is a deletion in a genomic DNA region of a Rb / E2F pathway gene. In some embodiments, the mutation is a loss of function mutation in a Rb / E2F pathway gene. In some embodiments, the mutation is a gain of function mutation in a Rb / E2F pathway gene. In some embodiments, the mutation prevents degradation of a Rb / E2F pathway gene. In some embodiments, the mutation prevents p!6 binding to a Rb / E2F pathway gene.
[0073] The level of a gene in a biological sample may be measured at the nucleic acid level (e.g, gene copy number, DNA methylation or chromatin remodeling level, mRNA level), or protein level, including post-translational modification level of the protein, such as phosphorylation level of the protein corresponding to the biomarker. The level of a gene in a biological sample may be determined using any of the known methods in the art. For example, suitable methods for determining the DNA level of a gene include, but are not limited to, Polymerase Chain Reaction (PCR), DNA sequencing, and in situ hybridization, and Genome-wide genotyping arrays to detect genetic variants including CNVs (CNV Array). For example, suitable methods for determining the mRNA level of a gene include, but are not limited to, Reverse Transcription Polymerase Chain Reaction (RT-PCR), quantitative PCR, microarray, whole-exome sequencing (WES), NanoString and RNA sequencing. For example, suitable methods for determining the protein expression level of a gene include, but are not limited to, immunohistochemistry, Western blotting, antibody-based immunoassays, and mass spectroscopy methods.
[0074] “In-situ hybridization” refers to hybridization techniques that utilize labeled DNA, RNA, or modified nucleic acids, to identify a specific DNA or RNA sequence within a tissue, tissue section, or cell.
[0075] “PCR” refers to the polymerase chain reaction technique, which can be used to amplify DNA within a sample. PCR methods are well known in the art.25MF-363552698Attorney Docket No.: 74444-20008.40
[0076] “DNA sequencing” refers to methods of determining the nucleic acid sequence in DNA. DNA sequencing methods are well known in the art, including Sanger sequencing and next-generation sequencing.
[0077] “RNA sequencing” or “RNA-Seq” refers to a nucleic acid sequencing technique using next-generation sequencing techniques to identify the presence and quantity of RNA within a biological sample at a given time point. RNA sequencing permits examination of changes in gene expression levels, mutations, alternative splicing of transcripts, post- transcriptional modifications, and gene fusions.
[0078] ‘RT-PCR” refers to the technique of combining reverse transcription of RNA into DNA and amplification of DNA using the polymerase chain reaction (PCR). RT-PCR can be used to measure the amount of RNA in a sample. RT-PCR may utilize fluorescent dyes for quantitative measurements, techniques referred to as real-time PCR or quantitative PCR.
[0079] Immunohistochemistry refers to immunostaining techniques whereby antigens within cells, tissues, or tissue sections are identified using antibodies. A number of methods well known in the art can accomplish visualization of antigen-antibody interactions within biological samples.
[0080] Enzyme-linked immunoassay (ELISA) is an analytical biochemistry assay involving detection of an antigen within a sample using an antibody. The antibody used is linked to an enzyme that will produce a detectable signal in the presence of the enzymes substrate.
[0081] In some embodiments, the method comprises determining a level of a coxsackie adenovirus receptor (CXADR) gene polynucleotide (e.g, RNA) in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of the CXADR gene polynucleotide (e.g, RNA). In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of the CXADR gene polynucleotide (e.g, RNA) exceeds a control level of the CXADR gene polynucleotide (e.g, RNA). In certain embodiments, the CXADR gene polynucleotide is RNA (e.g, mRNA). In some embodiments, determining the level of the CXADR gene polynucleotide comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof. In some embodiments, the method comprising determining the level of a CXADR gene polypeptide (e.g, protein) in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of the26MF-363552698Attorney Docket No.: 74444-20008.40CXADR gene polypeptide (e.g, protein). In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of the CXADR gene polypeptide (e.g, protein) exceeds a control level of the CXADR gene polypeptide (e.g, protein). In certain embodiments, determining the level of the CXADR gene polypeptide comprises immunohistochemistry, enzyme-linked immunoassay (ELISA), high- throughput Luminex-multiplex based assays, flow-cytometry based assays, high-throughput- multiplexed Proximity Extension Assay (PEA) technology -based protein analysis, or a combination thereof.
[0082] In some embodiments, the method comprises determining a level of each of one or more Rb / E2F pathway gene polynucleotides (e.g, RNAs) in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of each of the one or more Rb / E2F pathway gene polynucleotides (e.g, RNAs). In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway gene polynucleotides (e.g, RNAs) exceeds or is lower than a control level of the same Rb / E2F pathway gene polynucleotide (e.g, RNA). In certain embodiments, the one or more Rb / E2F pathway gene polynucleotides are DNA. In some embodiments, determining the level of the one or more Rb / E2F pathway gene polynucleotides comprises DNA sequencing including but not limited to next-generation sequencing (NGS) based technology, whole-genome sequencing (WGS), or targeted sequencing panel analysis, PCR, in-situ hybridization, or any combination thereof. In certain embodiments, the one or more Rb / E2F pathway gene polynucleotides are RNAs. In some embodiments, determining the level of the one or more Rb / E2F pathway gene polynucleotides comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof. In some embodiments, the method comprises determining a level of each of one or more Rb / E2F pathway gene polypeptides (e.g, proteins) in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of each of the one or more Rb / E2F pathway gene polypeptides (e.g, proteins). In some embodiments, the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway gene polypeptides (e.g, proteins) exceeds or is lower than a control level of the same Rb / E2F pathway gene polypeptides (e.g, protein). In certain embodiments, determining the level of one or more Rb / E2F pathway gene27MF-363552698Attorney Docket No.: 74444-20008.40 polypeptides comprises immunohistochemistry, enzyme-linked immunoassay (ELISA), high- throughput Luminex-multiplex based assays, flow-cytometry based assays, high-throughput- multiplexed Proximity Extension Assay (PEA) technology -based protein analysis, or a combination thereof. In some embodiments, the one or more Rb / E2F pathway genes are selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining the level of E2F1. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of ,E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non- cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a28MF-363552698Attorney Docket No.: 74444-20008.40 non-cancerous sample. In some embodiments, the control level is a baseline level of steadystate gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions.
[0083] In some embodiments wherein the method comprises determining a level of two or more genes in the biological sample, the method may comprise determining any combination of gene products for determining the levels of each of the two or more genes. For example, in some embodiments, the method comprises determining a level of a first gene and a second gene in the biological sample, wherein (1) determining the level of the first gene comprises determining the level of a polynucleotide of the first gene (e.g, RNA), and (2) determining the level of the second gene comprises determining the level of a polynucleotide of the first gene (e.g, an RNA). In some embodiments, (1) determining the level of the first gene comprises determining the level of a polynucleotide of the first gene (e.g, RNA), and (2) determining the level of the second gene comprises determining the level of a polypeptide of the second gene (e.g, a protein). In some embodiments (1) determining the level of the first gene comprises determining the level of a polypeptide of the first gene (e.g, a protein), and (2) determining the level of the second gene comprises determining the level of a polypeptide of the second gene (e.g, a protein). In certain embodiments, the level of the first gene is determined prior to determining the level of the second gene. In certain embodiments, the first gene is a CXADR gene and the second gene is an Rb / E2F pathway gene. In some embodiments, the first gene is a CXADR gene and the second gene is selected from a panel of one or more Rb / E2F pathway genes. In certain embodiments, the level of the CXADR gene is determined prior to determining the level of the Rb / E2F pathway gene.
[0084] In some embodiments, the method comprises determining a level of a first gene and two or more (e.g, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, or more) additional genes in the biological sample, wherein (1) determining the level of the first gene comprises determining the level of a polynucleotide of the first gene (e.g, RNA), and (2) determining the level of each of the two or more additional genes comprises determining the level of a polynucleotide of the first gene (e.g, an RNA). In some embodiments, (1) determining the level of the first gene comprises determining the level of a polynucleotide of the first gene (e.g, RNA), and (2) determining the level of each of the two or more additional genes comprises determining the level of a polypeptide of the second gene (e.g, a protein). In some embodiments (1) determining the level of the first gene comprises determining the level of a polypeptide of the first gene (e.g, a protein), and (2) determining the level of each of the two29MF-363552698Attorney Docket No.: 74444-20008.40 or more additional genes comprises determining the level of a polypeptide of the second gene (e.g, a protein). In certain embodiments, the level of the first gene is determined prior to determining the level of each of the two or more additional genes. In certain embodiments, the first gene is a CXADR gene and the two or more additional genes are Rb / E2F pathway genes (i.e., any of the Rb / E2F pathway genes described herein). In certain embodiments, the level of the CXADR gene is determined prior to determining the level of each of the two or more Rb / E2F pathway genes.
[0085] The level of the gene may be determined using a fresh or archived sample from the individual, including, but not limited to, the solid or lymphatic tumor tissue, a normal tissue adjacent to the solid or lymphatic tumor tissue, a normal tissue distal to the solid or lymphatic tumor tissue, or peripheral blood lymphocytes. In some embodiments, the sample is a solid or lymphatic tumor sample (e.g, solid or lymphatic tumor tissue). In some embodiments, the sample is a biopsy containing tumor cells, such as fine needle aspiration of tumor cells. In some embodiments, the biopsied cells are centrifuged into a pellet, fixed, and embedded in paraffin prior to the analysis. In some embodiments, the biopsied cells are flash frozen prior to the analysis. In some embodiments, the sample is a bodily fluid, such as a blood sample, a plasma sample, or a urine sample. In some embodiments, the sample comprises a circulating metastatic cancer cell. In some embodiments, the sample is obtained by sorting circulating tumor cells (CTCs) from blood.
[0086] High or low levels of a gene are determined as compared to a control level of the gene. The control level of the gene may be a standard level of the gene known in the art (e.g, a clinically accepted normal level in a standardized test), or may be the level of the gene in a control sample. In some embodiments, the level of the gene in the biological sample from the individual is compared to the level of the gene in multiple control samples. In some embodiments, multiple control samples are used to generate a statistic that is used to classify the level of the gene in an individual with the solid or lymphatic tumor. Control samples can be obtained from the same sources (e.g, individual and tissue) and methods as non-control samples. In some embodiments, the control sample is obtained from a different individual (for example an individual not having the solid or lymphatic tumor; an individual having a benign or less advanced form of the solid or lymphatic tumor; and / or an individual sharing similar ethnic, age, and gender). In some embodiments, the control sample is a sample from an individual not having a solid or lymphatic tumor (e.g. , a healthy individual). In certain embodiments, the control sample is from a population of individuals, none of which have a30MF-363552698Attorney Docket No.: 74444-20008.40 solid or lymphatic tumor (e.g., a healthy population of individuals). In some embodiments, the control sample is a cultured tissue or cell that has been determined to be a proper control. In some embodiments, wherein the sample is solid or lymphatic tumor sample, the control sample may be a non-cancerous sample from the same individual. In some embodiments, multiple control samples (e.g, from different individuals) are used to determine a range of levels of the gene in a particular tissue, organ, or cell population.
[0087] In some embodiments wherein the method comprises determining a level of two or more genes in the biological sample, the control levels of each of the two or more genes may be any combination of control levels described herein. For example, in some embodiments wherein the method comprises determining a level a first and second gene in the biological sample, (1) the control level of the first gene is a pre-determined level of the first gene; and (2) the control level the second gene is a pre-determined level of the second gene. In other embodiments, (1) the control level of the first gene is a pre-determined level of the first gene; and (2) the control level the second gene is the level of the second gene in a healthy individual or a healthy population of individuals. In other embodiments, (1) the control level of the first gene is a pre-determined level of the first gene; and (2) the control level the second gene is the level of the second gene in non-cancerous sample from the individual. In other embodiments, (1) the control level of the first gene is the level of the first gene in a healthy individual or a healthy population of individuals, and (2) the control level the second gene is a pre-determined level of the second gene. In other embodiments, (1) the control level of the first gene is the level of the first gene in a healthy individual or a healthy population of individuals, and (2) the control level the second gene is the level of the second gene in a healthy individual or a healthy population of individuals. In other embodiments, (1) the control level of the first gene is the level of the first gene in a healthy individual or a healthy population of individuals, and (2) the control level the second gene is the level of the second gene in non-cancerous sample from the individual. In other embodiments, (1) the control level of the first gene is the level of the first gene in non-cancerous sample from the individual, and (2) the control level the second gene is a pre-determined level of the second gene. In other embodiments, (1) the control level of the first gene is the level of the first gene in non-cancerous sample from the individual, and (2) the control level the second gene is the level of the second gene in a healthy individual or a healthy population of individuals. In other embodiments, (1) the control level of the first gene is the level of the first gene in non- cancerous sample from the individual, and (2) the control level the second gene is the level of31MF-363552698Attorney Docket No.: 74444-20008.40 the second gene in non-cancerous sample from the individual. In certain embodiments, the level of the first gene is determined prior to determining the level of the second gene. In certain embodiments, the first gene is a CXADR gene and the second gene is an Rb / E2F pathway gene. In some embodiments, the first gene is a CXADR gene and the second gene is selected from a panel of one or more Rb / E2F pathway genes. In certain embodiments, the level of the CXADR gene is determined prior to determining the level of the Rb / E2F pathway gene. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions.
[0088] In some embodiments, the method comprises determining a level of a first gene and two or more (e.g, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, or more) additional genes in the biological sample, (1) the control level of the first gene is a pre-determined level of the first gene; and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is a pre-determined level of the second gene. In other embodiments, (1) the control level of the first gene is a pre-determined level of the first gene; and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is the level of the same gene in a healthy individual or a healthy population of individuals. In other embodiments, (1) the control level of the first gene is a pre-determined level of the first gene; and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is the level of the same gene in non-cancerous sample from the individual. In other embodiments, (1) the control level of the first gene is the level of the first gene in a healthy individual or a healthy population of individuals, and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is a pre-determined level of the same gene. In other embodiments, (1) the control level of the first gene is the level of the first gene in a healthy individual or a healthy population of individuals, and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is the level of the same gene in a healthy individual or a healthy population of individuals. In other embodiments, (1) the control level of the first gene is the level of the first gene in a healthy individual or a healthy population of individuals, and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is the level of the same gene in non-cancerous sample from the individual. In other embodiments, (1) the control level of the first gene is the level of the first gene in non-cancerous sample from the individual, and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is a pre-determined32MF-363552698Attorney Docket No.: 74444-20008.40 level of the same gene. In other embodiments, (1) the control level of the first gene is the level of the first gene in non-cancerous sample from the individual, and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is the level of the same gene in a healthy individual or a healthy population of individuals. In other embodiments, (1) the control level of the first gene is the level of the first gene in non- cancerous sample from the individual, and (2) the control level of at least one (e.g, one, some, or all) of the two or more additional genes is the level of the same gene in non- cancerous sample from the individual. In certain embodiments, the level of the first gene is determined prior to determining the level of the second gene. In certain embodiments, the first gene is a CXADR gene and the two or more additional genes are Rb / E2F pathway genes (i.e., any of the Rb / E2F pathway genes described herein). In some embodiments, the level of the CXADR gene is determined prior to determining the level of each of the two or more Rb / E2F pathway genes. In some embodiments, the control level is a baseline level of steadystate gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions.
[0089] In some embodiments, provided herein is a method of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, the method comprising determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and (2) a level of each of one or more Rb / E2F pathway genes in a biological sample (e.g, a solid or lymphatic tumor sample) of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on the level of the CXADR gene exceeds that of a control level of a CXADR gene (e.g. , a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual) and at least one (e.g, one, two, three, four, five, or all six) of the following: (a) the level of one or more E2F family genes (e.g., E2F1, E2F2, E2F3, E2F4, and / or E2F5) exceeds that of a control level of the same gene (e.g, a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual); (b) the level of one or more RB family genes (e.g, RBI, RB2 / pl30, and / or RB3 / plO7) is lower than that of a control level of the same gene (e.g, a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual); (c) the level of one or more cyclin D family genes (e.g, CCND1, CCND2, and / or CCND3) exceeds that of a control level of the same gene (e.g, a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from33MF-363552698Attorney Docket No.: 74444-20008.40 the individual); (d) the level of one or more cyclin E family genes (e.g, CCNE1 and / or CCNE2) exceeds that of a control level of the same gene (e.g, a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual); (e) the level of one or more CDK family genes (e.g, CDK2, CDK4, and / or CDK6,) exceeds that of a control level of the same gene (e.g, a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual); and (f) the level of one or more CDKN2A / B / C / D genes (e.g, CDKN2A, CDKN2B, CDKN2C, and / or CDKN2D) is lower than that of a control level of the same gene (e.g. , a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual). In some embodiments, the method comprises determining the level of the CXADR gene prior to determining the levels level of each of one or more Rb / E2F pathway genes. In certain embodiments, the method comprises determining the level of one or more Rb / E2F pathway genes based on the level of the CXADR gene exceeding that of a control level of a CXADR gene (e.g, a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual). In some embodiments, the method comprises first determining a level of a coxsackie adenovirus receptor (CXADR) gene in a biological sample (e.g, a solid or lymphatic tumor sample) of the individual, and subsequently determining the level of one or more Rb / E2F pathway genes in a biological sample (e.g, a solid or lymphatic tumor sample) of the individual based on based on the level of the CXADR gene exceeding that of a control level of a CXADR gene (e.g. , a pre-determined level, a level in a healthy individual or population individuals, or a level in a non-cancerous sample from the individual). In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. In some embodiments, provided herein is a method of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus according to FIG. 7
[0090] In some embodiments, the level of the gene in a sample of the individual is classified as high, medium or low according to a scoring system, such as an immunohistochemistry-based scoring system. In some embodiments, a high level of the gene in a sample from the individual is at least about any one of 1.5 times, 2 times, 3 times, 5 times, 10 times, 20 times, 50 times, 100 times, 200 times, 500 times, 1000 times or more than the level of the gene in a control sample. In some embodiments, a low level of the gene in a34MF-363552698Attorney Docket No.: 74444-20008.40 sample from the individual is no more than about any one of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 1%, 0.1%, 0.01%, 0.001% or less of the level of the gene in a control sample. In some embodiments, the expression levels of two or more biomarkers are combined, for example, using a statistic model to determine an expression score, for selecting or recommending the individual for the treatment.Methods of Treating a Solid or Lymphatic Tumor
[0091] In some aspects, provided herein is a method of treating a solid or lymphatic tumor in an individual, the method comprising (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and (b) administering to the individual an effective amount of an oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In other aspects, provided herein is a method of treating a solid or lymphatic tumor in an individual, the method comprising administering to the individual an effective amount of an oncolytic virus, wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level of a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the level of the CXADR gene or one or more Rb / E2F pathway genes is a level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. The foregoing methods may comprise any means of determining (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual described herein. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene35MF-363552698Attorney Docket No.: 74444-20008.40 essential for replication of the virus. In some embodiments, the oncolytic virus is administered locally to the site of the tumor. In certain embodiments, the solid or lymphatic tumor is bladder cancer, and the oncolytic virus is administered intravesically. In some embodiments, the oncolytic virus is administered as a monotherapy. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator. In certain embodiments, the immunomodulator is a modulator of an immune checkpoint molecule. In certain embodiments wherein the method further comprises administering to the individual an effective amount of an immunomodulator, the oncolytic virus and the immunomodulator are administered locally to the site of the tumor (e.g., intravesically). In other embodiments wherein the method further comprises administering to the individual an effective amount of an immunomodulator, the oncolytic virus is administered locally to the site of the tumor (e.g., intravesically), and the immunomodulator is administered systemically (e.g, intravenously). In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase.
[0092] In some embodiments, provided herein is a method of treating a solid or lymphatic tumor in an individual, the method comprising (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and (b) administering to the individual an effective amount of the oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises36MF-363552698Attorney Docket No.: 74444-20008.40 an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF (e.g, is cretostimogene). In some embodiments, the oncolytic virus is administered locally to the site of the tumor, such as directly into the tumor (i.e., intratumorally) or to the tissue having the tumor (e.g, intravesically). In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the oncolytic virus is administered as a single therapeutic agent. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator, such as any of the immunomodulators described herein. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0093] In some embodiments, provided herein a method of treating a solid or lymphatic tumor in an individual, the method comprising administering to the individual an effective amount of an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level of a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments,37MF-363552698Attorney Docket No.: 74444-20008.40 the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF (e.g, is cretostimogene). In some embodiments, the oncolytic virus is administered locally to the site of the tumor, such as directly into the tumor (i.e., intratumorally) or to the tissue having the tumor (e.g, intravesically). In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the oncolytic virus is administered as a single therapeutic agent. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator, such as any of the immunomodulators described herein. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody).38MF-363552698Attorney Docket No.: 74444-20008.40
[0094] In some embodiments, provided herein is an oncolytic virus for use in a method of treating a solid or lymphatic tumor in an individual, wherein the method comprises administering an effective amount of the oncolytic virus to the individual, and wherein: (1) the level of the coxsackie adenovirus receptor (CXADR) gene in a biological sample of the individual exceeds a control level of the CXADR gene; and / or (2) the level of each of one or more Rb / E2F pathway genes in a biological sample of the individual exceeds or is lower than a control level of the same Rb / E2F pathway gene; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of ,E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a predetermined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in anon-cancerous sample. In some embodiments, the level of each of one or more of CCND1,39MF-363552698Attorney Docket No.: 74444-20008.40CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF (e.g, is cretostimogene). In some embodiments, the oncolytic virus is administered locally to the site of the tumor, such as directly into the tumor (i.e., intratumorally) or to the tissue having the tumor (e.g, intravesically). In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months.40MF-363552698Attorney Docket No.: 74444-20008.40In certain embodiments, the induction phase is repeated at least once. In some embodiments, the oncolytic virus is administered as a single therapeutic agent. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator, such as any of the immunomodulators described herein. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g., an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0095] In some embodiments, provided herein is a method of treating a solid or lymphatic tumor in an individual, the method comprising (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; (b) administering to the individual an effective amount of the oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes; and (c) administering to the individual an effective amount of an immunomodulator. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g., an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF (e.g, is cretostimogene). In some embodiments, the oncolytic virus is administered locally to the site of the tumor, such as directly into the41MF-363552698Attorney Docket No.: 74444-20008.40 tumor (i.e., intratumorally) or to the tissue having the tumor (e.g, intravesically). In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g., N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In some embodiments, the induction phase is repeated at least once. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0096] In some embodiments, provided herein a method of treating a solid or lymphatic tumor in an individual, the method comprising (a) administering to the individual an effective amount of an oncolytic virus, and (b) administering to the individual an effective amount of an immunomodulator; wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F- 1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g., GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6,42MF-363552698Attorney Docket No.: 74444-20008.40TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTa[3). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g., an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF (e.g, is cretostimogene). In some embodiments, the oncolytic virus is administered locally to the site of the tumor, such as directly into the tumor (i.e., intratumorally) or to the tissue having the tumor (e.g., intravesically). In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g., an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0097] In some embodiments, provided herein is a combination for use in a method of treating a solid or lymphatic tumor in an individual, wherein the combination comprises an oncolytic virus and an immunomodulator, wherein the method comprises (a) administering an effective amount of the oncolytic virus to the individual, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, and (b) administering an effective amount of the immunomodulator to the individual, and wherein: (1) the level of the coxsackie adenovirus receptor (CXADR) gene in a biological sample of the individual exceeds a control level of the CXADR gene; and / or (2) the level of each of one or more Rb / E2F pathway genes in a biological sample of the individual exceeds or is lower than a control level of the same Rb / E2F pathway gene. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E243MF-363552698Attorney Docket No.: 74444-20008.40 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain44MF-363552698Attorney Docket No.: 74444-20008.40 embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF (e.g, is cretostimogene). In some embodiments, the oncolytic virus is administered locally to the site of the tumor, such as directly into the tumor (i.e., intratumorally) or to the tissue having the tumor (e.g, intravesically). In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0098] The methods described herein may comprise a step of locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus. In some embodiments, the pretreatment composition comprises a transduction enhancing agent, such as N-Dodecyl-P-D-maltoside (DDM). DDM is a nonionic surfactant comprised of a maltose derivatized with a single twelve-carbon chain, and acts as a mild detergent and solubilizing agent. It has been used as a food additive and is known to enhance mucosal surface permeation in rodents, probably due to its effect on membrane associated GAG and tight junctions.45MF-363552698Attorney Docket No.: 74444-20008.40
[0099] The pretreatment composition can be administered directly into the tumor or to a tissue having the tumor. In some embodiments, the pretreatment composition comprises a solution of the transduction enhancing agent (such as DDM). Suitable concentration of the pretreatment composition (such as DDM solution) include, but are not limited to, about any one of 0.01%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, or 5% of the transducing enchanting agent (such as DDM). In some embodiments, the pretreatment composition comprises any of about 0.01% to about 0.05%, about 0.05% to about 0.1%, about 0.1% to about 0.5%, about 0.5% to about 1%, about 1% to about 2%, about 2% to about 3%, about 3% to about 4%, about 4% to about 5%, about 0.01% to about 1%, about 0.05% to about 2%, about 1% to about 5%, or about 0.1% to about 5% of the transduction enhancing agent (such as DDM).
[0100] In some embodiments, the pretreatment (such as DDM) is administered immediately (such as no more than 5 minutes) prior to the administration of the oncolytic virus. In some embodiments, the pretreatment (such as DDM) is administered no more than about any of 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 45 minutes, 1 hour, 90 minutes, 2 hours, 3 hours or 4 hours before the administration of the oncolytic virus. In some embodiments, the pretreatment (such as DDM) is administered no more than about 2 hours before the administration of the oncolytic virus.
[0101] Suitable dosages for the pretreatment composition (such as DDM) include, but are not limited to, about any of 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.5mg / kg, 2 mg / kg, 2.5 mg / kg, 5mg / kg, 10 mg / kg, 25 mg / kg, 50 mg / kg, 100 mg / kg, 150 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, 400 mg / kg, 500 mg / kg, 0.1 mg / kg to 0.5 mg / kg, 0.5 mg / kg to 1 mg / kg, 1 mg / kg to 2 mg / kg, 2 mg / kg to 5mg / kg, 5mg / kg to 10 mg / kg, 10 mg / kg to 25 mg / kg, 25 mg / kg to 50 mg / kg, 50 mg / kg to 100 mg / kg, 100 mg / kg to 150 mg / kg, 150 mg / kg to 200 mg / kg, 200 mg / kg to 250 mg / kg, 250 mg / kg to 500 mg / kg, or 0.5 mg / kg to about 5 mg / kg. In some embodiments, a suitable dosage for the pretreatment composition is about any one of 0.1 g, 0.2 g, 0.5g, 0.75 g, 1 g, 1.5 g, 2 g, 2.5 g, 5 g, or 10 g of the transduction enhancing agent (such as DDM).
[0102] In some embodiments, the individual (e.g, wholly or only at the site of the tumor) is subject to a prior therapy prior to the administration of the oncolytic virus. In some embodiments, the prior therapy is tumor site preparation using one or more (such as 1, 2, 3, 4, 5, or more) treatment modalities, including, but are not limited to radiation therapy, administration of one or more immune-related molecules, administration of other therapeutic46MF-363552698Attorney Docket No.: 74444-20008.40 agents, and combinations thereof. It is believed that adding other pre-treatment preparations can increase the chance of success for the methods described above. Without being bound by any theory or hypothesis, for example, local radiation, with or without lymphodepletion effects, or chemotherapy, may increase the chance of the infectious process of the oncolytic virus, and may deplete the more sensitive Treg cells at the tumor sites, thereby reviving the exhausted or telorized T memory cells. Similarly, tumor site preparations prior to or concomitant with the administration of the oncolytic virus at the tumor site can involve cytokines, chemokines, small molecules and other well-known beneficial immunomodulators, such as IL2, IL12, 0X40, CD40 and 4-1BB agonists. These tumor site preparation modalities can be given in conjunction with the oncolytic virus or in sequence with the oncolytic virus, depending on needs.
[0103] In some embodiments, the prior therapy is radiation therapy (e.g, with or without chemotherapy). In some embodiments, the radiation therapy is in combination with chemotherapy. In some embodiments, the prior therapy is radiation therapy to the whole body. In some embodiments, the prior therapy is radiation therapy to only tumor sites. In some embodiments, the prior therapy is radiation therapy to tissues having the tumor. In some embodiments, the prior therapy is radiation therapy to only the site of the tumor. In some embodiments, the prior therapy is radiation therapy to only a tissue having the tumor. In some embodiments, the dose of the radiation therapy is insufficient to treat the tumor cells. For example, a suitable dosage of the radiation therapy is about any one of 1 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, 60 Gy, 65 Gy, 70 Gy, 75 Gy, 80 Gy, 90 Gy or 100 Gy. In some embodiments, the dose of the radiation therapy is no more than about any one of 1 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, 60 Gy, 65 Gy, 70 Gy, 75 Gy, 80 Gy, 90 Gy or 100 Gy. In some embodiments, the dose of the radiation therapy is any one of about 1 Gy to about 5 Gy, about 5 Gy to about 10 Gy, about 10 Gy to about 15 Gy, about 15 Gy to about 20 Gy, about 20 Gy to about 25 Gy, about 25 Gy to about 30 Gy, about 30 Gy to about 35 Gy, about 5 Gy to about 15 Gy, about 10 Gy to about 20 Gy, about 20 Gy to about 30 Gy, about 30 Gy to about 40 Gy, about 40 Gy to about 50 Gy, about 50 Gy to about 60 Gy, about 60 Gy to about 70 Gy, about 70 Gy to about 80 Gy, about 80 Gy to about 100 Gy, about 10 Gy to about 30 Gy, about 20 Gy to about 40 Gy, about IGy to about 25 Gy, about 25 Gy to about 50 Gy, about 30 Gy to about 60 Gy, about 60 Gy to about 80 Gy, or about 10 Gy to about 60 Gy. The suitable dosage of the radiation therapy may also depend on the type, stage and location of the tumor.47MF-363552698Attorney Docket No.: 74444-20008.40
[0104] In some embodiments, the radiation therapy is administered in more than one fraction, such as about any one of 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 16, 18, 20 or more fractions. In some embodiments, the radiation therapy fractions are administered over the course of about any one of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks or more. In some embodiments, the radiation therapy fractions are administered over the course of any one of about 1 day to about 5 days, about 1 week to about 2 weeks, about 2 weeks to about 3 weeks, about 3 weeks to about 4 weeks, about 4 weeks to about 5 weeks, about 5 weeks to about 6 weeks, about 6 weeks to about 7 weeks, about 2 weeks to about 4 weeks, about 4 weeks to about 6 weeks, or about 1 week to about 6 weeks. In some embodiments, the radiation therapy is administered about two fractions per day. In some embodiments, each fraction of the radiation therapy is about 1.8 Gy to about 2 Gy per day, five days a week, for an adult, or about 1.5 Gy to about 1.8 Gy per day, five days a week for a child. In some embodiments, each fraction of the radiation therapy is about any one of 1 Gy, 1.5 Gy, 2 Gy, 2.5 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 30 Gy, 40 Gy, 50 Gy or more. In some embodiments, each fraction of the radiation therapy is any one of about 1 Gy to about 1.5 Gy, about 1.5 Gy to about 2 Gy, about 1 Gy to about 2.5 Gy, about 2.5 Gy to about 5 Gy, about 5 Gy to about 10 Gy, about 10 Gy to about 15 Gy, about 15 Gy to about 20 Gy, about 20 Gy to about 30 Gy, about 25 Gy to about 50 Gy, about 1 Gy to about 10 Gy, or about 2 Gy to about 20 Gy. In some embodiments, the radiation therapy is administered in a single fraction.
[0105] In some embodiments, the radiation therapy is for the purpose of lymphodepletion, either as a single dose fraction per day or in multiple fractions over days to weeks. In some embodiments, the lymphodepletion radiation therapy is given as a total body irradiation. In some embodiments, the lymphodepletion is only given to local tumor sites, or to tissues with the tumor. In some embodiments, the lymphodepletion radiation therapy is administered two fractions per day. In some embodiments, each fraction of the lymphodepletion radiation therapy is about 1 Gy to about 2 Gy per day, five days a week, for an adult, or about 0.5 Gy to about 1.8 Gy per day, five days a week for a child. In some embodiments, each fraction of the radiation therapy is about any one of 1 Gy, 1.5 Gy, 2 Gy, 2.5 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 30 Gy, 40 Gy, 50 Gy or more. In some embodiments, each fraction of the radiation therapy is any one of about 1 Gy to about 1.5 Gy, about 1.5 Gy to about 2 Gy, about 1 Gy to about 2.5 Gy, about 2.5 Gy to about 5 Gy, about 5 Gy to about 10 Gy, about 10 Gy to about 15 Gy, about 15 Gy to about 20 Gy, about 20 Gy to about 3048MF-363552698Attorney Docket No.: 74444-20008.40Gy, about 25 Gy to about 50 Gy, about 1 Gy to about 10 Gy, or about 2 Gy to about 20 Gy. In some embodiments, lymphodepletion radiation therapy is administered with or without the use of a chemotherapeutic agent, such as but not limited to, cyclophosphamide and fludarabine.
[0106] Any of the known methods of radiation therapy may be used in the present invention, including, but not limited to external beam radiation therapy (EBRT or XRT), tele therapy, brachytherapy, sealed source radiation therapy, systemic radioisotope therapy (RIT), unsealed source radiation therapy, intraoperative radiation therapy (IORT), targeted intraoperative radiation therapy (TARGIT), intensity-modulated radiation therapy (IMRT), volumetric modulated arc therapy (VMAT), particle therapy, and auger therapy.
[0107] In some embodiments, the prior therapy comprises administration of a therapeutic agent. In some embodiments, the dosage of the therapeutic agent is sufficient to treat the tumor. In some embodiments, the dosage of the therapeutic agent is insufficient to treat the tumor. In some embodiments, the therapeutic agent is any one or combination of chemotherapeutic agents known in the art, for example, cyclosphamide. In some embodiments, the therapeutic agent is any one or combination of agents targeting or blocking a cellular signaling pathway known in the art, for example, a BRAF inhibitor. In some embodiments, the therapeutic agent is any one or combination of cell therapies known in the art, for example, TIL cells, CAR / T cells, and / or TCR / T cells. In some embodiments, the therapeutic agent is an agent that increases the level of cytokines involved an immunogenic pathway. Any of the immune-related molecules described herein may be used as the therapeutic agent, including, but are not limited to, cytokines such as IL6, IL8 and IL 18 (these cytokines can either have pro and / or anti-inflammatory actions, or some may promote new blood vessels formation and tumor growth), chemokines (such as CCL21 that can promote tumor spread by increase of lymphatic structures), growth factors (such as FLT3L), heat shock proteins, small molecule kinase inhibitors (such as JAK2 inhibitor), IAP inhibitors, STING activators (such as CDN), PRRago (such as CpG ODN (oligodeoxynucleotides, for example, CpG 7909CCL21)), Imiquimod, or Poly I:C), TLR stimulators (such as GS-9620, AED-1419, CYT-003-QbG10, AVE-0675, or PF-7909), and RLR stimulators (such as RIG-I, Mda5, or LGP2 stimulators). In some embodiments, the therapeutic agent is an agent that causes dysfunction or damage to a structural component of a tumor. Exemplary agents include, but are not limited to, anti-VEGF antibody, a hyaluronidase, and n-dodecyl-pd-maltoside. In some embodiments, the therapeutic agent49MF-363552698Attorney Docket No.: 74444-20008.40 induces immune cells, such as dendritic cells, B cells, and T cells (such as follicular T helper cells).
[0108] Any of the therapeutic agents described herein (e.g. chemotherapeutic agents, agents targeting or blocking cell signaling pathways, cytokines, chemokines, cell therapies, etc.) can be administered directly or indirectly (e.g., through intravenous administration) to the tumor sites, either singly or in combination.
[0109] Exemplary routes of administration of the oncolytic virus, the immunomodulator, the prior therapy, and / or the pretreatment compositions include, but are not limited to, intratumoral, intravesical, intramuscular, intraperitoneal, intravenous, intra-arterial, intracranial, intrapleural, subcutaneous, and epidermal routes, or be delivered into lymph glands, body spaces, organs or tissues known to contain such live cancer cells (such as intrahepatic or intrapancreatic injections). In some embodiments, the local administration is carried out by direct injection of the agent(s) into the tumor. In some embodiments, the local administration is carried out by direct injection of the agent(s) to a site close to the tumor cells. In some embodiments, the systemic administration is via intravenous infusion. The specific route of the administration depends on the nature of the solid or lymphatic tumor and is discussed further below in the context of different types of solid or lymphatic tumor.
[0110] In some embodiments, wherein the oncolytic virus, and optionally the immunomodulator, is administered intratumorally (e.g, by intratumoral injection), the total volume administered is no more than about any one of 0.5 mL, 1 mL, 1.5 mL, 2 mL, 2.5 mL, 5 mL or 10 mL. In some embodiments, the volume of the oncolytic virus, and optionally the immunomodulator, for intratumoral administration (such as intratumoral injection) per tumor site is dependent on the size of the tumor. Tumor size can be measured as the tumor volume or the longest dimension of the tumor. For example, for a tumor with the longest dimension greater than about 5 cm, the intratumoral administration volume is no more than about 2 mL; for a tumor with the longest dimension of about 2 cm to about 5 cm, the intratumoral administration volume is about 1 mL; for a tumor with the longest dimension of about 0.75 cm to about 2 cm, the intratumoral administration volume is about 0.5 mL; and for a tumor with the longest dimension of smaller than about 0.75 cm, the intratumoral administration volume is about 0.1 mL. In some embodiments, the oncolytic virus, and optionally the immunomodulator, is administered to all tumor sites in the individual. In some embodiments, the oncolytic virus, and optionally the immunomodulator, is administered to about any one of 1, 2, 3, 4, 5, 6, or more tumor sites in the individual. In some embodiments, the oncolytic50MF-363552698Attorney Docket No.: 74444-20008.40 virus, and optionally the immunomodulator, is administered to the tumor site with the largest size.[oni] In some embodiments, the individual is a human individual. In some embodiments, the individual being treated for solid or lymphatic tumor has been identified as having one or more of the cancers described herein. Identification of the cancers as described herein by a skilled physician is routine in the art (e.g, via blood tests, X-rays, ultrasound, CT scans, PET scans, PET / CT scans, MRI scans, PET / MRI scans, nuclear medicine radioisotope scans, endoscopy, biopsy, angiography, CT-angiography, etc.) and may also be suspected by the individual or others, for example, due to tumor growth, hemorrhage, ulceration, pain, enlarged lymph nodes, cough, jaundice, swelling, weight loss, cachexia, sweating, anemia, paraneoplastic phenomena, thrombosis, etc. In some embodiments, the individual is selected for any one of the treatment methods described herein based on any one or more of a number of risk factors and / or diagnostic approaches appreciated by the skilled artisan, including, but not limited to, genetic profiling, family history, medical history (e.g, appearance of related conditions and viral infection history), lifestyle or habits.
[0112] In some embodiments, the individual further has a high expression level of one or more inhibitory immune checkpoint molecules, including, but not limited to, CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, 2B4 and ligands thereof. In some embodiments, the individual further has a low expression level of one or more stimulatory immune checkpoint molecules or co-stimulatory molecules, including, but not limited to, 0X40, 4-1BB, CD40, and ligands thereof. In some embodiments, the individual further has a high expression level of one or more genes selected from the group consisting of PD-1, PD- Ll, and PD-L2 in the tumor (such as tumor cells and / or immune cells inside the tumor). In some embodiments, the individual further has a high expression level of one or more genes selected from the group consisting of CD80, CD83, CD86 and HLA-Class II antigens in tumor-derived mature dendritic cells. In some embodiments, the individual further has a high expression level of one or more genes selected from the group consisting of CXCL9, CXCL10, CXCL11, CCR7, CCL5, CCL8, SOD2, MT2A, OASL, GBP1, HES4, MTIB, MTIE, MTIG, MTIH, GADD45A, LAMP3 and miR-155. In some embodiments, the method further comprises assessing the level of each of one or more additional genes in the individual. In some embodiments, the method is adjusted based on the levels of each of the one or more additional genes.Oncolytic Viruses51MF-363552698Attorney Docket No.: 74444-20008.40
[0113] The methods described herein comprise administering an effective amount of an oncolytic virus to an individual having a solid or lymphatic tumor. In some embodiments, the oncolytic virus an oncolytic adenovirus. In certain embodiments, the oncolytic adenovirus is an adenovirus serotype 5.
[0114] In some embodiments, the oncolytic virus is a wild-type (i.e., native, non- genetically modified) virus. In some embodiments, the oncolytic virus is a genetically modified virus. In certain embodiments, the oncolytic virus has additional favorable features (e.g, preferential replication in cancer cells, and encoding an immune-related molecule). In some embodiments, the oncolytic virus is attenuated (for example through multiple passages, inactivation or genetic modification). In some embodiments, the oncolytic virus is only a part, or parts of the wild type (i.e., native, non-genetically modified) oncolytic virus that can cause infection, inflammation or infection-like effects.
[0115] In some embodiments, the virus is replication competent. In some embodiments, the virus replicates preferentially in a cancer cell (e.g, a solid or lymphatic tumor cell). In some embodiments, the oncolytic virus preferentially replicates in a cancer cell that is defective in the Rb pathway. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, an exogenous promoter) operably linked to one or more viral genes (e.g, endogenous viral genes) essential for replication of the virus. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter (e.g, a human E2F-1 promoter). In some embodiments, the tumor-specific promoter is an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1 as shown below, or a nucleic acid sequence having at least 80% identity (e.g, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) to the nucleotide sequence set forth in SEQ ID NO: 1 as shown below. In some embodiments, the E2F-1 promoter comprises a functional fragment (e.g., a minimal promoter sequence) derived from SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:2 as shown below. In some embodiments, the E2F-1 promoter consists of SEQ ID NO:2. In certain embodiments wherein the oncolytic virus is an adenovirus, the one or more viral genes essential for replication of the virus comprise E1A, E1B, E4, or a combination thereof.
[0116] In some embodiments, the oncolytic virus further comprises an exogenous nucleic acid encoding a heterologous immune-related molecule, such as a cytokine or a chemokine. The heterologous immune-related molecule may be any immune-related molecule described52MF-363552698Attorney Docket No.: 74444-20008.40 herein. For example, in some embodiments, the immune-related molecule is GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTa[3. In certain embodiments, the immune-related molecule is GM-CSF.
[0117] In some embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a wild-type (i.e., native) adenovirus is replaced by an E2F-1 promoter (e.g., a human E2F-1 promoter), and the E3 19kD coding region of the native adenovirus is replaced by a nucleic acid sequence encoding a cytokine (e.g., human GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a wild-type (i.e., native) adenovirus is replaced by ahuman E2F-1 promoter, and the E3 19kD coding region of the native adenovirus is a nucleic acid sequence encoding human GM-CSF. In some embodiments, the human E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises a functional fragment (e.g., a minimal promoter sequence) derived from SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, the E2F-1 promoter consists of SEQ ID NO:2.
[0118] In some embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the endogenous El a promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In some embodiments, a polyadenylation signal (PA) is inserted 5’ of the E2F-1 promoter. In some embodiments, the nucleic acid encoding human GM-CSF is operably linked to the E3 promoter. In some embodiments, the vector backbone of the adenovirus serotype 5 further comprises E2, E4, late protein regions or inverted terminal repeats (ITRs) identical to the wildtype adenovirus serotype 5 genome. In some embodiments, the oncolytic virus has the genomic structure as shown in Figure 1. In some embodiments, the oncolytic virus is conditionally replicating. In some embodiments, the oncolytic virus preferentially replicates in cancer cells. In some embodiments, the cancer cells are Rb pathway-defective cancer cells. In some embodiments, the oncolytic virus is cretostimogene.
[0119] Thus, in some embodiments, there is provided a method of treating IR-NMIBC(such as low-grade Ta stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or solitary high-grade tumor of Ta stage having a diameter of 3 cm or smaller; solitary low grade Ta stage having a diameter of53MF-363552698Attorney Docket No.: 74444-20008.40 greater than 3 cm; two or more low-grade tumors of Ta stage; primary and solitary highgrade tumor of Ta stage having a diameter of less than 3 cm; low-grade tumor of T1 stage tumor; or any combination of: a tumor of low-grade Ta (LG Ta) stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or solitary high-grade tumor of Ta stage having a diameter of 3 cm or smaller; two or more low-grade tumors of Ta stage; and a low-grade tumor of T1 stage) in an individual, comprising intravesically administering to the individual an effective amount of an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine, for example, GM-CSF). In some embodiments, the tumor-specific promoter is a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises a functional fragment (e.g., a minimal promoter sequence) derived from SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, the E2F-1 promoter consists of SEQ ID NO:2. In some embodiments, the method further comprises administering to the individual a transduction enhancing agent (such as DDM) prior to the administration of the adenovirus. In some embodiments, the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic virus. In certain embodiments, the oncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to administering the oncolytic virus. In some embodiments, the adenovirus is administered at a dose of about 1 x 108to about lx 1014viral particles (such as about IxlO12viral particles). In some embodiments, the adenovirus is administered weekly. In some embodiments, the IR- NMIBC comprises a tumor of low-grade Ta (LG Ta) stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or solitary high-grade tumor of Ta stage having a diameter of 3 cm or smaller. In some embodiments, the IR-NMIBC comprises a solitary tumor of low grade Ta stage having a diameter of greater than 3 cm. In some embodiments, the IR-NMIBC comprises two or more low-grade tumors of Ta stage. In some embodiments, the IR-NMIBC comprises a primary and solitary high-grade tumor of Ta stage having a diameter of less than 3 cm. In some embodiments, the IR-NMIBC comprises a low-grade tumor of T1 stage. In some54MF-363552698Attorney Docket No.: 74444-20008.40 embodiments, the IR-NMIBC comprises any combination of: a tumor of low-grade Ta (LG Ta) stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or solitary high-grade tumor of Ta stage having a diameter of 3 cm or smaller; two or more low-grade tumors of Ta stage; and a low-grade tumor of T1 stage.
[0120] SEQ ID NO: 1 (E2F-1 promoter)
[0121] gggcccaaaattagcaagtgaccacgtggttctgaagccagtggcctaaggaccacccttgcagaaccgtggtctcc ttgtcacagtctaggcagcctctggcttagcctctgtttctttcataacctttctcagcgcctgctctgggccagaccagtgttgggaggag tcgctactgagctcctagattggcaggggaggcagatggagaaaaggagtgtgtgtggtcagcattggagcagaggcagcagtggg caatagaggaagtgagtaaatccttgggagggctccctagaagtgatgtgttttctttttttgttttagagacaggatctcgctctgtcgccc aggctggtgtgcagtggcatgatcatagctcactgcagcctcgacttctcgggctcaagcaatcctcccacctcagcctcccaagtagc tgggactacgggcacacgccaccatgcctggctaatttttgtattttttgtagagatgggtcttcaccatgttgatcaggctggtctcgaac tcctgggctcatgcgatccaccccgccagctgattacagggattccggtggtgagccaccgcgcccagacgccacttcatcgtattgt aaacgtctgttacctttctgttcccctgtctactggactgtgagctccttagggccacgaattgaggatggggcacagagcaagctctcc aaacgtttgttgaatgagtgagggaatgaatgagttcaagcagatgctatacgttggctgttggagattttggctaaaatgggacttgcag gaaagcccgacgtccccctcgccatttccaggcaccgctcttcagcttgggctctgggtgagcgggatagggctgggtgcaggatta ggataatgtcatgggtgaggcaagttgaggatggaagaggtggctgatggctgggctgtggaactgatgatcctgaaaagaagagg ggacagtctctggaaatctaagctgaggctgttgggggctacaggttgagggtcacgtgcagaagagaggctctgttctgaacctgca ctatagaaaggtcagtgggatgcgggagcgtcggggcggggcggggcctatgttcccgtgtccccacgcctccagcaggggacgc ccgggctgggggcggggagtcagaccgcgcctggtaccatccggacaaagcctgcgcgcgccccgccccgccattggccgtacc gccccgcgccgccgccccatcccgcccctcgccgccgggtccggcgcgttaaagccaataggaaccgccgccgttgttcccgtca cggacggggcagccaattgtggcggcgctcggcggctcgtggctctttcgcggcaaaaaggatttggcgcgtaaaagtggccggg actttgcaggcagcggcggccgggggcggagcgggatcgagccctcgccgaggcctgccgccatgggcccgcgccgccgccg ccgcctgtcacccgggccgcgcgggccgtgagcgtcatg
[0122] SEQ ID NO: 2 (E2F-1 promoter fragment)
[0123] catccggacaaagcctgcgcgcgccccgccccgccattggccgtaccgccccgcgccgccgccccatctcgccc ctcgccgccgggtccggcgcgttaaagccaataggaaccgccgccgttgttcccgtcacggccggggcagccaattgtggcggcg ctcggcggctcgtggctctttcgcggcaaaaaggatttggcgcgtaaaagtggccgggactttgcaggcagcggcggccgggggc ggagcgggatcgagccctcg
[0124] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus and a nucleic acid encoding an immune- related molecule (such as cytokine or chemokine) operably linked to a viral promoter. In55MF-363552698Attorney Docket No.: 74444-20008.40 some embodiments, the tumor-specific promoter is an E2F-1 promoter, such as a human E2F- 1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the E2F-1 promoter comprises a functional fragment (e.g., a minimal promoter sequence) derived from SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, the E2F-1 promoter consists of SEQ ID NO:2. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4. In some embodiments, the viral promoter operably linked to the nucleic acid encoding the immune-related molecule is the E3 promoter. In some embodiments, the immune-related molecule is GM-CSF.
[0125] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-selective promoter operably linked to a viral gene essential for replication of the oncolytic virus and a nucleic acid encoding an immune- related molecule (such as cytokine or chemokine) operably linked to a viral promoter. In some embodiments, the tumor- selective promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises a functional fragment (e.g., a minimal promoter sequence) derived from SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, the E2F-1 promoter consists of SEQ ID NO:2. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4. In some embodiments, the viral promoter operably linked to the nucleic acid encoding the immune-related molecule is the E3 promoter. In some embodiments, the immune-related molecule is GM-CSF.
[0126] In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine, for example, GM-CSF), respectively. In some embodiments, the tumor-specific promoter is a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises a functional fragment (e.g., a minimal promoter sequence) derived from SEQ ID NO:1. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, the E2F-1 promoter consists of SEQ ID NO:2.56MF-363552698Attorney Docket No.: 74444-20008.40
[0127] In some embodiments, the oncolytic virus is cretostimogene, an adenovirus serotype 5 which has a human E2F-1 promoter at the Ela gene and a GM-CSF coding sequence at the E3 gene.
[0128] Cretostimogene (also known as CG0070 or cretostimogene grenadenorepvec) is a conditionally replicating oncolytic adenovirus (serotype 5) designed to preferentially replicate in and kill Rb pathway-defective cancer cells. This vector is transcriptionally regulated by a human E2F-1 promoter, which is up-regulated in Rb-pathway-detective tumor cells. In approximately 85% of all cancers, one or more genes of the Rb pathway, such as the tumor suppressor Rb gene, are mutated. In addition to its restricted propagation, cretostimogene also encodes the human cytokine GM-CSF, which is expressed selectively in the infected tumor cells to stimulate immune responses against uninfected distant (such as metastases) and local tumor foci.
[0129] The genomic structure of the oncolytic adenoviral vector cretostimogene is shown schematically in Figure 1. Products of the adenoviral early E1A gene are essential for efficient expression of other regions of the adenoviral genome. Cretostimogene has been engineered to express the El A gene under control of the human E2F-1 promoter, which provides tumor specificity to the El A gene product. To protect from transcriptional read- through activating El A expression, a polyadenylation signal (PA) was inserted 5' of the E2F- 1 promoter. Cretostimogene includes the entire wild type E3 region except for the 19kD- coding region. A direct comparison of E3-containing to E3-deleted oncolytic adenovirus vectors showed superiority of E3 -containing vectors in tumor spread and efficacy. In place of the 19kD gene, cretostimogene carries the cDNA for human GM-CSF under the control of the endogenous E3 promoter (E3P). Since the E3 promoter is in turn activated by El A, both viral replication and GM-CSF expression are ultimately under the control of the E2F-1 promoter. The rest of the viral vector backbone, including the E2, E4, late protein regions and inverted terminal repeats (ITRs), is identical to the wild type Ad5 genome.
[0130] Cretostimogene is manufactured in a human cancer cell line and released from infected cells by detergent lysis. Cretostimogene is purified from the lysate by chromatography, and then formulated in 5% sucrose, 10 mM Tris, 0.05% polysorbate-80, 1 % glycine, 1 mM magnesium chloride, pH 7.8.
[0131] Cretostimogene is supplied as a sterile, slightly opalescent, frozen liquid in stoppered glass vials. The particle concentration per mL (vp / mL) is stated on the Certificate of Analysis for each lot of cretostimogene.57MF-363552698Attorney Docket No.: 74444-20008.40
[0132] Cretostimogene has additional potential anti-tumor activity in that it carries the cDNA for human GM-CSF, a key cytokine for generating long-lasting anti-tumor immunity. Thus, cretostimogene is a selectively replicating oncolytic vector with the potential for attacking the tumor by two mechanisms: direct cytotoxicity as a replicating vector and induction of a host immune response. In vitro and in vivo studies have been conducted to characterize the tumor selectivity and anti-tumor activity and safety of cretostimogene. See, for example, U.S. Patent No. 11,596,660, which incorporated herein by reference in its entirety.
[0133] As used herein, the terms “cretostimogene grenadenorepvec,” “cretostimogene,” and “CG0070” are used interchangeably.
[0134] In some embodiments, the oncolytic virus is administered at a dose of about any one of IxlO5particles, IxlO6particles, IxlO7particles, IxlO8particles, IxlO9particles, IxlO10particles, 2xlO10particles, 5xlO10particles, IxlO11particles, 2xlOnparticles, 5x l()" particles, IxlO12particles, 2xl012particles, 5xl012particles, IxlO13particles, 2xl013particles, 5xl013particles, IxlO14particles, or IxlO15particles. In some embodiments, the oncolytic virus is administered at a dose of any one of about IxlO5particles to about IxlO6particles, about IxlO6particles to about IxlO7particles, about IxlO7particles to about IxlO8particles, about IxlO8particles to about IxlO9particles, about IxlO9particles to about IxlO10particles, about IxlO10particles to about IxlO11particles, about IxlO11particles to about 5xlOnparticles, about 5x I ()" particles to about IxlO12particles, about IxlO12particles to about 2xl012particles, about 2xl012particles to about 5x1012particles, about 5xl012particles to about IxlO13particles, about IxlO13particles to about IxlO14particles, or about IxlO14particles to about IxlO15particles.
[0135] In some embodiments, the oncolytic virus is administered daily. In some embodiments, the oncolytic virus is administered is administered at least about any one of once, twice, 3 times, 4 times, 5 times, 6 times, or 7 times (i.e., daily) a week. In some embodiments, the oncolytic virus is administered weekly. In some embodiments, the oncolytic virus is administered weekly without every week; weekly, two out of three weeks; weekly three out of four weeks; once every two weeks; once every 3 weeks; once every 4 weeks; once every 6 weeks; once every 8 weeks, monthly, or every two to 12 months. In some embodiments, the oncolytic virus is administered once per week for one to six weeks (e.g., once per week for one, two, three, four, five, or six weeks). In some embodiments, the intervals between each administration of the oncolytic virus are less than about any one of 658MF-363552698Attorney Docket No.: 74444-20008.40 months, 3 months, 1 month, 20 days, 15, days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day. In some embodiments, the intervals between each administration of the oncolytic virus are more than about any one of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months. In some embodiments, there is no break in the dosing schedule. In some embodiments, the interval between each administration is no more than about a week.
[0136] The administration of the oncolytic virus can be over an extended period of time, such as from about a month up to about seven years. In some embodiments, the oncolytic virus is administered over a period of at least about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36, 48, 60, 72, or 84 months. In some embodiments, the oncolytic virus is administered over a period of at least 4 weeks or 6 weeks. In some embodiments, the oncolytic virus is administered weekly for four weeks every 3 months. In some embodiments, the oncolytic virus is administered weekly for 6 weeks every 3 months.Immune-Related Molecules
[0137] In some embodiments, provided here are methods comprising administration of a oncolytic virus comprising a viral vector, wherein viral vector comprises an exogenous nucleic acid encoding at least one (for example, 1, 2, 3, 4, 5, or more) heterologous immune- related molecule. In some embodiments, the oncolytic virus comprises a viral vector comprising a heterologous gene encoding an immune-related molecule. In some embodiments, the immune-related molecule enhances an immune response in the individual. In some embodiments, the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa|3. In some embodiments, the immune-related molecule is GM-CSF. In some embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter, such as an El promoter, or an E3 promoter. In some embodiments, the exogenous heterologous gene encoding the immune-related molecule is operably linked to a viral promoter, such as an El promoter, or an E3 promoter.
[0138] Immune-related molecules may include, but are not limited to, a cytokine, a chemokine, a stem cell growth factor, a lymphotoxin, an hematopoietic factor, a colony stimulating factor (CSF), erythropoietin, thrombopoietin, tumor necrosis factor-alpha (TNF), TNF-beta , granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), interferon-alpha, interferon-beta, interferon-gamma, interferon-59MF-363552698Attorney Docket No.: 74444-20008.40 lambda, stem cell growth factor designated "SI factor", human growth hormone, N- methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prorelaxin, follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), luteinizing hormone (LH), hepatic growth factor, prostaglandin, fibroblast growth factor, prolactin, placental lactogen, OB protein, mullerian-inhibiting substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular endothelial growth factor, integrin, NGF-beta , platelet-growth factor, TGF-alpha , TGF-beta , insulinlike growth factor-I, insulin-like growth factor-II, macrophage-CSF (M-CSF), IL-1, IL- la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL-25, LIF, FLT-3, angiostatin, thrombospondin, endostatin, lymphotoxin, thalidomide, lenalidomide, and pomalidomide. The immune-related molecule can be of any one of the molecular modalities known in the art, including, but not limited to, aptamer, mRNA, siRNA, microRNA, shRNA, peptide, antibody, anticalin, Spherical nucleic acid, TALEN, Zinc Finger Nuclease, CRISPR / Cas9, and small molecule.Immunomodulators
[0139] In some embodiments, the methods described herein comprise administration of an effective amount of an immunomodulator, or a combination of immunomodulators. In some embodiments, the immunomodulator is an immune checkpoint inhibitor. In some embodiments, the immunomodulator is an immune-stimulating agent. In some embodiments, the method comprises administration of a combination of immunomodulators comprising one or more immune checkpoint inhibitors and / or one or more immune-stimulating agents (such as at least two immune checkpoint inhibitors, at least two immune-stimulating agents, or a combination of at least one immune checkpoint inhibitor and at least one immune-stimulating agent). In some embodiments, the immunomodulator (including combination of immunomodulators) is administered systemically (e.g, intravenously). In some embodiments, the immunomodulator (including combination of immunomodulators) is administered locally to the site of the tumor. In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, the immunomodulator (including combination of immunomodulators) is administered intravesically. In some embodiments the method comprises administration of two or more immunomodulators, any combination of administration routes may be used to administer the two or more immunomodulators (such as at least two locally-administered immunomodulators, at least two systemically-administered60MF-363552698Attorney Docket No.: 74444-20008.40 immunomodulators, or a combination of at least one locally-administered immunomodulator and at least one systemically-administered immunomodulator).
[0140] “Immunomodulator” refers to an agent that when present, alters, suppresses or stimulates the body's immune system. Immunomodulators can target specific molecules, such as the checkpoint molecules, or non-specifically modulate the immune response.Immunomodulators can include compositions or formulations that activate the immune system (e.g, adjuvants or activators), or downregulate the immune system. Adjuvants can include aluminum-based compositions, as well as compositions that include bacterial or mycobacterial cell wall components. Activators can include molecules that activate antigen presenting cells to stimulate the cellular immune response. For example, activators can be immunostimulant peptides. Activators can include, but are not limited to, agonists of toll-like receptors TLR-2, 3, 4, 6, 7, 8, or 9, granulocyte macrophage colony stimulating factor (GM- CSF); TNF; CD40L; CD28; FLT-3 ligand; or cytokines such as IL-1, IL-2, IL-4, IL-7, IL-12, IL-15, or IL-21. Activators can include agonists of activating receptors (including costimulatory receptors) on T cells, such as an agonist (e.g, agonistic antibody) of CD28, 0X40, GITR, CD137, CD27, CD40, or HVEM. Activators can also include compounds that inhibit the activity of an immune suppressor, such as an inhibitor of the immune suppressors IL-10, IL-35, TGF-P, IDO, or cyclophosphamide, or inhibit the activity of an immune checkpoint such as an antagonist (e.g, antagonistic antibody) of CTLA-4, PD-1, PD-L1, PD- L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3. Activators can also include costimulatory molecules such as CD40, CD80, or CD86. Immunomodulators can also include agents that downregulate the immune system such as antibodies against IL-12p70, antagonists of toll-like receptors TLR-2, 3, 4, 5, 6, 8, or 9, or general suppressors of immune function such as cyclophosphamide, cyclosporin A or FK506. These agents (e.g, adjuvants, activators, or downregulators) can be combined to achieve an optimal immune response.
[0141] Immunomodulators of particular interest in the present invention include immune- stimulating agents and immune checkpoint inhibitors. As used herein, the term "immune checkpoint inhibitors," "checkpoint inhibitors," and the like refers to compounds that inhibit the activity of control mechanisms of the immune system. Immune system checkpoints, or immune checkpoints, are inhibitory pathways in the immune system that generally act to maintain self-tolerance or modulate the duration and amplitude of physiological immune responses to minimize collateral tissue damage. Checkpoint inhibitors can inhibit an immune system checkpoint by stimulating the activity of a stimulatory checkpoint molecule, or61MF-363552698Attorney Docket No.: 74444-20008.40 inhibiting the activity of an inhibitory checkpoint molecule in the pathway. Stimulatory checkpoint molecules are molecules, such as proteins, that stimulate or positively regulate the immune system. Inhibitory checkpoint molecules are molecules, such as proteins, that inhibit or negatively regulate the immune system. Immune system checkpoint molecules include, but are not limited to, cytotoxic T-lymphocyte antigen 4 (CTLA-4), programmed cell death 1 protein (PD-1), programmed cell death 1 ligand 1 (PD-L1), programmed cell death 1 ligand 2 (PD-L2), lymphocyte activation gene 3 (LAG3), B7-1, B7-H3, B7-H4, T cell membrane protein 3 (TIM3), B- and T-lymphocyte attenuator (BTLA), V-domain immunoglobulin (Ig)- containing suppressor of T-cell activation (VISTA), Killer-cell immunoglobulin-like receptor (KIR), and A2A adenosine receptor (A2aR). As such, checkpoint inhibitors include antagonists of CTLA-4, PD-1, PD-L1, PD-L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3. For example, antibodies that bind to CTLA-4, PD-1, PD-L1, PD-L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3 and antagonize their function are checkpoint inhibitors. Moreover, any molecule (e.g, peptide, nucleic acid, small molecule, etc.) that inhibits the inhibitory function of an immune system checkpoint is a checkpoint inhibitor.
[0142] The immunomodulators discussed herein include both immune-stimulating agents and immune checkpoint inhibitors. The immunomodulator can be of any one of the molecular modalities known in the art, including, but not limited to, aptamer, mRNA, siRNA, microRNA, shRNA, peptide, antibody, anticalin, Spherical nucleic acid, TALEN, Zinc Finger Nuclease, CRISPR / Cas9, and small molecule.
[0143] In some embodiments, the immunomodulator is an immune-stimulating agent. In some embodiments, the immune-stimulating agent is a natural or engineered ligand of an immune stimulatory molecule, including, for example, ligands of 0X40 (e.g, OX40L), ligands of CD-28 (e.g, CD80, CD86), ligands of ICOS (e.g, B7RP1), ligands of 4-1BB (e.g, 4-1BBL, Ultra4-1BBL), ligands of CD27 (e.g, CD70), ligands of CD40 (e.g, CD40L), and ligands of TCR (e.g, MHC class I or class II molecules, IMCgplOO). In some embodiments, the immune-stimulating agent is an antibody selected from the group consisting of anti-CD28 (e.g, TGN-1412), anti-OX40 (e.g, MEDI6469, MEDI-0562), anti-ICOS (e.g, MEDI-570), anti-GITR (e.g, TRX518, INBRX-110, NOV-120301), anti-41-BB (e.g, BMS-663513, PF- 05082566), anti-CD27 (e.g, BION-1402, Varlilumab and hCD27.15), anti-CD40 (e.g, CP870,893, BI-655064, BMS-986090, APX005, APX005M), anti-CD3 (e.g, blinatumomab, muromonab), and anti-HVEM. In some embodiments, the antibody is an agonistic antibody.62MF-363552698Attorney Docket No.: 74444-20008.40In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is an agonistic antibody. In some embodiments, the antibody is a polyclonal antibody. In some embodiments, the antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full length antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof.
[0144] In some embodiments, the immune-stimulating agent is an activator of CD40. In some embodiments, the activator of CD40 is an agonistic anti-CD40 antibody. Any of the known anti-CD40 antibodies may be used in the present invention, including, but not limited to, CP-870,893, Dacetuzumab (also known as SGN-40), ChiLob 7 / 4, APX005, and APX005M, BI-655064, and BMS-986090. In some embodiments, the agonistic anti-CD40 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the agonistic anti-CD40 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full-length anti-CD40 antibody. In some embodiments, the agonistic anti-CD40 antibody is a human, humanized, or chimeric antibody. In some embodiments, the agonistic anti-CD40 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the activator of CD40 is a natural or engineered CD40 ligand, such as CD40L. In some embodiments, the activator of CD40 is an inhibitor of the interaction between CD40 and CD40L. In some embodiments, the activator of CD40 increases the signaling of CD40. In some embodiments, the activator of 0X40 is an agnostic anti-OX40 antibody, for example, MEDI6469, MEDI0562, MEDI6383, GSK3174998, KHK4083 or InVivoMAb clone OX-86.
[0145] In some embodiments, the immunomodulator is an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is a natural or engineered ligand of an inhibitory immune checkpoint molecule, including, for example, ligands of CTLA-4 (e.g, B7.1, B7.2), ligands of TIM3 (e.g, Galectin-9), ligands of A2a Receptor (e.g, adenosine, Regadenoson), ligands of LAG3 (e.g, MHC class I or MHC class II molecules), ligands of BTLA (e.g, HVEM, B7-H4), ligands of KIR (e.g, MHC class I or MHC class II molecules), ligands of PD-1 (e.g, PD-L1, PD-L2), ligands of IDO (e.g, NKTR-218, Indoximod, NLG919), ligands of CD47 (e.g., SIRP-alpha receptor), and ligands of CSF1R. In some63MF-363552698Attorney Docket No.: 74444-20008.40 embodiments, the immune checkpoint inhibitor is an antibody that targets an inhibitory immune checkpoint protein. In some embodiments, the immunomodulator is an antibody selected from the group consisting of anti-CTLA-4 (e.g, Ipilimumab, Tremelimumab, KAHR-102), anti-TIM3 (e.g, F38-2E2, ENUM005), anti-LAG3 (e.g, BMS-986016, IMP701, IMP321, C9B7W), anti-KIR (e.g, Lirilumab, IPH2101, IPH4102), anti-PD-1 (e.g, Nivolumab, Pidilizumab, Pembrolizumab, BMS-936559, atezolizumab, Lambrolizumab, MK-3475, AMP-224, AMP-514, STI-A1110, TSR-042), anti-PD-Ll (e.g, KY-1003 (EP20120194977), MCLA-145, atezolizumab, BMS-936559, MEDI-4736, MSB0010718C, AUR-012, STI-A1010, PCT / US2001 / 020964, MPDL3280A, AMP-224, Dapirolizumab pegol (CDP-7657), MEDI-4920), anti-CD73 (e.g, AR-42 (OSU-HDAC42,HDAC- 42,AR42,AR 42,OSU-HDAC 42, OSU-HD AC-42, NSC D736012,HDAC-42,HDAC 42,HDAC42,NSCD736012,NSC-D736012), MEDI-9447), anti-B7-H3 (e.g, MGA271, DS- 5573a, 8H9), anti-CD47 (e.g, CC-90002, TTI-621, VLST-007), anti-BTLA, anti-VISTA, anti-A2aR, anti-B7-l, anti-B7-H4, anti-CD52 (such as alemtuzumab), anti-IL-10, anti-IL-35, anti-TGF-P (such as Fresolumimab), anti-CSFIR (e.g, FPA008), anti-NKG2A (e.g, monalizumab), anti-MICA (e.g, IPH43), and anti-CD39. In some embodiments, the antibody is an antagonistic antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a polyclonal antibody. In some embodiments, the antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full length antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof.
[0146] In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1. In some embodiments, the inhibitor of PD-1 is an anti-PD-1 antibody. Any of the anti-PD-1 antibodies known in the art may be used in the present invention, including, but not limited to, Nivolumab, pembrolizumab, pidilizumab, BMS-936559, and atezolizumab, Lambrolizumab, MK-3475, AMP-224, AMP-514, STI-All 10, and TSR-042. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti-PD-1 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full-length anti-PD-1 antibody. In some embodiments, the anti-PD-1 antibody is a human,64MF-363552698Attorney Docket No.: 74444-20008.40 humanized, or chimeric antibody. In some embodiments, the anti-PD-1 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the inhibitor of PD-1 is a natural or engineered ligand of PD-1, such as PD-L1 or PD-L2. In some embodiments, the inhibitor of PD-1 is an inhibitor of the interaction between PD-1 and its ligand, for example, an inhibitor of PD-1 / PD-L1 interaction or an inhibitor of PD-1 / PD-L2 interaction. In some embodiments, the inhibitor of PD-1 is an inhibitor of a PD-1 ligand, such as an inhibitor of PD-L1 (e.g, anti-PD-Ll antibody) or an inhibitor of PD-L2 (e.g., anti-PD-L2 antibody). Any of the inhibitors of interaction between PD-1 and its ligand may be used in the present invention, see, for example, U.S. Patent No. US7709214, US7432059, US7722868, US8217149, US8383796, and US9102725. In some embodiments, the inhibitor of PD-1 is an Fc fusion protein comprising a PD-1 ligand, such as an Fc-fusion of PD-L2 (e.g, AMP-224).
[0147] In some embodiments, the immune checkpoint inhibitor is an inhibitor of a PD-1 ligand (e.g, PD-L1 and / or PD-L2). In some embodiments, the inhibitor of PD-1 ligand is an anti-PD-Ll antibody. Exemplary anti-PD-Ll antibodies include, but are not limited to, KY- 1003, MCLA-145, RG7446 (also known as atezolizumab), BMS935559 (also known as MDX-1105), MPDL3280A, MEDI4736, Avelumab (also known as MSB0010718C), and STI-A1010. In some embodiments, the inhibitor of PD-1 ligand is an anti-PD-L2 antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 is an antigenbinding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full-length anti-PD-Ll or anti-PD-L2 antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 antibody is a human, humanized, or chimeric antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the inhibitor of PD-1 ligand is an inhibitor (e.g, peptide, protein or small molecule) of both PD-L1 and PD-L2. Exemplary inhibitors of both PD-L1 and PD-L2 include, but are not limited to, AUR-012, and AMP-224. In some embodiments, the inhibitor of PD-L1 and the inhibitor of PD-L2 can be used interchangeably in any of the methods of treatment described herein.65MF-363552698Attorney Docket No.: 74444-20008.40
[0148] In some embodiments, the immune checkpoint inhibitor is an inhibitor of CTLA- 4. In some embodiments, the inhibitor of CTLA-4 is an anti-CTLA-4 antibody. Any of the anti-CTLA-4 antibodies that are known in the art may be used in the present invention, including, but not limited to, Ipilimumab, Tremelimumab, and KAHR-102. In some embodiments, the anti-CTLA-4 antibody is YERVOY® (Ipilimumab). In some embodiments, the anti-CTLA-4 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti-CTLA-4 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full length anti-CTLA-4 antibody. In some embodiments, the anti- CTLA-4 antibody is a human, humanized, or chimeric antibody. In some embodiments, the anti-CTLA-4 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof. In some embodiments, the inhibitor of CTLA-4 is an engineered lipocalin protein specifically recognizing CTLA-4 (such as an anticalin molecule that specifically binds to CTLA-4). In some embodiments, the inhibitor of CTLA-4 is a natural or engineered ligand of CTLA-4, such as B7.1 or B7.2.
[0149] The immunomodulators can be used singly or in combination. For example, any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors can be used simultaneously or sequentially, or any number (such as any of 2, 3, 4, 5, 6, or more) of immune-stimulating agents can be used simultaneously or sequentially. Alternatively, any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors in combination with any number (such as any of 2, 3, 4, 5, 6, or more) of immune-stimulating agents can be used simultaneously or sequentially. Sequential administration of immunomodulators can be separated by hours, days or weeks. The administration route(s) for two or more immunomodulators can be the same or different. For example, one immunomodulator can be administered intratumorally, and a second immunomodulator can be administered intravenously; or two immunomodulators can be administered both intratumorally.
[0150] In some embodiments, the method comprises administration of a single immunomodulator. In some embodiments, the immunomodulator is an immune checkpoint inhibitor. In some embodiments, the immunomodulator is an immune-stimulating agent. In some embodiments, the immunomodulator is selected from the immunomodulators listed in Table 1, wherein the immunomodulator is administered with the same route of66MF-363552698Attorney Docket No.: 74444-20008.40 administration, and / or dose, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1. In some embodiments, the immunomodulator is selected from the immunomodulators listed in Table 1, wherein the immunomodulator is administered with the different route of administration, and / or dose, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1. In some embodiments, the immunomodulator is not a molecule selected from Table 1. In some embodiments, the single immunomodulator is administered systemically (e.g, intravenously). In other embodiments, the single immunomodulator is administered locally to the site of the tumor (e.g, intratumorally). In some embodiments wherein the solid or lymphatic tumor is bladder cancer, the single immunomodulator is administered intravesically.
[0151] In some embodiments, the method comprises administration of at least two (such as any of 2, 3, 4, 5, 6, or more) immunomodulators. In some embodiments, all or part of the at least two or more immunomodulators are administered simultaneously, such as in a single composition. In some embodiments, all or part of the at least two immunomodulators are administered sequentially. In some embodiments, all or part of the at least two or more immunomodulators are administered systemically (e.g, intravenously). In some embodiments, all or part of the at least two immunomodulators are administered locally to the site of the tumor (e.g, intratumorally). In some embodiments, one or more of the immunomodulators are administered systemically (e.g, intravenously) and one or more of the immunomodulators are administered locally to the site of the tumor (e.g, intratumorally). In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, all or part of the at least two or more immunomodulators are administered intravesically. In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, one or more of the immunomodulators are administered intravesically and one or more of the immunomodulators are administered systemically (e.g, intravenously). In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, one or more of the immunomodulators are administered intravesically, one or more of the immunomodulators are administered systemically (e.g, intravenously), and one or more of the immunomodulators are administered intratumorally.
[0152] In some embodiments, the method comprises administration of a combination of immunomodulators comprising an immune checkpoint inhibitor and an immune-stimulating agent. In some embodiments, the method comprises administration of a combination of immunomodulators comprising two or more (such as any of 2, 3, 4, 5, 6, or more) checkpoint67MF-363552698Attorney Docket No.: 74444-20008.40 inhibitors. In some embodiments, the method comprises administration of a combination of immunomodulators comprising two or more (such as any of 2, 3, 4, 5, 6, or more) immune- stimulating agents. In some embodiments, the method comprises administration of a combination of immunomodulators comprising any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors and any number (such as any of 2, 3, 4, 5, 6, or more) of immune-stimulating agents. In some embodiments, the at least two immunomodulators comprise one or more immunomodulators selected from Table 1.
[0153] In some embodiments, the method comprises administering a first immunomodulator and a second immunomodulator. In some embodiments, the first immunomodulator and the second immunomodulator have the same target. In some embodiments, the first immunomodulator and the second immunomodulator are the same immunomodulator molecule. In some embodiments, the first immunomodulator and the second immunomodulator have the same target, but are of different modalities. In some embodiments, the first immunomodulator and the second immunomodulator are different immunomodulator molecules. In some embodiments, the first immunomodulator and the second immunomodulator do not have the same target. In some embodiments, the first immunomodulator is an immune checkpoint inhibitor, and the second immunomodulator is an immune-stimulating agent. In some embodiments, the first immunomodulator is an immune checkpoint inhibitor, and the second immunomodulator is an immune checkpoint inhibitor. In some embodiments, the first immunomodulator is an immune-stimulating agent, and the second immunomodulator is an immune-stimulating agent. In some embodiments, the first immunomodulator is an immune-stimulating agent, and the second immunomodulator is an immune checkpoint inhibitor.
[0154] The administration of the first and second immunomodulators can be of any sequence, including simultaneous administration of the first immunomodulator and the second immunomodulator and sequential administration of the first and second immunomodulators. Additionally, the administration of the first and second immunomodulators can be of any combination of administration routes, including administering the first and second immunomodulators by the same route, and administering the first and second immunomodulators by different routes. For Example, in some embodiments, the first immunomodulator is administered locally to the site of the tumor (e.g., intratumorally) and the second immunomodulator is administered systemically (e.g., intravenously). In other embodiments, the first and second immunomodulators are68MF-363552698Attorney Docket No.: 74444-20008.40 administered locally to the site of the tumor (e.g., intratumorally). In other embodiments, the first and second immunomodulators are administered systemically (e.g, intravenously). In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, the first immunomodulator is administered intravesically and the second immunomodulator is administered systemically (e.g, intravenously). In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, the first immunomodulator is administered intravesically and the second immunomodulator is administered intratumorally. In certain embodiments wherein the solid or lymphatic tumor is bladder cancer, the first and second immunomodulators are administered intravesically. Any combination of administration routes and sequences may be used in the methods disclosed herein. For example, in some embodiments, the method comprises first administering the second immunomodulator locally to the site of the tumor (e.g., intratumorally or intravesically) followed by administering the first immunomodulator systemically (e.g., intravenously). In other embodiments, the method comprises first administering the first immunomodulator systemically (e.g, intravenously) followed by administering the second immunomodulator locally to the site of the tumor (e.g., intratumorally or intravesically). Immunomodulators administered simultaneously via the same administration route may be administered as a single composition. For example, the immunomodulators can be admixed prior to (such as immediately prior to, e.g, within less than about 10, 5, or 1 minutes before) the administration of the single composition.
[0155] Suitable dosages for each immunomodulator depend on factors such as the nature of the immunomodulator or combination of immunomodulators, type of the solid or lymphatic tumor being treated, and the routes of administration. Exemplary doses of each immunomodulator include, but are not limited to, about any one of 1 mg / m2, 5 mg / m2, 10 mg / m2, 20 mg / m2, 50 mg / m2, 100 mg / m2, 200 mg / m2, 300 mg / m2, 400 mg / m2, 500 mg / m2, 750 mg / m2, 1000 mg / m2, or more. In some embodiments, the dose of each immunomodulator independently is included in any one of the following ranges: about 1 to about 5 mg / m2, about 5 to about 10 mg / m2, about 10 to about 20 mg / m2, about 20 to about 50 mg / m2, about 50 to about 100 mg / m2, about 100 mg / m2 to about 200 mg / m2, about 200 to about 300 mg / m2, about 300 to about 400 mg / m2, about 400 to about 500 mg / m2, about 500 to about 750 mg / m2, or about 750 to about 1000 mg / m2. In some embodiments, the dose of each immunomodulator is independently about any one of 1 pg / kg, 2 pg / kg, 5 pg / kg, 10 pg / kg, 20 pg / kg, 50 pg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 5 mg / kg, 10 mg / kg, 20 mg / kg, 50 mg / kg, 100 mg / kg, or more. In some embodiments, the69MF-363552698Attorney Docket No.: 74444-20008.40 dose of each immunomodulator is independently any one of about 1 pg / kg to about 5 pg / kg, about 5 pg / kg to about 10 pg / kg, about 10 pg / kg to about 50 pg / kg, about 50 pg / kg to about 0.1 mg / kg, about 0.1 mg / kg to about 0.2 mg / kg, about 0.2 mg / kg to about 0.3 mg / kg, about 0.3 mg / kg to about 0.4 mg / kg, about 0.4 mg / kg to about 0.5 mg / kg, about 0.5 mg / kg to about 1 mg / kg, about 1 mg / kg to about 5 mg / kg, about 5 mg / kg to about 10 mg / kg, about 10 mg / kg to about 20 mg / kg, about 20 mg / kg to about 50 mg / kg, about 50 mg / kg to about 100 mg / kg, or about 1 mg / kg to about 100 mg / kg. In some embodiments, the dose of each immunomodulator is independently about any one of 1 pg, 10 pg, 50 pg, 100 pg, 500 pg, 1 mg, 2 mg, 4 mg, 6 mg, 12 mg, 18 mg, 24 mg, 50 mg, 100 mg, 500 mg or 1000 mg. In some embodiments, the dose of each immunomodulator is independently any one of about 1 pg to about 10 pg, about 10 pg to about 50 pg, about 50 pg to about 100 pg, about 100 pg to about 500 pg, about 500 pg to about 1 mg, about 1 mg to about 5 mg, about 5 mg to about 10 mg, about 10 mg to about 25 mg, about 25 mg to about 50 mg, about 50 mg to about 100 mg, about 100 mg to about 500 mg, about 500 mg to about 1000 mg, about 1 pg to about 1 mg, about 1 mg to about 1000 mg, or about 1 pg to about 1000 mg.
[0156] When administered locally to the tumor site, in some embodiments, the dose of each immunomodulator administered per tumor site is independently no more than about any of 10 pg, 50 pg, 100 pg, 500 pg, 1 mg, 2 mg, 4 mg, 6 mg, 12 mg, 18 mg, 24 mg, 50 mg, or 100 mg. In some embodiments, the dose of the each immunomodulator administered locally per tumor site is independently any one of about 10 pg to about 50 pg, about 50 pg to about 100 pg, about 100 pg to about 500 pg, about 100 pg to about 1 mg, about 1 mg to about 2 mg, about 2 mg to about 5 mg, about 5 mg to about 10 mg, about 10 mg to about 15 mg, about 10 mg to about 25 mg, about 25 mg to about 50 mg, about 50 mg to about 100 mg, about 1 mg to about 50 mg, or about 100 pg to about 10 mg. In some embodiments, the dose of each immunomodulator administered locally per tumor site is based on the size of the tumor.
[0157] In some embodiments, the immunomodulator (including one or more of a combination of immunomodulators) is administered daily. In some embodiments, the immunomodulator (including one or more of a combination of immunomodulators) is administered is administered at least about any one of once, twice, 3 times, 4 times, 5 times, 6 times, or 7 times (i.e., daily) a week. In some embodiments, the immunomodulator (including one or more of a combination of immunomodulators) is administered weekly without break; weekly two out of three weeks; weekly three out of four weeks; once every two weeks; once70MF-363552698Attorney Docket No.: 74444-20008.40 every 3 weeks; once every 4 weeks; once every 6 weeks; once every 8 weeks, monthly, or every two to 12 months. In some embodiments, the intervals between each administration of the immunomodulator (including one or more of a combination of immunomodulators) are less than about any one of 6 months, 3 months, 1 month, 20 days, 15, days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day. In some embodiments, the intervals between each administration of the immunomodulator (including one or more of a combination of immunomodulators) are more than about any one of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months. In some embodiments, there is no break in the dosing schedule of the immunomodulator (including one or more of a combination of immunomodulators). In some embodiments, the interval between each administration of the immunomodulator (including one or more of a combination of immunomodulators) is no more than about a week. In some embodiments, the immunomodulator (including one or more of a combination of immunomodulators) is administered with the same dosing schedule as the oncolytic virus. In some embodiments, the immunomodulator (including one or more of a combination of immunomodulators) is administered with a different dosing schedule as the oncolytic virus.
[0158] The administration of the each immunomodulator can be over an extended period of time, such as from about a month up to about seven years. In some embodiments, each immunomodulator is independently administered over a period of at least about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36, 48, 60, 72, or 84 months. In some embodiments, the combination of immunomodulators is administered over a period of at least about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36, 48, 60, 72, or 84 months. In some embodiments, each immunomodulator, or the combination of immunomodulators, is administered over a period of at least 3 weeks or 6 weeks.
[0159] Exemplary immune checkpoint molecules and immunomodulators thereof are discussed below. It is understood that other suitable immune checkpoint molecules and immunomodulators known in the art are also within the scope of the present application.CTLA-4
[0160] CTLA-4 is an immune checkpoint molecule, which is up-regulated on activated T- cells. An anti-CTLA-4 mAb can block the interaction of CTLA-4 with CD80 / 86 and switch off the mechanism of immune suppression and enable continuous stimulation of T-cells by DCs. Examples of anti-CTLA-4 antibodies are Ipilimumab (see U.S. Patent Nos. 6,984,720, 7,452,535, 7,605,238, 8,017,114 and 8,142,778), Tremilimumab (see U.S. Patent No.71MF-363552698Attorney Docket No.: 74444-20008.406,68,736, 7,109,003, 7,132,281, 7,411,057, 7,807,797, 7,824,679 and 8,143,379) and other anti-CTLA-4 antibodies, including single chain antibodies (e.g, see U.S. Patent Nos. 5,811,097, 6051,227 and 7,229,628, and US Patent Publication No. US20110044953).
[0161] Two IgG mAb directed against CTLA-4, Ipilimumab and Tremelimumab, have been tested in clinical trials for a number of indications. Ipilimumab is approved by the FDA for the treatment of melanoma, e.g, for late stage melanoma patients. The complete prescribing information is fully described in the packaging insert of YERVOY® (Bristol Meyers). YERVOY® (Ipilimumab) comes in 50mg single use vials.
[0162] Anticalins are engineered proteins that are able to recognize and bind specific targets with high affinity. They are antibody mimetics, but they are not structurally related to antibodies. Instead, they are derived from human lipocalins, which are a family of naturally binding proteins. Anticalins are being used in lieu of monoclonal antibodies, but are about eight times smaller than monoclonal antibodies with a size of about 180 amino acids and a mass of about 20 kDa. Anticalins have been described in U.S. Patent No. 7,250, 297.Anticalins that bind CTLA-4 with high affinity and specificity have been developed, which are described in, for example, International Patent Application Publication No.WO2012072806. Any of the CTLA-4-binding anticalins may be used in the present application. In some embodiments, the CTLA-4 binding anticalin is PRS-010 (Piers AG).PD-1
[0163] PD-1 is a part of the B7 / CD28 family of co-stimulatory molecules that regulate T- cell activation and tolerance, and thus antagonistic anti-PD-1 antibodies can be useful for overcoming tolerance. PD-1 has been defined as a receptor for B7-4. B7-4 can inhibit immune cell activation upon binding to an inhibitory receptor on an immune cell.Engagement of the PD-1 / PD-L1 pathway results in inhibition of T-cell effector function, cytokine secretion and proliferation. (Tumis et al., Oncolmmunology 1(7): 1172-1174, 2012). High levels of PD-1 are associated with exhausted or chronically stimulated T cells.Moreover, increased PD-1 expression correlates with reduced survival in cancer patients.
[0164] Agents for down modulating PD-1, B7-4, and the interaction between B7-4 and PD-1 inhibitory signal in an immune cell resulting in enhancement of the immune response. Any of the anti-PD-1 antibodies known in the art may be used in the present invention, for example, see US Patent Nos. US7101550, US5698520, US6808710, US7029674, US7794710, US7892540, US8008449, US8088905, US8163503, US8168757, US8354509, US8460927, US8609089, US8747833, US8779105, US8900587, US8952136, US8981063,72MF-363552698Attorney Docket No.: 74444-20008.40US8993731, US9062112, US9067999, US9073994, US9084776, US9102728, and US7488802; and U.S. Patent Publication Nos. US20020055139, US20140044738. For example, Nivolumab is a human mAb to PD-1 that is FDA approved for the treatment of unresectable or metastatic melanoma, as well as squamous non-small cell lung cancer. Another example is pembrolizumab, a humanized antibody that is FDA approved for any unresectable or metastatic solid tumor with certain genetic anomalies (such as mismatch repair deficiency or microsatellite instability). Another exemplary anti -PD-1 antibody is cemiplimab, which has been approved for metastatic cutaneous squamous cell carcinoma (CSCC) or locally advanced CSCC who are not candidates for curative surgery or curative radiation, advanced basal cell carcinoma, and first-line advanced non-small cell lung cancer with PD-L1 Expression of > 50%. Another examplary anti-PD-1 antibody is dostarlimab, which has been approved for recurrent or advanced dMMR endometrial cancer, adult patients with Mismatch Repair-Deficient (dMMR) recurrent or advanced solid tumors.PD-L1 / PD-L2
[0165] PD-L1 (Programmed cell death-ligand 1) is also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1). PD-L1 serves as a ligand for PD-1 to play a major role in suppressing the immune system during particular events such as pregnancy, tissue allographs, autoimmune disease and other disease states such as hepatitis and cancer. The formation of PD-1 receptor / PD-Ll ligand complex transmits an inhibitory signal which reduces the proliferation of CD8+ T cells at the lymph nodes.
[0166] Any of the known anti-PD-Ll antibodies may be used in the present invention, see, for example, U.S. Patent Nos. US7943743, US7722868, US8217149, US8383796, US8552154, and US9102725; and U.S. Patent Application Publication Nos. US20140341917, and US20150203580; and International Patent Application No. PCT / US2001 / 020964. For example, anti-PD-Ll antibodies that are in clinical development include BMS935559 (also known as MDX-1105), MPDL3280A, durvalumab (also known as MEDI4736), Avelumab (also known as MSB0010718C), KY-1003, MCLA-145, RG7446 (also known as atezolizumab), and STI -Al 010.
[0167] PD-L2 (Programmed cell death 1 ligand 2) is also known as B7-DC. PD-L2 serves as a ligand for PD-1. Under certain circumstances, PD-L2 and its inhibitor can be used as a substitute for PD-L1 and its inhibitor respectively.CD4073MF-363552698Attorney Docket No.: 74444-20008.40
[0168] CD40 (Cluster of differentiation 40) is a co-stimulatory protein found on antigen presenting cells and is required for their activation. Binding of CD40L (CD 154) on Tn cells to CD40 activates antigen presenting cells and incudes a variety of downstream effects to stimulate immune response.
[0169] Agents that stimulate the activity of CD40 is useful as an immune-stimulating agent. Any of the known agonistic anti-CD40 antibodies may be used in the present invention, see, for example, U.S. Pat. Nos. US5786456, US5674492, US5182368, US5801227, US7824683, US6843989, US7618633, US7537763, US5677165, US5874082, US6051228, US6312693, US6315998, US6413514, US6838261, US6843989, US6946129, US7063845, US7172759, US7193064, US7288251, US7338660, US7547438, US7563442, US7626012, US8778345; and U.S. Pat. Publication Nos. US 2003059427, US 20020142358, and US20050136055; International Pat. Publication Nos. WO 02 / 088186, WO 01 / 56603, WO 88 / 06891, WO 94 / 04570, and WO05 / 63289; Schlossman et al., Leukocyte Typing, 1995, 1:547-556; and Paulie et al., 1984, Cancer Immunol. Immunother. 17: 165-179. For example, agonistic anti-CD40 antibodies that are in clinical development include CP-870,893, Dacetuzumab (also known as SGN-40), and ChiLob 7 / 4 or APX005M.0X40
[0170] 0X40, also known as CD134 and TNFRSF4, is a member of the TNFR- superfamily of receptors. 0X40 is a co-stimulatory immune checkpoint molecule, expressed after 24 to 72 hours following activation of the T cells. The interaction of OX40L and 0X40 will sustain T cell proliferation and immune response and memory beyond the first two days. Methods for enhancing the immune response to a tumor antigen by engaging the 0X40 receptor on the surface of T-cells by an 0X40 receptor binding agent, OX40L or an 0X40 agonist during or shortly after priming of the T-cells by the antigen can be used in CLIVS as an immune checkpoint inhibitor.LAG-3
[0171] The use of LAG-3 (Lymphocyte Activating Gene-3), and in a more general way, the use of MHC class II ligands or MHC class Il-like ligands as adjuvants for vaccines, in order to boost an antigen specific immune response has been successful in pre-clinical models. Antibodies or agents directed against or modulate LAG-3 gene products may be helpful in the present invention. See US patent 5773578, cited and referenced patents for details of LAG-3 related patents and claims.74MF-363552698Attorney Docket No.: 74444-20008.40
[0172] Table 1 below summarizes examples of commercially available immunomodulators administered via systemic routes that have been approved by the FDA or are involved in clinical trial studies. Any of the immunomodulators in Table 1 may be used as the first, second, or third immunomodulator in any of the methods described herein, using the same or different administration routes, and / or dosages, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1.Table 1. Examples of Systemic Administration of Exemplary Immunomodulators75MF-363552698Attorney Docket No.: 74444-20008.40Combination Therapies
[0173] In some embodiments, provided herein are methods of treating a solid or lymphatic tumor comprising administering an effective amount of an oncolytic virus and an effective amount of one or more immunomodulators. The oncolytic virus and immunomodulators may be administered in a variety of ways, such as simultaneous or sequential administration schedules and local or systemic administration routes.
[0174] In some embodiments, the oncolytic virus and the immunomodulator (or combination of immunomodulators) discussed above are administered sequentially, i.e., the administration of the oncolytic virus is administered before or after the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered prior to the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered no more than about any of 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, or 24 hours prior to the76MF-363552698Attorney Docket No.: 74444-20008.40 administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered about days or weeks (such as about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or more) prior to the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered after the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered no more than about any of 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, or 24 hours after the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered about days or weeks (such as about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or more) after the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus and the immunomodulator (or one or more of a combination of immunomodulators) are administered with one immediately after another (e.g, within 5 minutes or less between the two administrations). For example, in some embodiments, the oncolytic virus is administered immediately before the administration of the immunomodulator (or one or more of a combination of immunomodulators). In some embodiments, the oncolytic virus is administered immediately after the administration of the immunomodulator (or one or more of a combination of immunomodulators).
[0175] In some embodiments, the oncolytic virus and the immunomodulator (or one or more of a combination of immunomodulators) are administered simultaneously. In some embodiments, the oncolytic virus and the immunomodulator (or one or more of a combination of immunomodulators) are administered simultaneously via separate compositions. In some embodiments, the oncolytic virus and the immunomodulator (or one or more of a combination of immunomodulators) are admixed and administered simultaneously via a single composition.
[0176] In some embodiments, the oncolytic virus is administered locally to the site of the tumor (e.g, intratumorally or to the tissue having the tumor) and the immunomodulator (or one or more of a combination of immunomodulators) is administered systemically (e.g, intravenously). In some embodiments, the oncolytic virus is administered locally to the site of the tumor (e.g, intratumorally or to the tissue having the tumor) and the immunomodulator77MF-363552698Attorney Docket No.: 74444-20008.40(or one or more of a combination of immunomodulators) is administered locally to the site of the tumor (e.g., intratumorally or to the tissue having the tumor). In certain embodiments, the oncolytic virus is administered locally to the site of the tumor (e.g., intratumorally or to the tissue having the tumor), one or more immunomodulators is administered locally to the site of the tumor (e.g., intratumorally or to the tissue having the tumor), and one or more immunomodulators is administered systemically (e.g, intravenously).Solid and Lymphatic Tumors
[0177] In some embodiments, provided herein are methods of treating solid or lymphatic tumors. The methods described herein are applicable to a wide variety of solid or lymphatic tumors of all stages, including stages, I, II, III, and IV, according to the American Joint Committee on Cancer (AJCC) staging groups. In some embodiments, the solid or lymphatic tumor is an early stage cancer, a non-metastatic cancer, primary cancer, an advanced cancer, a locally advanced cancer, a metastatic cancer, a cancer in remission, a cancer in an adjuvant setting, or a cancer in a neoadjuvant setting. In some embodiments, the solid or lymphatic tumor is localized resectable, localized unresectable, or unresectable. In some embodiments, the solid or lymphatic tumor is localized resectable or borderline resectable. In some embodiments, the cancer has been refractory to prior therapy.
[0178] The methods described herein are applicable to solid or lymphatic tumors of a variety of cancer types including, but not limited to, Hodgkin lymphoma, non-Hodgkin lymphoma, acute myeloid leukemia, sarcomas and carcinomas such as esophageal carcinoma, stomach adenocarcinoma, liver hepatocellular carcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, Kaposi's sarcoma, soft tissue sarcoma, uterine sacronomasynovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, kidney chromophobe, adrenocortical carcinoma, pheochromocytoma, paraganglioma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, testicular germ cell tumors, lung carcinoma, lung adenocarcinoma, small cell lung carcinoma, bladder carcinoma, bladder urothelial carcinoma, epithelial carcinoma, glioma, astrocytoma,78MF-363552698Attorney Docket No.: 74444-20008.40 medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.
[0179] In some embodiments, the solid or lymphatic tumor is head and neck cancer. In some embodiments, the head and neck cancer is a squamous cell carcinoma in the head and neck (e.g., head and neck squamous cell carcinoma). In some embodiments, the head and neck cancer is a hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, metastatic squamous neck cancer with occult primary, nasopharyngeal cancer, oropharyngeal cancer, paranasal sinus and nasal cavity cancer, or salivary gland cancer. In some embodiments, the head and neck squamous cell cancer is an early stage head and neck cancer, non-metastatic head and neck cancer, advanced head and neck cancer, locally advanced head and neck cancer, metastatic head and neck cancer, head and neck cancer in remission, head and neck cancer in adjuvant setting, or head and neck cancer in neoadjuvant setting. In some embodiments, the head and neck cancer is in a neoadjuvant setting. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the head and neck tissue having the head and neck tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the head and neck tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the head and neck tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the head and neck tissue close to the head and neck tumor.
[0180] In some embodiments, the solid or lymphatic tumor is breast cancer. In some embodiments, the breast cancer is early stage breast cancer, non-metastatic breast cancer, advanced breast cancer, stage IV breast cancer, locally advanced breast cancer, metastatic breast cancer, breast invasive carcinoma, breast cancer in remission, breast cancer in an adjuvant setting, or breast cancer in a neoadjuvant setting. In some embodiments, the breast cancer is in a neoadjuvant setting. In some embodiments, the breast cancer is at an advanced stage. In some embodiments, the breast cancer (which may be HER2 positive or HER279MF-363552698Attorney Docket No.: 74444-20008.40 negative) includes, for example, advanced breast cancer, stage IV breast cancer, locally advanced breast cancer, and metastatic breast cancer. In some embodiments, the breast cancer is a triple negative breast cancer. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intramammary injection into the mammary tissue having the breast tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intramammary injection directly into the breast tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the breast tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intramammary injection into the mammary tissue close to the breast tumor.
[0181] In some embodiments, the cancer is renal cell carcinoma. In some embodiments, the renal cell carcinoma is an adenocarcinoma. In some embodiments, the renal cell carcinoma is a clear cell renal cell carcinoma (e.g., kidney renal clear cell carcinoma), papillary renal cell carcinoma (also called chromophilic renal cell carcinoma or kidney renal papillary cell carcinoma), chromophobe renal cell carcinoma, collecting duct renal cell carcinoma, granular renal cell carcinoma, mixed granular renal cell carcinoma, renal angiomyolipomas, or spindle renal cell carcinoma. In some embodiments, the renal cell carcinoma is at any of stage I, II, III, or IV, according to the American Joint Committee on Cancer (AJCC) staging groups. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrarenal injection into the renal tissue having the renal tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrarenal injection directly into the renal tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or80MF-363552698Attorney Docket No.: 74444-20008.40 the pretreatment composition is carried out by injection directly into metastatic sites of the renal tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrarenal injection into the renal tissue close to the renal tumor.
[0182] In some embodiments, the solid or lymphatic tumor is prostate cancer. In some embodiments, the prostate cancer is an adenocarcinoma (e.g., prostate adenocarcinoma). In some embodiments, the prostate cancer is a sarcoma, neuroendocrine tumor, small cell cancer, ductal cancer, or a lymphoma. In some embodiments, the prostate cancer is at any of the four stages, A, B, C, or D, according to the Jewett staging system. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraprostatic injection into the prostate tissue having the prostate tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraprostatic injection directly into the prostate tumor. In some embodiments, the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the prostate tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraprostatic injection into the prostate tissue close to the prostate tumor.
[0183] In some embodiments, the solid or lymphatic tumor is lung cancer. In some embodiments, the lung cancer is anon-small cell lung cancer (NSCLC). Examples ofNSCLC include, but are not limited to, large-cell carcinoma, adenocarcinoma (e.g., lung adenocarcinoma), neuroendocrine lung tumors, and squamous cell carcinoma (e.g., lung squamous cell carcinoma). In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrapulmonary injection into the lung tissue having the lung tumor. In some embodiments, the lung cancer is small cell lung cancer (SCLC). In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrapulmonary injection directly into the lung tumor. In some81MF-363552698Attorney Docket No.: 74444-20008.40 embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the lung tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrapulmonary injection into the lung tissue close to the lung tumor.
[0184] In some embodiments, the solid or lymphatic tumor is melanoma. In some embodiments, the melanoma is superficial spreading melanoma, lentigo maligna melanoma, nodular melanoma, mucosal melanoma, polypoid melanoma, desmoplastic melanoma, amelanotic melanoma, soft-tissue melanoma, skin cutaneous melanoma, uveal melanoma, or acral lentiginous melanoma. In some embodiments, the melanoma is at any of stage I, II, III, or IV, according to the American Joint Committee on Cancer (AJCC) staging groups. In some embodiments, the melanoma is recurrent. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the skin tissue having the melanoma tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the melanoma tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the melanoma tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the lung tissue close to the melanoma tumor.
[0185] In some embodiments, the solid or lymphatic tumor is ovarian cancer. In some embodiments, the ovarian cancer is ovarian epithelial cancer. In some embodiments, the ovarian cancer is ovarian serous cystadenocarcinoma. In some embodiments, the ovarian cancer is stage I (e.g, stage IA, IB, or IC), stage II (e.g, stage HA, HB, or IIC), stage III (e.g, stage IIIA, HIB, or HIC), or stage IV. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraovarian82MF-363552698Attorney Docket No.: 74444-20008.40 injection into the ovarian tissue having the ovarian tumor. In some embodiments, the administration of the oncolytic virus, and / the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraovarian injection directly into the ovarian tumor. In some embodiments, the administration of the oncolytic virus, and / the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the ovarian tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraovarian injection into the ovarian tissue close to the ovarian tumor.
[0186] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is pancreatic cancer. In some embodiments, the pancreatic cancer is a seous cystic neoplasm, mucinous cystic neoplasm, intraductal papillary mucinous neoplasm, pancreatic adenocarcinoma, adenosquamous carcinoma, squamous cell carcinoma, signet ring cell carcinoma, undifferentiated carcinoma, undifferentiated carcinoma with giant cells, solid pseudopapillary neoplasm, ampullary cancer, or pancreatic neuroendocrine tumor. In some embodiments, the pancreatic cancer is a pancreatic adenocarcinoma. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrapancreatic injection into the pancreatic tissue having the pancreatic tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrapancreatic injection directly into the pancreatic tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the pancreatic tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrapancreatic injection into the pancreatic tissue close to the pancreatic tumor.
[0187] In some embodiments, the solid or lymphatic tumor is endometrial cancer. In some embodiments, the endometrial cancer is adenocarcinoma, carcinosarcoma, squamous cell carcinoma, undifferentiated carcinoma, small cell carcinoma, transitional carcinoma,83MF-363552698Attorney Docket No.: 74444-20008.40 uterine corpus endometrial carcinoma. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraendometrial injection into the endometrial tissue having the endometrial tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraendometrial injection directly into the endometrial tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the endometrial tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intraendometrial injection into the endometrial tissue close to the endometrial tumor.
[0188] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is colorectal cancer. In some embodiments, the colorectal cancer is adenocarcinoma (e.g., rectum adenocarcinoma or colon adenocarcinoma), gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, leiomysarcoma, melanoma, or squamous cell carcinoma. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the colorectal tissue having the colorectal tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the colorectal tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the colorectal tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the colorectal tissue close to the colorectal tumor.
[0189] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is hepatocellular carcinoma (HCC). In some embodiments, the HCC is84MF-363552698Attorney Docket No.: 74444-20008.40 early stage HCC, non-metastatic HCC, primary HCC, advanced HCC, locally advanced HCC, metastatic HCC, HCC in remission, or recurrent HCC. In some embodiments, the HCC is localized resectable (i.e., tumors that are confined to a portion of the liver that allows for complete surgical removal), localized unresectable (i.e., the localized tumors may be unresectable because crucial blood vessel structures are involved or because the liver is impaired), or unresectable (i.e., the tumors involve all lobes of the liver and / or has spread to involve other organs (e.g, lung, lymph nodes, bone). In some embodiments, the HCC is, according to TNM classifications, a stage I tumor (single tumor without vascular invasion), a stage II tumor (single tumor with vascular invasion, or multiple tumors, none greater than 5 cm), a stage III tumor (multiple tumors, any greater than 5 cm, or tumors involving major branch of portal or hepatic veins), a stage IV tumor (tumors with direct invasion of adjacent organs other than the gallbladder, or perforation of visceral peritoneum), N1 tumor (regional lymph node metastasis), or Ml tumor (distant metastasis). In some embodiments, the HCC is, according to AJCC (American Joint Commission on Cancer) staging criteria, stage Tl, T2, T3, or T4 HCC. In some embodiments, the HCC is any one of liver cell carcinomas, fibrolamellar variants of HCC, and mixed hepatocellular cholangiocarcinomas. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrahepatic injection into the liver tissue having the HCC. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrahepatic injection directly into the HCC. In some embodiments, the administration of the oncolytic virus, and / the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the HCC. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrahepatic injection into the tissue close to the HCC.
[0190] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is lymphoma. In some embodiments, the lymphoma is a B-cell neoplasm, a T-cell neoplasm, and / or a putative NK-cell neoplasm. Examples of B-cell neoplasms include, but are not limited to, precursor B-cell neoplasms (e.g, precursor B-lymphoblastic leukemia / lymphoma) and peripheral B-cell neoplasms (e.g, B-cell chronic lymphocytic85MF-363552698Attorney Docket No.: 74444-20008.40 leukemia / prolymphocytic leukemia / small lymphocytic lymphoma (small lymphocytic (SL) NHL), lymphoplasmacytoid lymphoma / immunocytoma, mantel cell lymphoma, follicle center lymphoma, follicular lymphoma (e.g, cytologic grades: I (small cell), II (mixed small and large cell), III (large cell) and / or subtype: diffuse and predominantly small cell type), low grade / follicular non-Hodgkin’s lymphoma (NHL), intermediate grade / follicular NHL, marginal zone B-cell lymphoma (e.g, extranodal (e.g, MALT-type + / - monocytoid B cells) and / or Nodal (e.g, + / - monocytoid B cells)), splenic marginal zone lymphoma (e.g, + / - villous lymphocytes), Hairy cell leukemia, plasmacytoma / plasma cell myeloma (e.g, myeloma and multiple myeloma), diffuse large B-cell lymphoma (e.g, primary mediastinal (thymic) B-cell lymphoma or lymphoid neoplasm diffuse large B-cell lymphoma), intermediate grade diffuse NHL, Burkitt’s lymphoma, High-grade B-cell lymphoma, Burkitt- like, high grade immunoblastic NHL, high grade lymphoblastic NHL, high grade small noncleaved cell NHL, bulky disease NHL, AIDS-related lymphoma, and Waldenstrom’s macroglobulinemia). Examples of T-cell and / or putative NK-cell neoplasms include, but are not limited to, precursor T-cell neoplasm (precursor T-lymphoblastic lymphoma / leukemia) and peripheral T-cell and NK-cell neoplasms (e.g, T-cell chronic lymphocytic leukemia / prolymphocytic leukemia, and large granular lymphocyte leukemia (LGL) (e.g, T- cell type and / or NK-cell type), cutaneous T-cell lymphoma (e.g, mycosis fungoides / Sezary syndrome), primary T-cell lymphomas unspecified (e.g, cytological categories (e.g, medium-sized cell, mixed medium and large cell), large cell, lymphoepitheloid cell, subtype hepatosplenic y5 T-cell lymphoma, and subcutaneous panniculitic T-cell lymphoma), angioimmunoblastic T-cell lymphoma (AILD), angiocentric lymphoma, intestinal T-cell lymphoma (e.g, + / - enteropathy associated), adult T-cell lymphoma / leukemia (ATL), anaplastic large cell lymphoma (ALCL) (e.g, CD30+, T- and null-cell types), anaplastic large-cell lymphoma, and Hodgkin’s like). In some embodiments, the lymphoma is Hodgkin’s disease or Non-Hodgkin Lymphoma (NHL). For example, the Hodgkin’s disease may be lymphocyte predominance, nodular sclerosis, mixed cellularity, lymphocyte depletion, and / or lymphocyte-rich. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intralymphatic injection into the lymph node having the lymphatic tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of86MF-363552698Attorney Docket No.: 74444-20008.40 immunomodulators), and / or the pretreatment composition is carried out by intralymphatic injection directly into the lymphatic tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the lymphatic tumor. In some embodiments, the administration of the oncolytic virus, and / the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intralymphatic injection into the tissue close to the lymphatic tumor.
[0191] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is mesothelioma. In some embodiments, the mesothelioma is pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma, or mesothelioma affecting mesothelial tissue covering other organs. In some embodiments, the mesothelioma is benign mesothelioma or malignant mesothelioma. In some embodiments, the mesothelioma is epithelial mesothelioma, sarcomatoid mesothelioma, biphasic mesothelioma, or papillary mesothelioma. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the mesothelial tissue having the mesothelioma. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the mesothelioma. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the mesothelioma. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the mesothelial tissue close to the mesothelioma.
[0192] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is brain tumor. In some embodiments, the brain tumor is primary brain tumor or secondary (or metastatic) brain tumor. In some embodiments, the brain tumor is glioma (such as astrocytoma, oligodendroglioma, glioblastoma multiforme, brain lower grade glioma, or ependymoma), meningioma, Schwannoma, craniopharyngioma, germ cell tumor, or pineal region tumor. In some embodiments, the immunomodulator (or combination of87MF-363552698Attorney Docket No.: 74444-20008.40 immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the brain tissue having the brain tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the brain tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the brain tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the brain tissue close to the brain tumor.
[0193] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is gallbladder and bile duct tumor. In some embodiments, the gallbladder and bile duct tumor is carcinoma, adenocarcinoma, cholangiocarcinoma, papillary tumor, small cell (neuroendocrine) carcinoma, adenosquamous carcinoma, or rhabdomyosarcoma. In some embodiments, the gallbladder and bile duct tumor is gallbladder carcinoma, carcinoma of extrahepatic bile duct, or carcinoma of intrahepatic bile duct. In some embodiments, the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the gallbladder or bile duct tissue having the gallbladder and bile duct tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the gallbladder and bile duct tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the gallbladder and bile duct tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the gallbladder or bile duct tissue close to the gallbladder and bile duct tumor.
[0194] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is soft tissue sarcoma. In some embodiments, the soft tissue sarcoma is88MF-363552698Attorney Docket No.: 74444-20008.40 adult fibrosarcoma, alveolar soft-part sarcoma, angiosarcoma, clear cell sarcoma, desmoplastic small round cell tumor, epitheloid sarcoma, fibromyxoid sarcoma, liposarcoma, malignant mesenchymoma, malignant peripheral nerve sheath tumor (e.g, neurofibrosarcoma, malignant schwannoma, or neurogenic sarcoma), myxofibrosarcoma, synovial sarcoma, undifferentiated pleomorphic sarcoma, dermatofibrosarcoma protuberan, fibromatosis, hemangioendothelioma, infantile fibrosarcoma, solitary fibrous tumor, elastofibroma, fibroma, fibrous histocytoma, glomus tumor, granular cell tumor, hemangioma, hibernoma, lipoma, leiomyoma, leiomyoma, lipoblastoma, lymphangioma, myxoma, neurofibroma, neuroma, PEComa, rhabdomyoma, schwannoma, tenosynovial giant cell tumor, spindle cell tumor, or tumor-like conditions of soft tissue. In some embodiments, or the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the tissue having the soft tissue sarcoma. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the soft tissue sarcoma. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the soft tissue sarcoma. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the tissue close to the soft tissue sarcoma.
[0195] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is uterine tumor. In some embodiments, the uterine tumor is uterine carcinoma, uterine corpus endometrial carcinoma, uterine sarcoma (such as endometrial stromal sarcoma, undifferentiated sarcoma, or uterine leiomyosarcoma), or uterine carcinosarcoma (such as malignant mixed mesodermal tumor, or malignant mixed mullerian tumor). In some embodiments, the uterine tumor is a fibroid tumor, such as leiomyoma, adenofibroma, or adenomyoma. In some embodiments, or the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrauterine89MF-363552698Attorney Docket No.: 74444-20008.40 injection into the uterine tissue having the uterine tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrauterine injection directly into the uterine tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the uterine tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intrauterine injection into the uterine tissue close to the uterine tumor.
[0196] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is cervical tumor. In some embodiments, the cervical tumor is squamous cell carcinoma (e.g., cervical squamous cell carcinoma), adenocarcinoma, adenosquamous carcinoma, or endocervical adenocarcinoma. In some embodiments, or the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intracervical injection into the cervical tissue having the cervical tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intracervical injection directly into the cervical tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the cervical tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by intracervical injection into the cervical tissue close to the cervical tumor.
[0197] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is thyroid tumor. In some embodiments, the thyroid tumor is differentiated thyroid tumor (such as papillary carcinoma, follicular carcinoma, or Hurthle cell carcinoma), thymoma, thyroid carcinoma, medullary thyroid carcinoma, anaplastic carcinoma, thyroid lymphoma, thyroid sarcoma, or parathyroid tumor. In some embodiments, or the immunomodulator (or combination of immunomodulators) is administered90MF-363552698Attorney Docket No.: 74444-20008.40 intravenously. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the thyroid tissue having the thyroid tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the thyroid tumor. In some embodiments, the administration of the oncolytic virus, and / or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the thyroid tumor. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the thyroid tissue close to the thyroid tumor.
[0198] In some embodiments, according to any of the methods described above, the solid or lymphatic tumor is nasopharyngeal carcinoma. In some embodiments, the nasopharyngeal carcinoma is keratinizing squamous cell carcinoma, non-keratinizing differentiated carcinoma, or undifferentiated carcinoma (e.g, lymphoepithelioma), oral cavity and oropharyngeal tumor, nasal cavity and paranasal sinus tumor, or salivary gland tumor. In some embodiments, or the immunomodulator (or combination of immunomodulators) is administered intravenously. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the nasopharyngeal tissue having the nasopharyngeal carcinoma. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into the nasopharyngeal carcinoma. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection directly into metastatic sites of the nasopharyngeal carcinoma. In some embodiments, the administration of the oncolytic virus, and / or or the immunomodulator (or combination of immunomodulators), and / or the pretreatment composition is carried out by injection into the nasopharyngeal tissue close to the nasopharyngeal carcinoma.Methods of Treating Bladder Cancer by Intravesical Administrations
[0199] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising (a) determining: (1) a level of a coxsackie adenovirus91MF-363552698Attorney Docket No.: 74444-20008.40 receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and (b) administering to the individual an effective amount of the oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. In some embodiments, the level of the CXADR gene or one or more Rb / E2F pathway genes is a level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In certain embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In some embodiments, the bladder cancer is muscle invasive bladder cancer (MIBC). In certain embodiments wherein the bladder cancer is MIBC, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some92MF-363552698Attorney Docket No.: 74444-20008.40 embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual is BCG unresponsive, has bladder cancer recurrence subsequent to BCG treatment, and / or has failed BCG treatment within about 6 months of the start of BCG treatment. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the oncolytic virus is administered as a single therapeutic agent. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator, such as any of the immunomodulators described herein. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0200] In some embodiments, provided herein a method of treating bladder cancer in an individual, the method comprising administering to the individual an effective amount of an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level of a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises93MF-363552698Attorney Docket No.: 74444-20008.40 determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F- 1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In certain embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In some embodiments, the bladder cancer is muscle invasive bladder cancer (MIBC). In certain embodiments wherein the bladder cancer is MIBC, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual is BCG unresponsive, has bladder cancer recurrence subsequent to BCG treatment, and / or has failed BCG treatment within about 6 months of the start of BCG treatment. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months.94MF-363552698Attorney Docket No.: 74444-20008.40In certain embodiments, the induction phase is repeated at least once. In some embodiments, the oncolytic virus is administered as a single therapeutic agent. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator, such as any of the immunomodulators described herein. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g., an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0201] In some embodiments, provided herein is an oncolytic virus for use in a method of treating bladder cancer in an individual, wherein the method comprises administering an effective amount of the oncolytic virus to the individual, and wherein: (1) the level of the coxsackie adenovirus receptor (CXADR) gene in a biological sample of the individual exceeds a control level of the CXADR gene; and / or (2) the level of each of one or more Rb / E2F pathway genes in a biological sample of the individual exceeds or is lower than a control level of the same Rb / E2F pathway gene; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of, E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g., a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a predetermined level of the same gene, a level of the same gene in a healthy individual or95MF-363552698Attorney Docket No.: 74444-20008.40 population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in anon-cancerous sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In certain embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In some embodiments, the bladder cancer is muscle invasive bladder96MF-363552698Attorney Docket No.: 74444-20008.40 cancer (MIBC). In certain embodiments wherein the bladder cancer is MIBC, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual is BCG unresponsive, has bladder cancer recurrence subsequent to BCG treatment, and / or has failed BCG treatment within about 6 months of the start of BCG treatment. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the oncolytic virus is administered as a single therapeutic agent. In other embodiments, the method further comprises administering to the individual an effective amount of an immunomodulator, such as any of the immunomodulators described herein. In certain embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody).
[0202] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; (b) administering to the individual an effective amount of the oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes; and (c) administering to the individual an effective amount of an immunomodulator. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2,97MF-363552698Attorney Docket No.: 74444-20008.40RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (pl6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining the level and / or a mutation of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e , GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In certain embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In some embodiments, the bladder cancer is muscle invasive bladder cancer (MIBC). In certain embodiments wherein the bladder cancer is MIBC, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual is BCG unresponsive, has bladder cancer recurrence subsequent to BCG treatment, and / or has failed BCG treatment within about 6 months of the start of BCG treatment. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is98MF-363552698Attorney Docket No.: 74444-20008.40 administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g., an inhibitor if PD-1 such as an anti-PD-1 antibody). In some embodiments, the immunomodulator is administered locally (e.g., intratumorally or intravesically). In other embodiments, the immunomodulator is administered systemically (e.g, intravenously).
[0203] In some embodiments, provided herein a method of treating bladder cancer in an individual, the method comprising (a) administering to the individual an effective amount of an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, and (b) administering to the individual an effective amount of an immunomodulator; wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level of a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F- 1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTa[3). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid99MF-363552698Attorney Docket No.: 74444-20008.40 encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In certain embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In some embodiments, the bladder cancer is muscle invasive bladder cancer (MIBC). In certain embodiments wherein the bladder cancer is MIBC, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual is BCG unresponsive, has bladder cancer recurrence subsequent to BCG treatment, and / or has failed BCG treatment within about 6 months of the start of BCG treatment. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N-Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g, an inhibitor if PD-1 such as an anti-PD-1 antibody). In some embodiments, the immunomodulator is administered locally (e.g, intratumorally or intravesically). In other embodiments, the immunomodulator is administered systemically (e.g, intravenously).
[0204] In some embodiments, provided herein is a combination for use in a method of treating bladder cancer in an individual, wherein the combination comprises an oncolytic virus and an immunomodulator, wherein the method comprises (a) administering an effective amount of the oncolytic virus to the individual, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, and (b) administering an effective amount of the immunomodulator to the individual, and wherein: (1) the level of the coxsackie adenovirus100MF-363552698Attorney Docket No.: 74444-20008.40 receptor (CXADR) gene in a biological sample of the individual exceeds a control level of the CXADR gene; and / or (2) the level of each of one or more Rb / E2F pathway genes in a biological sample of the individual exceeds or is lower than a control level of the same Rb / E2F pathway gene. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (pl6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of, E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the101MF-363552698Attorney Docket No.: 74444-20008.40 same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In certain embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the oncolytic virus comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus (e.g, El A, E1B, and / or E4). In some embodiments, wherein the viral vector comprises an exogenous nucleic acid encoding a heterologous immune-related molecule (e.g, GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, or LTaP). In certain embodiments, the exogenous nucleic acid encoding the immune-related molecule is operably linked to a viral promoter (e.g, an adenoviral E3 promoter). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In certain embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In some embodiments, the bladder cancer is muscle invasive bladder cancer (MIBC). In certain embodiments wherein the bladder cancer is MIBC, the individual is ineligible for or has refused cisplatin-based chemotherapy. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual is BCG unresponsive, has bladder cancer recurrence subsequent to BCG treatment, and / or has failed BCG treatment within about 6 months of the start of BCG treatment. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus, such as a transduction enhancing agent (e.g, N- Dodecyl-P-D-maltoside (DDM)). In some embodiments, the oncolytic virus is administered102MF-363552698Attorney Docket No.: 74444-20008.40 at a dose of about 1 x 108to about lx 1014viral particles. In some embodiments, the oncolytic virus is administered weekly and / or is administered for about 1 week to about 6 weeks. In some embodiments, the oncolytic virus is administered during an induction phase followed by a maintenance phase. In certain embodiments, the induction phase and the maintenance phase are separated by about three to about six months. In certain embodiments, the induction phase is repeated at least once. In some embodiments, the immunomodulator is an immune checkpoint inhibitor (e.g., an inhibitor if PD-1 such as an anti-PD-1 antibody). In some embodiments, the immunomodulator is administered locally (e.g., intratumorally or intravesically). In other embodiments, the immunomodulator is administered systemically (e.g, intravenously).
[0205] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and (b) intravesically administering to the individual an effective amount of cretostimogene based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the sample is a tumor sample (e.g, a biopsy). In some embodiments, the method comprises determining a level of a CXADR gene polypeptide and / or a level and / or a mutation of each of one or more Rb / E2F pathway gene polypeptides. In certain embodiments, determining the level of the CXADR gene polypeptide and / or the level of each of the one or more Rb / E2F pathway gene polypeptides comprises immunohistochemistry. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In some embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In certain embodiments, the bladder cancer comprises CIS and does not comprise concurrent Ta or T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent Ta stage103MF-363552698Attorney Docket No.: 74444-20008.40 bladder cancer but does not comprise concurrent T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent T1 stage bladder cancer but does not comprise concurrent Ta stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent Ta and / or T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises Ta and / or T1 stage bladder cancer but does not comprise concurrent CIS. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual has failed BCG treatment (i.e., experienced persistent bladder cancer or bladder cancer recurrence despite BCG treatment) within about 12 months of completing BCG therapy. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises intravesically administering N-Dodecyl-P-D-maltoside (DDM) (e.g., 5% DDM) prior to administration of cretostimogene. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 1011to about lx 1013viral particles (e.g., about 1 x 1012). In some embodiments, cretostimogene is administered once per week for six weeks during an induction phase. In certain embodiments, if the individual has persistent high-grade NMIBC (e.g, about 13 weeks after the start of treatment), cretostimogene is further administered once per week for six weeks during a second induction phase. In some embodiments, the induction phase or second induction phase is followed by a maintenance phase. In some embodiments, cretostimogene is administered to the individual once per week for three weeks during the maintenance phase. In certain embodiments, cretostimogene is administered to the individual once per week for three weeks every three to six months during the maintenance phase.
[0206] In some embodiments, provided herein a method of treating bladder cancer in an individual, the method comprising intravesically administering to the individual an effective amount of cretostimogene, wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level of a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4,104MF-363552698Attorney Docket No.: 74444-20008.40CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the sample is a tumor sample (e.g, a biopsy). In some embodiments, the method comprises determining a level of a CXADR gene polypeptide and / or a level and / or a mutation of each of one or more Rb / E2F pathway gene polypeptides. In certain embodiments, determining the level of the CXADR gene polypeptide and / or the level of each of the one or more Rb / E2F pathway gene polypeptides comprises immunohistochemistry. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In some embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In certain embodiments, the bladder cancer comprises CIS and does not comprise concurrent Ta or T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent Ta stage bladder cancer but does not comprise concurrent T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent T1 stage bladder cancer but does not comprise concurrent Ta stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent Ta and / or T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises Ta and / or T1 stage bladder cancer but does not comprise concurrent CIS. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual has failed BCG treatment (i.e., experienced persistent bladder cancer or bladder cancer recurrence despite BCG treatment) within about 12 months of completing BCG therapy. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or intravesically. In some embodiments, the method further comprises intravesically administering N-Dodecyl-P-D-maltoside (DDM) (e.g, 5% DDM) prior to administration of cretostimogene. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 1011to about lx 1013viral particles (e.g, about 1 x 1012). In some embodiments, cretostimogene is administered once per week for six weeks during an induction phase. In certain embodiments, if the individual has persistent high-grade NMIBC (e.g, about 13 weeks after the start of treatment), cretostimogene is further administered once per week for six weeks during a second induction phase. In some embodiments, the induction phase or second induction phase is followed by a maintenance phase. In some embodiments, cretostimogene is administered to the individual once per week for three weeks during the105MF-363552698Attorney Docket No.: 74444-20008.40 maintenance phase. In certain embodiments, cretostimogene is administered to the individual once per week for three weeks every three to six months during the maintenance phase.
[0207] In some embodiments, provided herein is an oncolytic virus for use in a method of treating bladder cancer in an individual, wherein the method comprises intravesically administering an effective amount of the oncolytic virus to the individual, wherein the oncolytic virus is cretostimogene, and wherein: (1) the level of the coxsackie adenovirus receptor (CXADR) gene in a biological sample of the individual exceeds a control level of the CXADR gene; and / or (2) the level of each of one or more Rb / E2F pathway genes in a biological sample of the individual exceeds or is lower than a control level of the same Rb / E2F pathway gene. The level of the CXADR gene and / or the level of each of the one or more Rb / E2F pathway genes in the biological sample may be determined by any means described herein. In some embodiments, the method comprises determining a level and / or a mutation of one or more Rb / E2F pathway genes selected from the group comprising E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, CDKN2D. In some embodiments, the method comprises determining a level of E2F1. In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of, E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (p!6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, and the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level (e.g, a pre-determined level of the same gene, a level of the same gene in a healthy individual or population of individuals, or a level of the same gene in a non-cancerous sample from the individual). In some embodiments, the level of each of one or more of E2F1, E2F2, E2F3, E2F4, or E2F5 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of RBI, RB2, or RB3 in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous106MF-363552698Attorney Docket No.: 74444-20008.40 sample. In some embodiments, the level of each of one or more of CCND1, CCND2, or CCND3 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CCNE1 or CCNE2 in a solid or lymphatic tumor sample is higher than the level of the same gene in a non-cancerous sample. In some embodiments, the level of each of one or more of CDK2, CDK4, or CDK6 in a solid or lymphatic tumor sample is higher than the level of each of the same gene in a non-cancerous sample. In some embodiments, the control level is a baseline level of steady-state gene expression or gene activity under normal, unstimulated, unstressed conditions in healthy samples / subjects, or pre-treatment conditions. In some embodiments, the level of each of one or more of CDKN2A, CDKN2B, CDKN2C, or CDKN2D in a solid or lymphatic tumor sample is lower than the level of the same gene in a non-cancerous sample. In some embodiments, the sample is a tumor sample (e.g, a biopsy). In some embodiments, the method comprises determining a level of a CXADR gene polypeptide and / or a level and / or a mutation of each of one or more Rb / E2F pathway gene polypeptides. In certain embodiments, determining the level of the CXADR gene polypeptide and / or the level of each of the one or more Rb / E2F pathway gene polypeptides comprises immunohistochemistry. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer (NMIBC). In some embodiments wherein the bladder cancer is NMIBC, the bladder cancer comprises carcinoma in situ (CIS), Ta stage bladder cancer, T1 stage bladder cancer, or any combination thereof. In certain embodiments, the bladder cancer comprises CIS and does not comprise concurrent Ta or T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent Ta stage bladder cancer but does not comprise concurrent T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent T1 stage bladder cancer but does not comprise concurrent Ta stage bladder cancer. In certain embodiments, the bladder cancer comprises CIS and concurrent Ta and / or T1 stage bladder cancer. In certain embodiments, the bladder cancer comprises Ta and / or T1 stage bladder cancer but does not comprise concurrent CIS. In some embodiments, has previously been treated with a Bacillus Calmette-Guerin (BCG). In certain embodiments, the individual has failed BCG treatment (i.e., experienced persistent bladder cancer or bladder cancer recurrence despite BCG treatment) within about 12 months of completing BCG therapy. In some embodiments, the individual has not received a cystectomy. In certain embodiments, the individual has refused or is ineligible for a cystectomy. In some embodiments, the oncolytic virus is administered intratumorally or107MF-363552698Attorney Docket No.: 74444-20008.40 intravesically. In some embodiments, the method further comprises intravesically administering N-Dodecyl-P-D-maltoside (DDM) (e.g., 5% DDM) prior to administration of cretostimogene. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 1011to about lx 1013viral particles (e.g., about 1 x 1012). In some embodiments, cretostimogene is administered once per week for six weeks during an induction phase. In certain embodiments, if the individual has persistent high-grade NMIBC (e.g, about 13 weeks after the start of treatment), cretostimogene is further administered once per week for six weeks during a second induction phase. In some embodiments, the induction phase or second induction phase is followed by a maintenance phase. In some embodiments, cretostimogene is administered to the individual once per week for three weeks during the maintenance phase. In certain embodiments, cretostimogene is administered to the individual once per week for three weeks every three to six months during the maintenance phase.
[0208] In some...
Claims
Attorney Docket No.: 74444-20008.40CLAIMSWhat is claimed is:
1. A method of treating a solid or lymphatic tumor in an individual, the method comprising: (a) determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual; and (b) administering to the individual an effective amount of an oncolytic virus based on the level of the CXADR gene and / or the level of each of one or more Rb / E2F pathway genes, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus.
2. A method of treating a solid or lymphatic tumor in an individual, the method comprising administering to the individual an effective amount of an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus, wherein the individual is selected based on a level of a coxsackie adenovirus receptor (CXADR) gene and / or a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual.
3. A method of selecting an individual having a solid or lymphatic tumor for treatment with an oncolytic virus, the method comprising determining: (1) a level of a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual, wherein the individual is selected for the treatment with the oncolytic virus based on:(1) the level of the CXADR gene, and / or(2) the level and / or the mutation of each of the one or more Rb / E2F pathway genes; wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus.
4. The method of claim 3, wherein the individual is determined as one who may benefit from treatment with the oncolytic virus if:(1) the level of the CXADR gene exceeds a control level of the CXADR gene; and / or160MF-363552698Attorney Docket No.: 74444-20008.40(2) the level of each of the one or more Rb / E2F pathway genes exceeds or is lower than a control level of the same Rb / E2F pathway gene, optionally wherein: a) the level of free, active E2F1 exceeds a control level of free, active E2F1; b) the level of functional Rb is lower than a control level of Rb; c) the level of Cyclin D exceeds a control level of Cyclin D; d) the level of CDK4 exceeds a control level of CDK4; e) the level of CDK6 exceeds a control level of CDK6; f) the level of CDKN2A is lower than a control level of CDKN2A; or g) any combination of (a)-(f).
5. The method of claim 4, wherein the one or more Rb / E2F pathway gene is selected from the group consisting of:(1) E2F1, E2F2, E2F3, E2F4, E2F5, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, and CDK6, wherein the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes exceeds a control level, optionally wherein the Rb / E2F pathway gene is E2F1; or(2) wherein the one or more Rb / E2F pathway gene is selected from the group consisting of RBI, RB2, RB3, CDKN2A (pl6 / INK4A), CDKN2B, CDKN2C, and CDKN2D, wherein the individual is determined as one who may benefit from treatment with the oncolytic virus if the level of each of the one or more Rb / E2F pathway genes is lower than a control level.
6. The method of claim 4, wherein:(1) the control level of the of the CXADR gene is: a) a pre-determined level of the CXADR gene; b) the level of the CXADR gene in a healthy individual or a healthy population of individuals; or c) the level of the CXADR gene in non-cancerous sample from the individual, and / or(2) the control level of each of the one or more Rb / E2F pathway genes is: a) a pre-determined level of the same Rb / E2F pathway gene;161MF-363552698Attorney Docket No.: 74444-20008.40 b) the level of the same Rb / E2F pathway gene in a healthy individual or a healthy population of individuals; or c) the level of the same Rb / E2F pathway gene in non-cancerous sample from the individual.
7. The method of any one of claims 1-6, wherein the sample is a solid or lymphatic tumor sample.
8. The method of any one of claims 1-7, wherein the one or more Rb / E2F pathway genes are selected from the group consisting of E2 transcription factor 1 (E2F1), E2F2, E2F3, E2F4, E2F5, RBI, RB2, RB3, CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, CDKN2A (pl6 / INK4A), CDKN2B, CDKN2C, CDKN2D.
9. The method of claim 8, wherein the one or more Rb / E2F pathway genes comprise E2F1 and RBI.
10. The method of any one of claims 1-9, wherein the method comprises determining a level of a coxsackie adenovirus receptor (CXADR) gene.
11. The method of claim 10, wherein determining the level of the CXADR gene comprises determining the level of a CXADR gene polynucleotide.
12. The method of claim 11, wherein the polynucleotide is RNA.
13. The method of claim 12, wherein determining the level of the CXADR gene polynucleotide comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, nucleic acid-based microarray technology, or any combination thereof.
14. The method of any one of claims 10-13, wherein determining the level of the CXADR gene comprises determining the level of a CXADR gene polypeptide.162MF-363552698Attorney Docket No.: 74444-20008.4015. The method of claim 14, wherein determining the level of the CXADR gene polypeptide comprises immunohistochemistry, enzyme-linked immunoassay (ELISA), high- throughput Luminex-multiplex based assays, flow-cytometry based assays, high-throughput- multiplexed Proximity Extension Assay (PEA) technology -based protein analysis, or a combination thereof.
16. The method of any one of claims 1-15, wherein the method comprises determining a level and / or a mutation of each of one or more Rb / E2F pathway genes.
17. The method of claim 16, wherein determining the level of each of the one or more Rb / E2F pathway genes comprises determining the level of one or more Rb / E2F pathway gene polynucleotides.
18. The method of claim 17, wherein the polynucleotide is DNA.
19. The method of claim 18, wherein the level of the one or more Rb / E2F pathway gene polynucleotides is a copy number of the one or more Rb / E2F pathway gene.
20. The method of claims 18-19, wherein determining the level and / or the mutation of the one or more Rb / E2F pathway gene polynucleotides comprises DNA sequencing including but not limited to next-generation sequencing (NGS) based technology, whole-genome sequencing (WGS), or targeted sequencing panel analysis, PCR, in-situ hybridization, or any combination thereof.
21. The method of claim 16, wherein the method comprises determining a mutation of one or more Rb / E2F pathway genes.
22. The method of claim 17, wherein the polynucleotide is RNA.
23. The method of claim 22, wherein the determining the level of the of one or more Rb / E2F pathway gene polynucleotides comprises RNA sequencing, whole-exome sequencing (WES), NanoString, RT-PCR, in-situ hybridization, nucleic acid-based microarray technology, or any combination thereof.163MF-363552698Attorney Docket No.: 74444-20008.4024. The method of any one of claims 16-18 or 22, wherein determining the level of each of the one or more Rb / E2F pathway genes comprises determining the level of one or more Rb / E2F pathway gene polypeptides.
25. The method of claim 24, wherein the determining the level of the one or more Rb / E2F pathway gene polypeptides comprises antibody-based immunoassays including but not limited to immunohistochemistry, enzyme-linked immunoassay (ELISA), high-throughput Luminex-multiplex based assays, flow-cytometry based assays, high-throughput-multiplexed Proximity Extension Assay (PEA) technology-based protein analysis, or a combination thereof.
26. The method of any one of claims 1-25 wherein the solid or lymphatic tumor is bladder cancer.
27. The method of claim 26, wherein the bladder cancer is non-muscle invasive bladder cancer (NMIBC).
28. The method of claim 26, wherein the bladder cancer is muscle invasive bladder cancer (MIBC).
29. The method of any one of claims 26-28, wherein the individual has previously been treated with a Bacillus Calmette-Guerin (BCG).
30. The method of any one of claims 26-29, wherein the individual has not received a cystectomy.
31. The method of any one of claims 1-30, wherein the oncolytic adenovirus is an adenovirus serotype 5, and wherein the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTaP; optionally wherein the immune-related molecule is human GM-CSF.164MF-363552698Attorney Docket No.: 74444-20008.4032. The method of claim 1-31, wherein the viral gene essential for replication of the virus is selected from the group consisting of El A, E1B, and E4.
33. The method of any one of claims 1-32, wherein the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of the adenovirus serotype 5 is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF.
34. The method of any one of claims 1-33, wherein the oncolytic virus is administered: a) directly into the tumor, or b) to the tissue having the tumor.
35. The method of any one of claims 1-34, further comprising locally administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus.
36. The method of any one of claims 1-35, wherein the oncolytic virus is administered at a dose of about 1 x 108to about lx 1014viral particles.
37. The method of any one of claims 1-36, wherein the oncolytic virus is administered weekly.
38. The method of any one of claims 1-37, wherein the oncolytic virus is administered during an induction phase followed by a maintenance phase.
39. The method of any one of claims 1-38, wherein the oncolytic virus is administered as a single therapeutic agent.
40. The method of any one of claims 1-39, further comprising administering to the individual an effective amount of an immunomodulator.
41. The method of claim 40, wherein the immunomodulator is a modulator of an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof.165MF-363552698Attorney Docket No.: 74444-20008.4042. A kit for treating a solid or lymphatic tumor in an individual, the kit comprising:(a) one or more agents for determining: (1) a level of the one a coxsackie adenovirus receptor (CXADR) gene, and / or (2) a level and / or a mutation of each of one or more Rb / E2F pathway genes in a biological sample of the individual;(b) an oncolytic virus, wherein the oncolytic virus is an adenovirus and comprises a viral vector comprising an E2F-1 promoter operably linked to a viral gene essential for replication of the virus; and(c) a device for administering the oncolytic virus.166MF-363552698